'cause	'cause	IN	256
'd	'd	MD	8493
'd	'd	NNP	223
'em	'em	NNP	15
'em	'em	PRP	378
'll	'll	MD	7624
'm	be	VBP	19080
'n	'n	NNP	20
'n'	'n'	CC	187
're	be	VBP	12606
's	's	NNP	48
's	's	POS	103837
's	's	PRP	473
's	be	VBZ	56517
't	't	NN	193
'til	'til	IN	22
've	have	VB	408
've	have	VBP	10136
-losing	-losing	UNC	1
1069	1069	NNP	17
727	727	NNP	34
a	a	DT	406057
a	a	JJ	2
a	a	NN	54
a	a	NNP	805
a	a	SYM	97
a	a	UNC	1048
a-a	a-a	JJ	2
a-abaker	a-abaker	JJ	1
a-adrenoceptor	a-adrenoceptor	JJ	1
a-ank-fgf	a-ank-fgf	NNP	1
a-atp	a-atp	NNP	24
a-b	a-b	NNP	9
a-b-b-bye-bye	a-b-b-bye-bye	JJ	1
a-b-c	a-b-c	NNP	2
a-b-x-y	a-b-x-y	NNP	1
a-babble	a-babble	JJ	1
a-barrel	a-barrel	JJ	1
a-bed	a-bed	JJ	1
a-bigger	a-bigger	JJ	1
a-brewin	a-brewin	JJ	2
a-brewing	a-brewing	JJ	1
a-bustin	a-bustin	JJ	1
a-c	a-c	JJ	2
a-c	a-c	NNP	18
a-callin	a-callin	JJ	1
a-calling	a-calling	JJ	1
a-cand	a-cand	JJ	1
a-cappella	a-cappella	JJ	1
a-changin	a-changin	JJ	1
a-child	a-child	JJ	2
a-cockbill	a-cockbill	JJ	1
a-comin	a-comin	JJ	1
a-cut	a-cut	JJ	1
a-d	a-d	JJ	6
a-d	a-d	NNP	8
a-day	a-day	JJ	2
a-derived	a-derived	JJ	2
a-diaza-s-indacine	a-diaza-s-indacine	JJ	1
a-dna	a-dna	NNP	3
a-duplicate	a-duplicate	JJ	1
a-e	a-e	NNP	4
a-f	a-f	NNP	4
a-factor	a-factor	JJ	1
a-feared	a-feared	JJ	1
a-flutter	a-flutter	JJ	1
a-g	a-g	NNP	5
a-general	a-general	NNP	1
a-glimmering	a-glimmering	JJ	1
a-gonna	a-gonna	JJ	2
a-got	a-got	JJ	1
a-gvhd	a-gvhd	NNP	53
a-h	a-h	JJ	3
a-h	a-h	NNP	4
a-ha	a-ha	JJ	2
a-hehm	a-hehm	JJ	1
a-hem	a-hem	JJ	1
a-hem	a-hem	NNP	1
a-ho	a-ho	JJ	1
a-hp	a-hp	JJ	1
a-i	a-i	JJ	2
a-i	a-us	NNP	1
a-join-ed	a-join-ed	JJ	1
a-kan	a-kan	JJ	1
a-l	a-l	NNP	4
a-l-b	a-l-b	NNP	1
a-leaping	a-leaping	JJ	1
a-line	a-line	JJ	2
a-list	a-list	JJ	3
a-loo-min-um-foil	a-loo-min-um-foil	JJ	1
a-love	a-love	JJ	1
a-lovin	a-lovin	JJ	1
a-lu-min-i-um	a-lu-min-i-um	JJ	1
a-lying	a-lying	JJ	1
a-m	a-m	NNP	7
a-m-a	a-m-a	NNP	1
a-mazing	a-mazing	JJ	1
a-me	a-me	JJ	1
a-million-to-one	a-million-to-one	JJ	1
a-minus	a-minus	NNP	1
a-month	a-month	JJ	4
a-month-for-domestic-help	a-month-for-domestic-help	JJ	1
a-more	a-more	JJ	1
a-myc	a-myc	JJ	6
a-n	a-n	JJ	2
a-n	a-n	NNP	4
a-night	a-night	JJ	5
a-not	a-not	JJ	2
a-nt	a-nt	NNP	2
a-ny	a-ny	NNP	106
a-ok	a-ok	NNP	8
a-p	a-p	NNP	11
a-person	a-person	JJ	2
a-phorbol	a-phorbol	JJ	2
a-pinin	a-pinin	JJ	1
a-plate	a-plate	JJ	5
a-plinkin	a-plinkin	JJ	1
a-r	a-r	NNP	5
a-rattling	a-rattling	JJ	1
a-really-bad-cold-where-you-say-it	a-really-bad-cold-where-you-say-it	JJ	1
a-religiousness	a-religiousness	JJ	1
a-rockin	a-rockin	JJ	1
a-rod-style	a-rod-style	NNP	1
a-rollin	a-rollin	JJ	1
a-s	a	NNP	13
a-s-i-m-o-v	a-s-i-m-o-v	NNP	1
a-share	a-share	JJ	1
a-side	a-side	JJ	4
a-side	a-side	NNP	1
a-swabbin	a-swabbin	JJ	1
a-t	a-t	NNP	8
a-team	a-team	NNP	1
a-ticking	a-ticking	JJ	1
a-titter	a-titter	JJ	1
a-turning	a-turning	JJ	1
a-typical	a-typical	JJ	1
a-u	a-u	JJ	1
a-u	a-u	NNP	1
a-v	a-v	NNP	1
a-w	a-w	NNP	1
a-wailing	a-wailing	JJ	1
a-way	a-way	JJ	1
a-week	a-week	JJ	2
a-well	a-well	JJ	1
a-workin	a-workin	JJ	1
a-wt	a-wt	NNP	1
a-y	a-y	NNP	3
a-yard	a-yard	JJ	1
a-year	a-year	JJ	11
a-yup	a-yup	JJ	1
a-z	a-z	NNP	4
aa	aa	NN	382
aa	aa	NNP	60
aa-amino	aa-amino	NNP	1
aa-binding	aa-binding	NNP	6
aa-d	aa-d	JJ	3
aa-enriched	aa-enriched	NNP	1
aa-raxpé-ahu	aa-raxpé-ahu	JJ	1
aa-rich	aa-rich	NNP	1
aa-tttt	aa-tttt	NNP	2
aaa	aaa	NNP	187
aaa-domain	aaa-domain	NNP	3
aaaa	aaaa	NNP	2
aaaaa	aaaaa	NN	1
aaaaa	aaaaa	NNP	1
aaaaaa	aaaaaa	NNP	3
aaaaaaa	aaaaaaa	NNP	1
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa	aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa	NNP	1
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaah	aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaah	NNP	1
aaaaaaaaaaare	aaaaaaaaaaare	NN	1
aaaaaaaagh	aaaaaaaagh	NNP	1
aaaaaaaahahahahahahaha	aaaaaaaahahahahahahaha	NNP	1
aaaaaaaccent	aaaaaaaccent	NN	2
aaaaaaadddaaammmmmm	aaaaaaadddaaammmmmm	NNP	1
aaaaaaagh	aaaaaaagh	NNP	1
aaaaaaahh	aaaaaaahh	NNP	1
aaaaaaand	aaaaaaand	NN	1
aaaaaagh	aaaaaagh	NNP	2
aaaaaah	aaaaaah	NN	2
aaaaaah	aaaaaah	NNP	1
aaaaaahhh	aaaaaahhh	NNP	1
aaaaaannnnnd	aaaaaannnnnd	NNP	1
aaaaaarrrrrgh	aaaaaarrrrrgh	NNP	1
aaaaaggghhh	aaaaaggghhh	NNP	1
aaaaaghhh	aaaaaghhh	NNP	1
aaaaahhh	aaaaahhh	NNP	1
aaaaahhhhhh	aaaaahhhhhh	NNP	1
aaaaand	aaaaand	NNP	1
aaaaargh	aaaaargh	NNP	1
aaaaauuughhh	aaaaauuughhh	NNP	1
aaaaaw	aaaaaw	NNP	1
aaaacacaacgaaacctg	aaaacacaacgaaacctg	NNP	1
aaaaccccaaaa	aaaaccccaaaa	NNP	1
aaaach	aaaach	NNP	1
aaaack	aaaack	NNP	1
aaaactgcagcggccgccaccatgcaccac-caccacaccaccaccacgtgagcaagggcgaggagctgttcaccg	aaaactgcagcggccgccaccatgcaccac-caccacaccaccaccacgtgagcaagggcgaggagctgttcaccg	NNP	1
aaaagaaaaaa	aaaagaaaaaa	NNP	1
aaaagataaag	aaaagataaag	NNP	1
aaaagcggccgcgagtggggggcggcggcc	aaaagcggccgcgagtggggggcggcggcc	NNP	1
aaaagcttcttgaaaggagacttctgt	aaaagcttcttgaaaggagacttctgt	NNP	1
aaaaggtgggcctgaggttca	aaaaggtgggcctgaggttca	NNP	1
aaaagh	aaaagh	NN	1
aaaagh	aaaagh	NNP	2
aaaagtcgacgcgcccagcagcgagaccgc	aaaagtcgacgcgcccagcagcgagaccgc	NNP	1
aaaah	aaaah	NNP	3
aaaahh	aaaahh	NNP	1
aaaahhh	aaaahhh	NNP	1
aaaan-ist	aaaan-ist	NNP	2
aaaand	aaaand	NNP	2
aaaargghhh	aaaargghhh	NNP	1
aaaargh	aaaargh	NN	1
aaaargh	aaaargh	NNP	1
aaaarrgh	aaaarrgh	NN	1
aaaarrrrrggghhhhh	aaaarrrrrggghhhhh	NNP	1
aaaawwww	aaaawwww	NNP	1
aaaawwwwww	aaaawwwwww	NNP	1
aaab	aaab	NNP	2
aaabs	aaab	NNP	1
aaacaggattttcgcctgctggg	aaacaggattttcgcctgctggg	NNP	2
aaaccatctcactcgcatga	aaaccatctcactcgcatga	NNP	1
aaaccent	aaaccent	NN	1
aaacgacggccagtgaattgtaatacgactcactataggcgc	aaacgacggccagtgaattgtaatacgactcactataggcgc	NNP	1
aaacgacggccagtgaattgtaatacgactcactataggg	aaacgacggccagtgaattgtaatacgactcactataggg	NNP	1
aaactgtacttgttatcaggat	aaactgtacttgttatcaggat	NNP	1
aaactgtgg	aaactgtgg	NNP	1
aaag	aaag	NNP	1
aaaggaccccacgaagtgtt	aaaggaccccacgaagtgtt	NNP	1
aaagh	aaagh	NNP	2
aaah	aaah	NN	1
aaah	aaah	NNP	1
aaahh	aaahh	NNP	1
aaahhhh	aaahhhh	NNP	1
aaahing	aaah	VBG	1
aaaieeeooh	aaaieeeooh	NNP	1
aaaieeeoooh	aaaieeeoooh	NNP	1
aaaiiggghhh	aaaiiggghhh	NNP	1
aaaiiiieeeee	aaaiiiieeeee	NNP	1
aaalac	aaalac	NNP	1
aaand	aaand	NN	1
aaand	aaand	NNP	1
aaargh	aaargh	NNP	9
aaarrgghhh	aaarrgghhh	NNP	1
aaarrgh	aaarrgh	NNP	1
aaarrrggghhh	aaarrrggghhh	NNP	1
aaarrrrrgggggghhhhh	aaarrrrrgggggghhhhh	NN	1
aaat	aaat	NNP	2
aaataaat	aaataaat	NNP	1
aaatctcaat	aaatctcaat	NNP	1
aaatgcagttgttactgtccctg	aaatgcagttgttactgtccctg	NNP	1
aaatgcatctgcgagggc	aaatgcatctgcgagggc	NNP	1
aaawwwww	aaawwwww	NNP	1
aab	aab	NN	1
aab	aab	NNP	2
aabb	aabb	NN	2
aabb	aabb	NNP	5
aac	aac	NN	1
aac	aac	NNP	41
aaca	aaca	NNP	4
aacacagtgagacgctgtct	aacacagtgagacgctgtct	NNP	1
aacc	aacc	NN	3
aaccaa	aaccaa	NNP	1
aaccatgcaggtacagtc	aaccatgcaggtacagtc	NNP	1
aacccacatgttcacggcgga	aacccacatgttcacggcgga	NNP	1
aacctcctct	aacctcctct	NNP	1
aacctctccattcagc	aacctctccattcagc	NNP	1
aacgggaagcccatcacc	aacgggaagcccatcacc	NNP	1
aachen	aachen	NNP	7
aack	aack	NNP	1
aactagatgtagaagtcgttcatggattc	aactagatgtagaagtcgttcatggattc	NNP	1
aad	aad	NNP	13
aadntp	aadntp	NN	1
aadutp	aadutp	NN	2
aae	aa	NNP	1
aaf	aaf	NNP	5
aafp	aafp	NN	1
aag	aag	NNP	15
aag-gtggtaaaccagggggatc	aag-gtggtaaaccagggggatc	NNP	1
aagaattcaaactggggcct	aagaattcaaactggggcct	NNP	1
aagagtagctgctcaccgtgtacaag	aagagtagctgctcaccgtgtacaag	NN	1
aagcagtggtaacaacgc	aagcagtggtaacaacgc	NNP	1
aagcagtggtaacaacgcagagtacgcggg	aagcagtggtaacaacgcagagtacgcggg	NNP	1
aagcagtggtatcaacgcagagtacgcggg	aagcagtggtatcaacgcagagtacgcggg	NNP	1
aagccctctgaacagtgtcccatcccaagt	aagccctctgaacagtgtcccatcccaagt	NNP	1
aagccgggaaggatctgtat	aagccgggaaggatctgtat	NNP	1
aagcctgaccacgctttcta	aagcctgaccacgctttcta	NNP	1
aagctt	aagctt	NNP	1
aagg	aagg	NNP	1
aaggagtgcggggaggag	aaggagtgcggggaggag	NNP	1
aaggghhh	aaggghhh	NNP	1
aaggtcaaaattcaacagctgcttgtacagctcgtccatgcc	aaggtcaaaattcaacagctgcttgtacagctcgtccatgcc	NNP	1
aaggtcaaaattcaacagctgggtgggtgctaatcctaatggttc	aaggtcaaaattcaacagctgggtgggtgctaatcctaatggttc	NNP	1
aaggtgcggagcaaaat	aaggtgcggagcaaaat	NNP	1
aagh	aagh	NN	1
aah	aah	NN	3
aah	aah	NNP	4
aahed	aahed	JJ	5
aahh	aahh	NN	1
aahing	aah	VBG	2
aahp	aahp	NNP	14
aahs	aah	NNS	2
aaib	aaib	NNP	1
aaiii	aaiius	NNP	2
aair	aair	NN	3
aairs	aair	NNS	1
aak	aak	NNP	2
aake	aake	NN	1
aakp	aakp	NN	1
aakp	aakp	NNP	1
aal	aal	NNP	58
aal-american	aal-american	NNP	1
aala	aalum	NNP	1
aalborg	aalborg	NNP	1
aalikum	aalikum	NN	1
aaliyah	aaliyah	NNP	4
aalso	aalso	NN	1
aalto	aalto	NNP	5
aam	aam	NNP	2
aamco	aamco	NNP	1
aand	aand	NN	32
aand	aand	NNP	118
aap	aap	NN	2
aap	aap	NNP	10
aapf-p-nitroanilide	aapf-p-nitroanilide	NNP	1
aapf-pna	aapf-pna	NNP	3
aapfakkk	aapfakkk	NNP	1
aaps	aap	NNP	3
aard	aard	NN	1
aardvark	aardvark	NN	2
aardvark	aardvark	NNP	2
aardvarken	aardvarken	NN	1
aardvarks	aardvark	NNP	1
aare	aare	NNP	2
aarg	aarg	NNP	1
aargh	aargh	NNP	10
aarikkaa	aarikkaa	NNP	1
aaron	aaron	NN	3
aaron	aaron	NNP	168
aaronetta	aaronetta	NNP	2
aaronic	aaronic	NNP	1
aaronj	aaronj	NNP	1
aaronson	aaronson	NNP	4
aarp	aarp	NN	2
aarp	aarp	NNP	42
aarp	aarp	UNC	1
aarparific	aarparific	NNP	1
aarrrrrggghhhh	aarrrrrggghhhh	NNP	1
aars	aar	NN	4
aarss	aarss	NNS	4
aas	aa	NNP	4
aas	aa	NNS	2
aasa	aasa	NNP	1
aasland	aasland	NNP	3
aassumes	aassume	NNS	1
aat	aat	NN	2
aat	aat	NNP	28
aataaa	aataaa	NNP	1
aataacctccaaattgacctg	aataacctccaaattgacctg	NNP	1
aatctgcagctatgaaatccc	aatctgcagctatgaaatccc	NNP	1
aatctttcatagttcatgcgtt	aatctttcatagttcatgcgtt	NNP	1
aatgaagcggagttcccaaagc	aatgaagcggagttcccaaagc	NNP	1
aatgaccaattatatgaatcaattatctg	aatgaccaattatatgaatcaattatctg	NNP	1
aatgggcagaggtataaagataagga	aatgggcagaggtataaagataagga	NNP	1
aattaaaccatccaatgaaatagagc	aattaaaccatccaatgaaatagagc	NNP	1
aattcagtgaactggccacc	aattcagtgaactggccacc	NNP	1
aattcatgctatgatgatgatgatgatggctac	aattcatgctatgatgatgatgatgatggctac	NNP	1
aattctgacaatcgacgccag	aattctgacaatcgacgccag	NNP	1
aattctggagcttctggatccaagaatggaatcaaagttaag	aattctggagcttctggatccaagaatggaatcaaagttaag	NNP	1
aatttatatggaatgctacgatt	aatttatatggaatgctacgatt	NNP	1
aau	aau	NNP	3
aauaaa	aauaaa	NNP	2
aaucmb	aaucmb	NNP	3
aaup	aaup	NNP	4
aava	aava	NNP	2
aave	aave	NNP	4
aaw	aaw	NNP	2
aawww	aawww	NNP	1
ab	ab	NN	37
ab	ab	NNP	210
ab	ab	UNC	1
ab-boin-ug	ab-boin-ug	JJ	1
ab-dependent	ab-dependent	NNP	1
ab-initio	ab-initio	JJ	1
aba	aba	NN	2
aba	aba	NNP	55
aba	aba	UNC	1
aba-mediated	aba-mediated	NNP	1
aba-nlada	aba-nlada	NNP	1
aba-response	aba-response	NNP	1
abaa	abaa	NN	1
ababa	ababa	NNP	1
ababb	ababb	NN	1
abac	abac	NN	1
abacavir	abacavir	NN	4
abacha	abacha	NNP	11
aback	aback	RB	25
abaco	abaco	NNP	9
abaconians	abaconian	NNP	1
abacos	abaco	NNP	10
abacus	abacus	JJ	6
abacus	abacus	NNP	3
abacuses	abacus	NNP	1
abacuses	abacus	NNS	1
abad	abad	NN	1
abad	abad	NNP	3
abade	abade	NNP	1
abadie	abadie	NNP	1
abado	abado	NNP	1
abaft	abaft	NN	1
abagyan	abagyan	NNP	3
abajo	abajo	NNP	2
abalone	abalone	NN	8
abalone	abalone	NNP	1
aban	aban	NN	1
abandandoned	abandandoned	JJ	1
abandon	abandon	NNP	5
abandon	abandon	VB	214
abandon	abandon	VBP	11
abandoned	abandon	VBD	127
abandoned	abandon	VBN	342
abandoned	abandoned	JJ	2
abandoned	abandoned	NNP	7
abandoned	abandoned	UNC	5
abandoned-including	abandoned-including	JJ	1
abandoner	abandoner	NN	1
abandonimg	abandonimg	NN	1
abandoning	abandon	VBG	112
abandoning	abandoning	UNC	1
abandonment	abandonment	NN	46
abandonment	abandonment	NNP	2
abandons	abandon	NNP	3
abandons	abandon	VBZ	13
abang	abang	NNP	8
abangales	abangale	NNP	1
abanic	abanic	NNP	1
abanus	abanus	NNP	1
abarca	abarca	NNP	1
abarcas	abarca	NNP	2
abarinov	abarinov	NNP	1
abarnard	abarnard	NN	1
abas	aba	NNP	1
abase	abase	NN	1
abashed	abashed	JJ	9
abashment	abashment	NN	1
abasic	abasic	JJ	18
abasic	abasic	NNP	1
abate	abate	NNP	7
abate	abate	VB	11
abated	abate	VBN	16
abatement	abatement	NN	8
abatement	abatement	NNP	2
abating	abate	VBG	7
abattoir	abattoir	NN	3
abattoir	abattoir	NNP	1
abaxial	abaxial	NN	1
abb	abb	NNP	17
abba	abba	NNP	6
abbaddaba	abbaddaba	NNP	1
abbado	abbado	NNP	2
abbas	abba	NNP	7
abbasid	abbasid	NNP	1
abbasiya	abbasiya	NNP	2
abbass	abbass	NNP	2
abbate	abbate	NNP	5
abbatiale	abbatiale	NNP	2
abbaye	abbaye	NNP	4
abbayedefontenay	abbayedefontenay	NN	1
abbayes	abbay	NNP	1
abbdominal	abbdominal	NN	1
abbe	abbe	NNP	4
abbella	abbellum	NN	1
abberation	abberation	NN	1
abbess	abbess	NNS	2
abbesses	abbess	NNP	3
abbeville	abbeville	NNP	2
abbey	abbey	NN	41
abbey	abbey	NNP	86
abbeys	abbey	NNP	1
abbeys	abbey	NNS	6
abbie	abbie	NNP	9
abbondanza	abbondanza	NNP	2
abbot	abbot	NN	14
abbot	abbot	NNP	27
abbots	abbot	NNS	2
abbott	abbott	NNP	55
abbotts	abbott	NNP	4
abboud	abboud	NNP	4
abboy	abboy	NNP	1
abbr	abbr	NNP	2
abbreivations	abbreivation	NNP	1
abbrev	abbrev	NNP	6
abbreviate	abbreviate	NN	8
abbreviate	abbreviate	NNP	2
abbreviated	abbreviated	JJ	58
abbreviated	abbreviated	NNP	1
abbreviates	abbreviate	NNS	1
abbreviating	abbreviate	VBG	4
abbreviation	abbreviation	JJ	1
abbreviation	abbreviation	NN	50
abbreviation	abbreviation	NNP	2
abbreviations	abbreviation	NNP	191
abbreviations	abbreviation	NNS	111
abbreviaturis	abbreviaturi	NNP	1
abbreviatus	abbreviatus	JJ	1
abbrevs	abbrev	NNP	1
abbuehl	abbuehl	NNP	1
abby	abby	NNP	72
abc	abc	NN	4
abc	abc	NNP	656
abc	abc	UNC	2
abc-dab	abc-dab	NNP	1
abc-horseradish	abc-horseradish	NNP	1
abc-hrp	abc-hrp	NNP	1
abc-kit	abc-kit	NNP	1
abc-paramount	abc-paramount	NNP	1
abc-tv	abc-tv	NNP	7
abca	abca	NNP	7
abcb	abcb	NNP	2
abcd	abcd	NNP	6
abcdefghijklmnopqrstuvwxyz	abcdefghijklmnopqrstuvwxyz	NNP	1
abce	abce	NNP	3
abcfamily	abcfamily	NNP	1
abcg	abcg	NNP	86
abcissa	abcissa	NN	1
abcnews	abcnew	NNP	4
abcnews	abcnew	NNS	3
abcs	abc	NNP	8
abcs	abcs	UNC	1
abd	abd	NN	2
abd	abd	NNP	18
abd-er	abd-er	NNP	3
abdalla	abdallum	NNP	6
abdallah	abdallah	NNP	10
abdalrahman	abdalrahman	NNP	1
abdel	abdel	NNP	47
abdelamir	abdelamir	NNP	1
abdelaziz	abdelaziz	NNP	2
abdelbari	abdelbarus	NNP	3
abdelghani	abdelghanus	NNP	14
abdeljaber	abdeljaber	NNP	12
abdelkader	abdelkader	NNP	1
abdellatif	abdellatif	NNP	1
abdelmajed	abdelmajed	NNP	1
abdelwahhab	abdelwahhab	NNP	1
abdera	abdera	NNP	1
abderrahman	abderrahman	NNP	2
abderraman	abderraman	NNP	1
abderraouf	abderraouf	NNP	4
abdessalem	abdessalem	NNP	2
abdf	abdf	NNP	3
abdi	abdus	NN	8
abdi	abdus	NNP	6
abdicate	abdicate	VBP	10
abdicated	abdicated	JJ	11
abdicating	abdicate	VBG	3
abdication	abdication	NN	20
abdication	abdication	NNP	1
abdications	abdication	NNS	1
abdil	abdil	NNP	2
abdnr	abdnr	NNP	1
abdnu	abdnu	NNP	1
abdoh	abdoh	NNP	4
abdolghassem	abdolghassem	NNP	3
abdomen	abdomen	NN	38
abdomen-crush	abdomen-crush	JJ	1
abdomens	abdomen	NNS	2
abdominal	abdominal	NN	92
abdominal	abdominal	NNP	4
abdominals	abdominal	NNS	3
abdominis	abdomini	NNS	2
abdoulaye	abdoulaye	NNP	1
abdoun	abdoun	NNP	3
abducens	abducen	NNP	3
abducens	abducen	NNS	2
abduct	abduct	NN	5
abducted	abducted	NN	48
abducted	abducted	NNP	1
abductee	abductee	NN	1
abductees	abductee	NNS	2
abducting	abduct	VBG	3
abduction	abduction	NN	37
abduction	abduction	NNP	3
abduction-molestation-murder	abduction-molestation-murder	JJ	1
abductions	abduction	NNP	2
abductions	abduction	NNS	43
abductor	abductor	NN	4
abductors	abductor	NNS	2
abducts	abduct	NNS	1
abdul	abdul	NNP	100
abdulaziz	abdulaziz	NNP	3
abdulla	abdullum	NNP	3
abdullah	abdullah	NNP	208
abdullah-recalled	abdullah-recalled	NNP	1
abdulmuttaleb	abdulmuttaleb	NNP	1
abdulrab	abdulrab	NNP	1
abdulsalam	abdulsalam	NNP	2
abdur	abdur	NNP	1
abdurraham	abdurraham	NNP	1
abdurrahman	abdurrahman	NNP	7
abdál	abdál	NN	1
abdül	abdül	NNP	8
abe	abe	NN	1
abe	abe	NNP	56
abeam	abeam	NN	1
abeautiful	abeautiful	NNP	1
abebe	abebe	NNP	1
abecedarium	abecedarium	NNP	4
abecedarius	abecedarius	JJ	2
abed	abed	NNP	4
abedi	abedus	NNP	2
abednego	abednego	NN	2
abednego	abednego	NNP	1
abeer	abeer	NNP	2
abel	abel	NNP	31
abelard	abelard	NNP	1
abele	abele	NNP	2
abeline	abeline	NNP	1
abell	abell	NNP	1
abelmoschus	abelmoschus	JJ	1
abelson	abelson	NNP	20
abelsonprofessor	abelsonprofessor	NNP	1
abencerrajes	abencerraje	NNP	2
aberamenthooulerthexanaxethreluoothnemareba	aberamenthooulerthexanaxethreluoothnemareba	NNP	1
abercombie	abercombie	NNP	1
abercrombie	abercrombie	NN	1
abercrombie	abercrombie	NNP	24
abercromby	abercromby	NNP	3
aberdeen	aberdeen	NNP	16
aberdonians	aberdonian	NNP	1
aberg	aberg	NNP	1
aberlour	aberlour	NNP	7
abernathy	abernathy	NNP	9
aberrancies	aberrancy	NNS	11
aberrancy	aberrancy	NN	3
aberrant	aberrant	NN	106
aberrant	aberrant	NNP	6
aberrantly	aberrantly	RB	14
aberration	aberration	NN	18
aberration	aberration	NNP	1
aberrational	aberrational	NN	3
aberrations	aberration	NNP	1
aberrations	aberration	NNS	27
abert	abert	NNP	1
abet	abet	NN	6
abets	abet	NNS	1
abetted	abet	VBN	13
abetted	abetted	NNP	2
abetted	abetted	UNC	1
abetter	abetter	NNP	1
abetting	abet	VBG	14
abettor	abettor	NN	1
abeyance	abeyance	NN	1
abf	abf	NNP	2
abfab	abfab	NNP	3
abg	abg	NNP	1
abgene	abgene	NNP	3
abh	abh	NNP	1
abhominable	abhominable	JJ	1
abhor	abhor	NN	11
abhorred	abhorred	JJ	5
abhorred	abhorred	UNC	1
abhorrence	abhorrence	NN	4
abhorrent	abhorrent	NN	7
abhors	abhor	NNP	1
abhors	abhor	NNS	10
abi	abus	NN	8
abi	abus	NNP	119
abi-prism	abi-prism	NNP	2
abia	abium	NNP	1
abiankapas	abiankapa	NNP	1
abicada	abicada	NNP	1
abid	abid	NNP	1
abide	abide	VB	53
abide-and	abide-and	JJ	1
abided	abided	JJ	5
abides	abide	NNS	2
abidin	abidin	NNP	1
abiding	abide	VBG	35
abiding	abiding	UNC	1
abidjan	abidjan	NNP	2
abie	abie	NNP	1
abierto	abierto	NN	1
abies	aby	NNP	1
abies	aby	NNS	2
abig	abig	NN	2
abigail	abigail	NNP	35
abigale	abigale	NNP	1
abilene	abilene	NNP	19
abilites	abilite	NNS	1
abilities	abilities	UNC	2
abilities	ability	NNP	2
abilities	ability	NNS	165
ability	ability	JJ	1
ability	ability	NN	2346
ability	ability	NNP	9
ability	ability	UNC	3
ability-to-make-fire-in-rain	ability-to-make-fire-in-rain	JJ	1
abilityto	abilityto	NN	1
abim	abim	NNP	1
abingdon	abingdon	NNP	4
abiola	abiolum	NNP	9
abiotic	abiotic	JJ	26
abiotic	abiotic	NNP	1
abiotically	abiotically	RB	1
abiquiu	abiquiu	NNP	1
abir	abir	NN	1
abir	abir	NNP	7
abirdsworld	abirdsworld	NNP	1
abisco	abisco	NNP	1
abish	abish	NNP	1
abisynth	abisynth	NN	1
abit	abit	NN	1
abit	abit	NNP	1
abita	abita	NNP	2
abitation	abitation	NNP	2
abitur	abitur	NNP	1
abj	abj	NNP	1
abject	abject	NN	31
abjected	abjected	JJ	1
abjection	abjection	NN	2
abjection	abjection	UNC	1
abjectly	abjectly	RB	7
abjectness	abjectness	UNC	1
abjure	abjure	NN	5
abjured	abjured	JJ	1
abjures	abjure	NNS	2
abjuring	abjure	VBG	1
abkhazia	abkhazium	NNP	3
abl	abl	NN	2
abl	abl	NNP	30
abladen	abladen	NN	1
ablaqueate	ablaqueate	NN	1
ablaqueate	ablaqueate	NNP	1
ablasion	ablasion	NN	1
ablata	abla	NN	1
ablatable	ablatable	NNP	1
ablate	ablate	NN	6
ablated	ablated	JJ	19
ablates	ablate	NNS	2
ablating	ablate	VBG	3
ablation	ablation	NN	66
ablation	ablation	NNP	5
ablations	ablation	NNP	1
ablations	ablation	NNS	2
ablative	ablative	JJ	5
ablaze	ablaze	NN	17
ablaze	ablaze	NNP	1
able	able	JJ	4182
able	able	NNP	12
able-bodied	able-bodied	JJ	10
abled	abled	JJ	1
ableto	ableto	NN	2
ablidged	ablidged	JJ	1
ablities	ablity	NNS	1
abloom	abloom	NN	1
abluminal	abluminal	NN	5
abluted	abluted	JJ	1
ablution	ablution	NN	2
ablutions	ablutions	NNS	7
ably	ably	RB	13
abm	abm	NNP	14
abn	abn	NNP	1
abnaki	abnakus	NNP	2
abnegation	abnegation	NN	2
abner	abner	NNP	22
abnormal	abnormal	JJ	274
abnormal	abnormal	NNP	10
abnormalities	abnormality	NNP	5
abnormalities	abnormality	NNS	228
abnormality	abnormality	NN	65
abnormally	abnormally	NNP	1
abnormally	abnormally	RB	32
abnormals	abnormal	NNS	1
abnr	abnr	NNP	2
aboard	aboard	IN	200
aboard	aboard	NNP	4
aboard	aboard	RB	3
aboc	aboc	NNP	1
abode	abode	NN	10
abode	abode	NNP	1
abodes	abode	NNS	1
abodiement	abodiement	NN	1
abogadillo	abogadillo	NN	1
abogado	abogado	NN	1
abol	abol	NN	1
abolish	abolish	NNP	4
abolish	abolish	VB	64
abolished	abolish	VBD	56
abolished	abolish	VBN	67
abolished	abolished	NNP	1
abolished	abolished	UNC	1
abolishes	abolish	NNS	11
abolishing	abolish	VBG	40
abolishing	abolishing	NNP	1
abolition	abolition	NN	49
abolition	abolition	NNP	2
abolition	abolition	UNC	1
abolition-of-function	abolition-of-function	JJ	1
abolitionism	abolitionism	NN	2
abolitionist	abolitionist	NN	13
abolitionists	abolitionist	NNP	1
abolitionists	abolitionist	NNS	10
abomelic	abomelic	NNP	1
abominable	abominable	JJ	12
abominably	abominably	RB	2
abominated	abominated	JJ	1
abomination	abomination	NN	21
abomination	abomination	NNP	3
abomination	abomination	UNC	1
abominations	abomination	NNS	5
abominationvegetable	abominationvegetable	JJ	1
abominosus	abominosus	JJ	1
abonuses	abonus	NNS	1
aboot	aboot	NN	1
abootty	abootty	NNP	2
abooty	abooty	NNP	1
abor	abor	NN	1
aboriginal	aboriginal	NN	12
aboriginal	aboriginal	NNP	49
aborigine	aborigine	NN	1
aborigine	aborigine	NNP	4
aborigines	aborigine	NNP	24
aborigines	aborigine	NNS	4
aborigines	aborigines	UNC	1
aborigén	aborigén	NNP	1
abort	abort	NN	14
abort	abort	NNP	2
aborted	abort	VBN	2
aborted	aborted	JJ	25
aborted	aborted	UNC	1
abortifacent	abortifacent	NN	1
abortifacents	abortifacent	NNS	1
abortifacient	abortifacient	NN	2
aborting	abort	VBG	5
aborting	aborting	NNP	1
abortion	abortion	JJ	1
abortion	abortion	NN	610
abortion	abortion	NNP	26
abortion	abortion	UNC	9
abortion-abetting	abortion-abetting	JJ	1
abortion-clinic	abortion-clinic	JJ	2
abortion-clinic	abortion-clinic	NNP	1
abortion-free	abortion-free	JJ	1
abortion-neutral	abortion-neutral	JJ	1
abortion-related	abortion-related	JJ	5
abortion-reporting	abortion-reporting	JJ	1
abortion-rights	abortion-right	NNS	17
abortionist	abortionist	NN	4
abortionists	abortionist	NNP	2
abortionists	abortionist	NNS	2
abortions	abortion	NNP	4
abortions	abortion	NNS	137
abortions	abortions	JJ	1
abortions	abortions	UNC	7
abortive	abortive	JJ	30
abortive	abortive	NNP	1
aborto	aborto	NN	1
aborts	abort	NNS	1
abortus	abortus	JJ	35
abortuses	abortus	NNS	1
abortusvaccine	abortusvaccine	NN	1
aborville	aborville	NNP	1
abot	abot	NN	2
abotu	abotu	NN	3
abou	abou	NN	2
abou	abou	NNP	4
abouhalima	abouhalima	NNP	4
aboukir	aboukir	NNP	1
abound	abound	NNP	4
abound	abound	VBP	96
abounded	abound	VBD	9
aboundeth	aboundeth	NN	1
abounds	abound	NNP	1
abounds	abound	VBZ	24
about	about	IN	43353
about	about	JJ	87
about	about	NNP	89
about	about	RB	190
about	about	RP	131
about	about	UNC	104
about-face	about-face	NN	18
about-to-be	about-to-be	JJ	2
about-to-be-announced	about-to-be-announced	JJ	2
about-to-be-born	about-to-be-born	JJ	2
about-to-be-created	about-to-be-created	JJ	1
about-to-be-published	about-to-be-published	JJ	2
about-to-be-released	about-to-be-released	JJ	1
about-to-be-resuscitated	about-to-be-resuscitated	JJ	1
about-town	about-town	JJ	1
aboutthem	aboutthem	NN	1
abouttheportauthority	abouttheportauthority	NNP	1
above	above	IN	3336
above	above	JJ	395
above	above	NNP	6
above	above	RB	23
above	above	UNC	13
above-average	above-average	JJ	9
above-defined	above-defined	JJ	1
above-described	above-described	JJ	4
above-detected	above-detected	JJ	1
above-discussed	above-discussed	JJ	1
above-ground	above-ground	JJ	5
above-has	above-ha	JJ	1
above-hurdle	above-hurdle	JJ	1
above-it-all	above-it-all	JJ	2
above-listed	above-listed	JJ	2
above-market	above-market	JJ	1
above-mentioned	above-mentioned	JJ	16
above-named	above-named	JJ	1
above-noted	above-noted	JJ	1
above-politics	above-politic	JJ	1
above-the-eyebrow	above-the-eyebrow	JJ	1
above-the-fold	above-the-fold	JJ	25
above-the-fold	above-the-fold	NNP	1
above-the-fray	above-the-fray	JJ	2
above-the-knee	above-the-knee	JJ	2
above-the-title	above-the-title	JJ	1
above-threshold	above-threshold	JJ	2
aboveboard	aboveboard	NN	3
aboveboard	aboveboard	NNP	1
abovedescribed	abovedescribed	JJ	1
aboveground	aboveground	NN	2
abovementioned	abovementioned	JJ	1
abox	abox	NN	1
abp	abp	NNP	35
abp-containing	abp-containing	NNP	1
abp-tg	abp-tg	NNP	37
abpnn	abpnn	NN	1
abr	abr	NNP	1
abra	abra	NNP	13
abracadabra	abracadabra	NN	2
abracadabra	abracadabra	NNP	1
abrading	abrade	VBG	1
abraham	abraham	NNP	134
abrahamowicz	abrahamowicz	NNP	1
abrahams	abraham	NNP	5
abrahamsen	abrahamsen	NNP	1
abrahms	abrahm	NNP	1
abrain	abrain	NN	1
abram	abram	NNP	1
abramovic	abramovic	NNP	1
abramovich	abramovich	NNP	1
abramovitz	abramovitz	NNP	2
abramowitz	abramowitz	NNP	4
abrams	abram	NNP	57
abrams	abrams	UNC	1
abramson	abramson	NNP	5
abrans	abran	NNS	1
abrant	abrant	NN	1
abrantes	abrant	NNP	1
abrase	abrase	NN	1
abrash	abrash	NNP	2
abrasion	abrasion	NN	7
abrasion-themed	abrasion-themed	JJ	1
abrasions	abrasion	NNS	6
abrasive	abrasive	JJ	20
abrasive	abrasive	NN	2
abrasive	abrasive	NNP	1
abrazo	abrazo	NN	1
abre	abre	NN	2
abre	abre	NNP	1
abre-like	abre-like	NNP	1
abreaction	abreaction	NN	1
abreast	abreast	NN	28
abreast	abreast	NNP	1
abrejo	abrejo	NNP	1
abrell	abrell	NNP	1
abres	abr	NNP	1
abreu	abreu	NNP	3
abreuvoir	abreuvoir	NNP	2
abri	abrus	NNP	1
abridge	abridge	NN	11
abridged	abridged	JJ	7
abridged	abridged	NNP	1
abridgement	abridgement	NN	1
abridges	abridge	NNS	1
abridging	abridge	VBG	3
abridgment	abridgment	NN	2
abridgment	abridgment	NNP	1
abriel	abriel	NN	1
abrigo	abrigo	NN	1
abrigo	abrigo	NNP	1
abrikosov	abrikosov	NNP	1
abril	abril	NN	1
abril	abril	NNP	5
abroad	abroad	JJ	1
abroad	abroad	NNP	6
abroad	abroad	RB	399
abroad	abroad	UNC	3
abroad-limits	abroad-limit	JJ	1
abrogate	abrogate	NN	11
abrogated	abrogated	JJ	15
abrogates	abrogate	NNS	2
abrogating	abrogate	VBG	5
abrogation	abrogation	NN	8
abrotanum	abrotanum	NNP	3
abrou	abrou	NN	1
abrupt	abrupt	JJ	79
abrupta	abrupta	NN	1
abruptly	abruptly	NNP	2
abruptly	abruptly	RB	101
abruptness	abruptness	NNS	2
abruzzi	abruzzus	NNP	2
abs	ab	NNP	22
abs	ab	NNS	27
absalom	absalom	NNP	6
absaroka	absaroka	NNP	1
abscam	abscam	NNP	2
abscence	abscence	NN	1
abscene	abscene	NN	1
abscess	abscess	NNS	9
abscess-like	abscess-like	JJ	1
abscessed	abscessed	JJ	1
abscesses	abscess	NNP	1
abscesses	abscess	NNS	9
abscessus	abscessus	JJ	1
abscisic	abscisic	JJ	6
abscisic	abscisic	NNP	1
abscissa	abscissa	NN	3
abscond	abscond	NN	3
absconded	absconded	JJ	4
absconding	abscond	VBG	1
abscondment	abscondment	NN	1
absdata	absda	NN	3
abse	abse	NNP	1
absence	absence	NN	1435
absence	absence	NNP	18
absence	absence	UNC	1
absence-minded	absence-minded	NNP	1
absences	absence	NNS	31
absense	absense	NN	1
absent	absent	JJ	376
absent	absent	UNC	1
absent	absent	VB	72
absent-minded	absent-minded	JJ	1
absent-mindedly	absent-mindedly	JJ	3
absente	absente	NNP	1
absented	absented	JJ	1
absentee	absentee	NN	30
absentee	absentee	NNP	2
absenteeism	absenteeism	NN	15
absenteeism	absenteeism	NNP	1
absentees	absentee	NNS	1
absenthe	absenthe	NNP	1
absentia	absentia	NN	6
absentia	absentia	NNP	3
absentionists	absentionist	NNS	1
absently	absently	RB	9
absentminded	absentminded	JJ	1
absentmindedly	absentmindedly	RB	1
abshire	abshire	NNP	1
absinth	absinth	NN	1
absinthe	absinthe	NN	8
absinthe	absinthe	NNP	2
absinthe-fueled	absinthe-fueled	JJ	1
absinthium	absinthium	NNP	13
absit	absit	NNP	1
absloutely	absloutely	NNP	1
abso-bleeding-lutely	abso-bleeding-lutely	NNP	1
abso-freakin-lutely	abso-freakin-lutely	NNP	1
abso-friggin	abso-friggin	JJ	1
abso-fucking-lutely	abso-fucking-lutely	JJ	1
abso-fucking-lutely	abso-fucking-lutely	NNP	1
absofxxxinglutely	absofxxxinglutely	NNP	1
absolete	absolete	NN	1
absolom	absolom	NNP	1
absolut	absolut	NNP	4
absolute	absolute	JJ	672
absolute	absolute	NNP	1
absolute	absolute	UNC	1
absolute-beginners	absolute-beginner	JJ	1
absolutely	absolutely	NNP	1
absolutely	absolutely	RB	743
absoluteness	absoluteness	NNS	4
absolutes	absolute	NNS	9
absolution	absolution	NN	11
absolutism	absolutism	NN	11
absolutisms	absolutisms	UNC	1
absolutist	absolutist	NN	14
absolutists	absolutist	NNP	1
absolutists	absolutist	NNS	1
absolutly	absolutly	RB	1
absolve	absolve	NNP	1
absolve	absolve	VBP	8
absolved	absolved	JJ	9
absolver	absolver	NN	1
absolves	absolve	NNP	1
absolves	absolve	NNS	3
absolving	absolve	VBG	2
absolyutno	absolyutno	NN	1
absorb	absorb	NNP	1
absorb	absorb	VB	99
absorb	absorb	VBP	10
absorbable	absorbable	JJ	2
absorbance	absorbance	NN	132
absorbance	absorbance	NNP	8
absorbances	absorbance	NNS	4
absorbed	absorb	VBD	42
absorbed	absorb	VBN	147
absorbed	absorbed	UNC	3
absorbency	absorbency	NN	8
absorbency	absorbency	NNP	1
absorbent	absorbent	JJ	10
absorbent	absorbent	NNP	1
absorber	absorber	NN	61
absorber	absorber	NNP	2
absorber-module	absorber-module	JJ	2
absorbers	absorber	NNS	32
absorbing	absorb	VBG	62
absorbing	absorbing	NNP	2
absorbs	absorb	VBZ	22
absorptiometry	absorptiometry	NNP	2
absorption	absorption	NN	263
absorption	absorption	NNP	7
absorption	absorption	UNC	1
absorptions	absorption	NNS	1
absorptive	absorptive	JJ	3
absorptivities	absorptivity	NNS	1
abstain	abstain	NN	19
abstained	abstain	VBD	9
abstainers	abstainer	NNS	3
abstaining	abstain	VBG	5
abstains	abstain	NNS	2
abstemious	abstemious	JJ	2
abstemiousness	abstemiousness	NNS	1
abstention	abstention	NN	3
abstentions	abstention	NNS	4
abstinence	abstinence	NN	50
abstinence	abstinence	NNP	10
abstinence	abstinence	UNC	1
abstinence-based	abstinence-based	JJ	2
abstinence-only	abstinence-only	JJ	8
abstinence-oriented	abstinence-oriented	JJ	1
abstinence-plus	abstinence-plus	JJ	1
abstinent	abstinent	NN	3
abstinent	abstinent	NNP	1
abstract	abstract	JJ	239
abstract	abstract	NNP	30
abstract	abstract	UNC	2
abstractdataadapter	abstractdataadapter	NNP	1
abstracted	abstracted	JJ	35
abstracting	abstract	VBG	4
abstracting	abstracting	NNP	1
abstraction	abstraction	NN	53
abstraction	abstraction	NNP	1
abstractionist	abstractionist	NN	2
abstractions	abstraction	NNS	13
abstractly	abstractly	RB	6
abstractness	abstractness	NNS	1
abstractors	abstractor	NNS	3
abstracts	abstract	NNP	12
abstracts	abstract	NNS	73
abstruse	abstruse	NN	13
abstruse-seeming	abstruse-seeming	JJ	1
absurd	absurd	JJ	206
absurd	absurd	NNP	4
absurd	absurd	UNC	4
absurd-looking	absurd-looking	JJ	1
absurd-sounding	absurd-sounding	JJ	1
absurder	absurder	NNP	1
absurdism	absurdism	NN	1
absurdist	absurdist	NN	13
absurdist	absurdist	NNP	1
absurdist-tinged	absurdist-tinged	JJ	1
absurdities	absurdity	NNS	12
absurdity	absurdity	NN	51
absurdity	absurdity	NNP	3
absurdity	absurdity	UNC	1
absurdly	absurdly	RB	38
absurdly	absurdly	UNC	2
absurdum	absurdum	NN	3
absurdus	absurdus	NNP	1
absures	absure	NNP	1
abt	abt	NNP	19
abtei	abteus	NNP	1
abts	abt	NNP	4
abu	abu	NNP	217
abubakar	abubakar	NNP	12
abuela	abuelum	NN	1
abuela	abuelum	NNP	1
abuelo	abuelo	NN	7
abuelo	abuelo	NNP	4
abuen	abuen	NNP	1
abuja	abuja	NNP	1
abukayak	abukayak	NNP	1
abukhalil	abukhalil	NNP	3
abulia	abulium	NN	2
abulous	abulous	JJ	1
abumhrad	abumhrad	NNP	1
abundance	abundance	NN	392
abundance	abundance	NNP	3
abundances	abundance	NNS	27
abundant	abundant	JJ	288
abundant	abundant	NNP	12
abundantly	abundantly	RB	45
abundence	abundence	NN	1
abuot	abuot	NN	1
aburdeineh	aburdeineh	NNP	1
abusaad	abusaad	NNP	1
abusaid	abusaid	NNP	2
abuse	abuse	NN	901
abuse	abuse	NNP	106
abuse	abuse	UNC	9
abuse	abuse	VB	33
abuse-of-fiction	abuse-of-fiction	JJ	1
abuse-programs	abuse-program	JJ	1
abuse-suggesting	abuse-suggesting	JJ	1
abused	abuse	VBD	19
abused	abuse	VBN	136
abused	abused	JJ	1
abused	abused	NNP	10
abused	abused	UNC	1
abuseinfederal	abuseinfederal	NNP	2
abuseofpower	abuseofpower	NN	1
abuser	abuser	NN	16
abusers	abuser	NNP	4
abusers	abuser	NNS	32
abusers	abusers	UNC	1
abuses	abuse	NNP	7
abuses	abuse	NNS	195
abuses	abuses	UNC	1
abusing	abuse	VBG	79
abusing	abusing	NNP	4
abusive	abusive	JJ	139
abusive	abusive	NNP	2
abusive-cum-substance-abusive-cum-mooching	abusive-cum-substance-abusive-cum-mooching	JJ	1
abusively	abusively	RB	1
abut	abut	NN	11
abutments	abutment	NNS	1
abuts	abut	NNS	3
abutted	abutted	JJ	2
abutting	abut	VBG	5
abutting	abutting	NNP	1
abuturab	abuturab	NNP	1
abuzz	abuzz	JJ	7
abwab	abwab	NN	1
abwender	abwender	NNP	1
abx	abx	NNP	1
aby	aby	NN	1
abydos	abydo	NNP	1
abymes	abyme	NNP	1
abysii	abysius	NN	1
abysinth	abysinth	NN	1
abysmal	abysmal	NN	21
abysmally	abysmally	RB	3
abyss	abyss	NN	1
abyss	abyss	NNS	17
abyss	abyss	UNC	1
abyss-gazing	abyss-gazing	JJ	1
abyssi	abyssus	NN	11
abyssinia	abyssinium	NNP	7
abyssinian	abyssinian	NNP	2
abyssmally	abyssmally	RB	1
abzug	abzug	NNP	3
ab­bey	ab­bey	NN	1
ac	ac	NN	34
ac	ac	NNP	242
ac-hoteles	ac-hotele	JJ	2
aca	aca	NN	1
aca	aca	NNP	31
aca-limpia	aca-limpium	NNP	1
acaa	acaa	NN	2
acaa	acaa	NNP	8
acaaaaacc	acaaaaacc	NNP	1
acaaataggggttccgcgcaca	acaaataggggttccgcgcaca	NNP	1
acaacaaagggcagcaacaacacc	acaacaaagggcagcaacaacacc	NNP	1
acaacaccgtg	acaacaccgtg	NNP	1
acaaccagtttgctctgcttatc	acaaccagtttgctctgcttatc	NNP	1
acaba	acaba	NN	1
acacagataagttgctggcc	acacagataagttgctggcc	NNP	1
acacia	acacia	NN	6
acacia	acacia	NNP	2
acacia-like	acacia-like	JJ	1
acad	acad	NNP	19
academe	academe	NN	8
academe	academe	NNP	2
academese	academese	NN	1
academia	academia	NN	54
academia	academia	NNP	3
academic	academic	JJ	618
academic	academic	NN	34
academic	academic	NNP	88
academic	academic	UNC	3
academic-seeming	academic-seeming	JJ	1
academic-sounding	academic-sounding	JJ	1
academic-types	academic-type	JJ	1
academically	academically	RB	24
academician	academician	NN	2
academicians	academician	NNP	1
academicians	academician	NNS	7
academicism	academicism	NN	1
academics	academic	NNP	7
academics	academic	NNS	98
academic–industrial	academic–industrial	NN	1
academie	academie	NNP	4
academies	academy	NNP	4
academies	academy	NNS	11
academy	academy	NN	66
academy	academy	NNP	331
academy	academy	UNC	1
academywomen	academywoman	NN	1
acadia	acadium	NN	1
acadia	acadium	NNP	14
acadian	acadian	NNP	7
acadians	acadian	NNP	11
acadm	acadm	NNP	2
académica	académica	NNP	1
académie	académie	NN	1
académie	académie	NNP	11
académies	académies	NNP	1
acadé­mie	acadé­mie	NNP	1
acagcctgaccgtggagaag	acagcctgaccgtggagaag	NNP	1
acagtgaagagtagtggtcg	acagtgaagagtagtggtcg	NNP	1
acalda	acalda	NN	1
acampado	acampado	NN	1
acampora	acampora	NNP	2
acan	acan	NNP	1
acanthaceae	acanthacea	NNP	1
acanthamoeba	acanthamoeba	NNP	2
acanthomoeba	acanthomoeba	NNP	1
acanthostega	acanthostega	NNP	2
acanthus	acanthus	JJ	4
acap	acap	NN	1
acapella	acapellum	NN	2
acapulco	acapulco	NNP	89
acarbon	acarbon	NN	1
acarbose	acarbose	NN	1
acars	acar	NNP	7
acas	aca	NNP	2
acass	acass	NNP	1
acat	acat	NNP	1
acatccaaacagaacgtgcc	acatccaaacagaacgtgcc	NNP	1
acatcher	acatcher	NNP	1
acatggactgaggagtag	acatggactgaggagtag	NNP	1
acatgggacgtaacagatac	acatgggacgtaacagatac	NNP	1
acatgtccagcatcaaagcgg	acatgtccagcatcaaagcgg	NNP	1
acathala	acathala	NNP	1
acatitla	acatitlum	NNP	1
acatn	acatn	NNP	1
acaule	acaule	NN	1
acauses	acause	NNP	1
aca­demy	aca­demy	NNP	1
aca­dé­mie	aca­dé­mie	NNP	1
acbd	acbd	NNP	1
acc	acc	NN	2
acc	acc	NNP	68
accaccgtggacaccttctdtdt	accaccgtggacaccttctdtdt	NNP	1
accademia	accademium	NN	1
accademia	accademium	NNP	14
accadian	accadian	NNP	1
accaggacgatcaactgggcttc	accaggacgatcaactgggcttc	NNP	1
accagtcgactctacagtgc	accagtcgactctacagtgc	NNP	1
accattgagctcttcactgatgaacttcacc	accattgagctcttcactgatgaacttcacc	NNP	1
acccaagatacctcatcacag	acccaagatacctcatcacag	NNP	1
acccatgtcaaacccatcag	acccatgtcaaacccatcag	NNP	1
acccccatctcactaattcc	acccccatctcactaattcc	NNP	1
accclaimed	accclaimed	JJ	1
accctctccaaaatcccataa	accctctccaaaatcccataa	NNP	1
accede	accede	VB	11
acceded	accede	VBD	14
acceding	accede	VBG	4
accelerate	accelerate	NNP	1
accelerate	accelerate	VB	99
accelerate	accelerate	VBP	1
accelerate-the	accelerate-the	JJ	1
accelerated	accelerate	VBD	56
accelerated	accelerate	VBN	83
accelerated	accelerated	JJ	9
accelerated	accelerated	NNP	6
accelerates	accelerate	VBZ	17
accelerating	accelerate	VBG	58
acceleration	acceleration	NN	59
acceleration	acceleration	NNP	3
acceleration	acceleration	UNC	1
accelerations	acceleration	NNS	1
accelerator	accelerator	NN	17
accelerator	accelerator	NNP	1
accelerod	accelerod	NN	2
accelerometer	accelerometer	NN	1
accelerometer-based	accelerometer-based	JJ	3
accelerometers	accelerometer	NNS	1
acceleromyography	acceleromyography	NN	1
accelrys	accelry	NNP	1
accent	accent	NN	364
accent	accent	NNP	23
accent	accent	UNC	8
accent-free	accent-free	JJ	1
accent-reduction	accent-reduction	JJ	1
accent-training	accent-training	JJ	2
accented	accented	JJ	14
accenting	accent	VBG	6
accents	accent	NNP	15
accents	accent	NNS	122
accents-fighting-and-sweating-in-the-desert	accents-fighting-and-sweating-in-the-desert	JJ	1
accentservices	accentservice	NNP	1
accentuate	accentuate	NN	15
accentuate	accentuate	NNP	1
accentuated	accentuated	JJ	18
accentuated	accentuated	UNC	1
accentuates	accentuate	NNS	5
accentuating	accentuate	VBG	7
accenture	accenture	NNP	9
accep-tance	accep-tance	JJ	1
accept	accept	NNP	15
accept	accept	UNC	2
accept	accept	VB	770
accept	accept	VBP	136
acceptability	acceptability	NN	42
acceptability	acceptability	NNP	9
acceptable	acceptable	JJ	474
acceptable	acceptable	NNP	5
acceptable	acceptable	UNC	2
acceptableî	acceptableî	NN	1
acceptably	acceptably	RB	5
acceptance	acceptance	NN	296
acceptance	acceptance	NNP	18
acceptance	acceptance	UNC	2
acceptance-speech	acceptance-speech	JJ	1
acceptanceprocedures	acceptanceprocedure	NNS	1
acceptances	acceptance	NNS	9
accepted	accept	VBD	409
accepted	accept	VBN	418
accepted	accepted	JJ	9
accepted	accepted	NNP	18
accepted	accepted	UNC	5
accepter	accepter	NN	1
accepters	accepter	NNS	1
acceptible	acceptible	JJ	1
accepting	accept	VBG	249
accepting	accepting	NNP	9
accepting	accepting	UNC	1
acceptor	acceptor	NN	66
acceptor	acceptor	UNC	1
acceptors	acceptor	NNS	9
accepts	accept	NNP	1
accepts	accept	VBZ	102
accesorized	accesorized	JJ	1
access	access	JJ	1
access	access	NN	1970
access	access	NNP	226
access	access	UNC	10
access	access	VB	168
access-restriction	access-restriction	JJ	1
access-that	access-that	JJ	1
access-to-justice	access-to-justice	JJ	1
access-to-records	access-to-record	JJ	1
accessable	accessable	JJ	1
accessdata	accessda	NN	1
accessed	accessed	JJ	67
accessed	accessed	NNP	4
accessed-like	accessed-like	JJ	1
accesses	access	NNS	5
accessibilities	accessibility	NNS	1
accessibility	accessibility	NN	65
accessibility	accessibility	NNP	3
accessible	accessible	JJ	359
accessible	accessible	NNP	3
accessible	accessible	UNC	1
accessibly	accessibly	RB	3
accessing	access	VBG	40
accessing	accessing	NNP	3
accession	accession	NN	308
accession	accession	NNP	58
accession	accession	UNC	1
accessioned	accessioned	JJ	1
accessions	accession	NNS	14
accessionsperassembly	accessionsperassembly	RB	1
accessit	accessit	NN	1
accessories	accessories	UNC	1
accessories	accessory	NNP	1
accessories	accessory	NNS	70
accessorise	accessorise	NN	1
accessorise	accessorise	NNP	1
accessorize	accessorize	NN	5
accessorize	accessorize	NNP	1
accessorized	accessorized	JJ	3
accessorizing	accessorize	VBG	1
accessory	accessory	JJ	73
accessory	accessory	NNP	3
accessto	accessto	NN	1
accessworld	accessworld	NNP	1
accgtgaaaagatgatgacccag	accgtgaaaagatgatgacccag	NNP	1
accgtgaccg	accgtgaccg	NNP	1
acch	acch	NNP	1
accha	accha	NN	1
accham	accham	NNP	1
acci	accus	NNP	1
accid	accid	NNP	1
accident	accident	JJ	1
accident	accident	NN	523
accident	accident	NNP	39
accident	accident	UNC	2
accident-prone	accident-prone	JJ	2
accident-related	accident-related	JJ	1
accidental	accidental	NN	105
accidental	accidental	NNP	18
accidentalis	accidentali	NNS	1
accidentally	accidentally	NNP	2
accidentally	accidentally	RB	192
accidently	accidently	RB	12
accidents	accident	NNP	7
accidents	accident	NNS	177
accidents	accidents	JJ	1
accidents	accidents	UNC	2
acciderant	acciderant	NN	1
accidnet	accidnet	NN	1
accio	accio	NN	1
accipiens	accipien	NNS	1
accipitrine	accipitrine	NN	1
accival	accival	NNP	1
acclaim	acclaim	NN	50
acclaim	acclaim	NNP	2
acclaim	acclaim	UNC	1
acclaim	acclaim	VB	1
acclaimed	acclaimed	JJ	81
acclaimed	acclaimed	NNP	3
acclamabant	acclamabant	NN	1
acclamation	acclamation	NN	4
acclimatation	acclimatation	NNP	3
acclimate	acclimate	NN	7
acclimated	acclimated	JJ	14
acclimating	acclimate	VBG	6
acclimating	acclimating	NNP	1
acclimation	acclimation	NN	21
acclimation	acclimation	NNP	2
acclimatization	acclimatization	NN	4
acclimatize	acclimatize	NN	4
acclimatized	acclimatized	JJ	1
accn	accn	NNP	1
accnewsmedia	accnewsmedium	NN	1
accnu	accnu	NNP	1
acco	acco	NNP	12
accoberry	accoberry	NNP	1
accolade	accolade	NN	11
accolades	accolade	NNS	24
accom	accom	NN	1
accomadating	accomadate	VBG	1
accommodate	accommodate	VB	196
accommodate	accommodate	VBP	8
accommodated	accommodate	VBN	31
accommodates	accommodate	NNS	19
accommodating	accommodate	VBG	34
accommodating	accommodating	NNP	1
accommodatingly	accommodatingly	NNP	1
accommodation	accommodation	NN	81
accommodation	accommodation	NNP	2
accommodation	accommodation	UNC	1
accommodationist	accommodationist	NN	2
accommodations	accommodation	NNP	7
accommodations	accommodation	NNS	103
accommodations	accommodations	UNC	1
accomodate	accomodate	VB	8
accomodation	accomodation	NN	5
accomodationists	accomodationist	NNS	1
accomodations	accomodation	NNS	2
accompanied	accompanied	NNP	7
accompanied	accompanied	UNC	3
accompanied	accompany	VBD	58
accompanied	accompany	VBN	378
accompanies	accompany	NNP	1
accompanies	accompany	VBZ	61
accompaniment	accompaniment	NN	25
accompaniments	accompaniment	NNP	3
accompaniments	accompaniment	NNS	2
accompanist	accompanist	NN	3
accompany	accompany	NNP	3
accompany	accompany	VB	117
accompanying	accompany	VBG	260
accompanying	accompanying	NNP	12
accompianied	accompianied	JJ	1
accompianment	accompianment	NN	2
accompli	accompli	NN	10
accomplice	accomplice	NN	31
accomplice	accomplice	UNC	1
accomplices	accomplice	NNS	18
accomplis	accompli	NNS	1
accomplish	accomplish	JJ	1
accomplish	accomplish	NNP	1
accomplish	accomplish	VB	251
accomplish-easily	accomplish-easily	JJ	1
accomplished	accomplish	VBN	339
accomplished	accomplished	JJ	3
accomplished	accomplished	NNP	2
accomplished	accomplished	UNC	1
accomplishes	accomplish	VBZ	15
accomplishing	accomplish	VBG	41
accomplishment	accomplishment	NN	107
accomplishment	accomplishment	NNP	1
accomplishment	accomplishment	UNC	2
accomplishments	accomplishment	NNP	5
accomplishments	accomplishment	NNS	137
accomplit	accomplit	NN	1
accompong	accompong	NNP	1
accord	accord	JJ	1
accord	accord	NN	132
accord	accord	NNP	17
accord	accord	UNC	1
accord	accord	VB	4
accordance	accordance	NN	383
accordance	accordance	NNP	2
accordancewith	accordancewith	NN	1
accordant	accordant	NN	1
accorded	accord	VBD	16
accorded	accord	VBN	32
accordence	accordence	NN	1
accordianist	accordianist	NN	1
accordians	accordian	NNS	1
according	accord	VBG	5021
according	according	UNC	7
accordingly	accordingly	RB	264
accordingly	accordingly	UNC	1
accordion	accordion	NN	27
accordion	accordion	NNP	3
accordion-laced	accordion-laced	JJ	1
accordion-like	accordion-like	JJ	1
accordionated	accordionated	NNP	1
accordionist	accordionist	NN	4
accordions	accordion	NNS	12
accords	accord	NNPS	10
accords	accord	NNS	67
accords	accords	UNC	1
accoring	accore	VBG	1
accorsi	accorsus	NNP	1
accosted	accosted	JJ	10
accosting	accost	VBG	3
accosts	accost	NNS	1
account	account	JJ	1
account	account	NN	1450
account	account	NNP	36
account	account	UNC	10
account	account	VB	398
account	account	VBP	110
accountabilities	accountability	NNS	2
accountability	accountability	NN	374
accountability	accountability	NNP	85
accountability-can	accountability-can	JJ	1
accountability-with	accountability-with	JJ	1
accountabilitycontrol	accountabilitycontrol	NNP	1
accountabilityreportis	accountabilityreporti	NNP	1
accountable	accountable	JJ	213
accountable	accountable	NNP	6
accountable	accountable	UNC	1
accountancy	accountancy	NN	9
accountancy	accountancy	NNP	3
accountant	accountant	NN	81
accountant	accountant	NNP	7
accountant-client	accountant-client	JJ	1
accountantand	accountantand	NN	1
accountants	accountant	NNP	2
accountants	accountant	NNPS	61
accountants	accountant	NNS	113
accountants	accountants	NNP	2
accountants	accountants	UNC	1
accountants-www	accountants-www	NNP	2
accounted	account	VBD	160
accounted	account	VBN	115
accounted	accounted	NNP	1
accounting	account	VBG	87
accounting	accounting	NN	1387
accounting	accounting	NNP	530
accounting	accounting	UNC	2
accounting-fraud	accounting-fraud	JJ	1
accounting-oversight	accounting-oversight	JJ	1
accountingmalpractice	accountingmalpractice	NNP	1
accountingrelated	accountingrelated	JJ	1
accounts	account	NNP	8
accounts	account	NNPS	60
accounts	account	NNS	869
accounts	account	VBZ	59
accounts	accounts	UNC	3
accounts-and	accounts-and	JJ	1
accounts-and	accounts-and	NNP	1
accounts-discussed	accounts-discussed	JJ	1
accounts-to	accounts-to	JJ	1
accout	accout	NN	1
accouterment	accouterment	NN	2
accouterments	accouterment	NNS	5
accoutred	accoutred	JJ	1
accoutrements	accoutrements	NNS	12
accra	accra	NNP	12
accreditation	accreditation	NN	20
accreditation	accreditation	NNP	15
accreditation	accreditation	UNC	1
accredited	accredited	JJ	23
accrediting	accredit	VBG	5
accredits	accredit	NNS	3
accreted	accrete	VBN	2
accreting	accrete	VBG	1
accretion	accretion	NN	16
accretions	accretion	NNS	3
accross	accross	NNS	1
accrual	accrual	NN	10
accrual	accrual	NNP	2
accrue	accrue	UNC	1
accrue	accrue	VB	30
accrued	accrue	VBN	39
accrues	accrue	VBZ	8
accruing	accrue	VBG	9
acct	acct	NN	2
acctcccaaactatagattgggtg	acctcccaaactatagattgggtg	NNP	1
acctgcactc	acctgcactc	NNP	1
acctran	acctran	NNP	2
accttattttaaaaataaagttaa	accttattttaaaaataaagttaa	NNP	1
accttggaagaaccaaatc	accttggaagaaccaaatc	NNP	1
accucam	accucam	NNP	1
accueillir	accueillir	NN	1
accugel	accugel	NNP	1
acculturated	acculturated	JJ	3
acculturating	acculturate	VBG	2
acculturation	acculturation	NN	6
acculturation	acculturation	NNP	1
accumbens	accumben	NNS	5
accumbens	accumbens	UNC	1
accumen	accuman	NN	1
accummulated	accummulated	JJ	1
accumulate	accumulate	VBP	147
accumulated	accumulate	VBN	188
accumulated	accumulated	NNP	3
accumulates	accumulate	NNS	59
accumulating	accumulate	VBG	67
accumulating	accumulating	NNP	7
accumulation	accumulation	NN	464
accumulation	accumulation	NNP	4
accumulations	accumulation	NNP	2
accumulations	accumulation	NNS	16
accupressure	accupressure	NN	2
accuracies	accuracy	NNS	7
accuracy	accuracy	NN	632
accuracy	accuracy	NNP	25
accuracy-the	accuracy-the	JJ	1
accuradio	accuradio	NNP	2
accurate	accurate	JJ	801
accurate	accurate	NNP	28
accurate	accurate	UNC	3
accurately	accurately	NNP	2
accurately	accurately	RB	353
accurately	accurately	UNC	2
accuratelymodel	accuratelymodel	NN	1
accuray	accuray	NN	1
accurist	accurist	NNP	1
accurs	accur	NNS	1
accursed	accursed	JJ	2
accursed	accursed	NNP	1
accusation	accusation	NN	106
accusation	accusation	NNP	1
accusational	accusational	NN	1
accusations	accusation	NNP	6
accusations	accusation	NNS	199
accusations	accusations	UNC	3
accusative	accusative	JJ	6
accusatory	accusatory	JJ	9
accuse	accuse	NNP	2
accuse	accuse	VB	68
accuse	accuse	VBP	68
accused	accuse	VBD	301
accused	accuse	VBN	541
accused	accused	NNP	19
accused	accused	UNC	2
accuser	accuser	NN	31
accuser	accuser	UNC	1
accusers	accuser	NNS	25
accuses	accus	NNP	1
accuses	accusee	VBZ	108
accuses	accuses	UNC	1
accusing	accuse	VBG	150
accusing	accusing	NNP	2
accusing	accusing	UNC	1
accusingly	accusingly	RB	4
accusitive	accusitive	JJ	3
accustomed	accustom	VBN	109
accustomed	accustomed	JJ	5
accustomed	accustomed	NNP	1
accutron	accutron	NNP	20
accutrons	accutron	NNP	4
accuvue	accuvue	NNP	1
accuweather	accuweather	NNP	4
accuzyme	accuzyme	NNP	1
accytnarggt	accytnarggt	NNP	1
acd	acd	NNP	8
acdcrocks	acdcrock	NNS	1
ace	ace	NN	69
ace	ace	NNP	87
ace-i	ace-us	NNP	4
ace-inhibitor	ace-inhibitor	NNP	2
ace-inhibitors	ace-inhibitor	NNP	7
acea	acea	NNP	1
acebuche	acebuche	NNP	1
acecray	acecray	NN	1
aced	aced	JJ	3
acedb	acedb	NNP	6
aceee	aceee	NNP	3
aceh	aceh	NNP	14
acehnese	acehnese	NNP	4
aceisms	aceism	NNP	2
aceitunasoliveslangostaspiny	aceitunasoliveslangostaspiny	NN	1
acela	acelum	NNP	10
acellular	acellular	NN	1
acentric	acentric	JJ	1
aceous	aceous	NNP	1
acequia	acequium	NN	1
acer	acer	NNP	2
aceralia	aceralium	NNP	1
acerbic	acerbic	JJ	14
acerbity	acerbity	NN	1
acert	acert	NNP	1
aces	ace	NNP	9
aces	ace	VBZ	29
acess	acess	NNS	1
acesulfame	acesulfame	NN	2
acetabularia	acetabularium	NNP	4
acetabulum	acetabulum	NN	2
acetaminophen	acetaminophen	NN	14
acetaminophen	acetaminophen	NNP	1
acetate	acetate	NN	171
acetate	acetate	NNP	10
acetates	acetate	NNS	1
acetazolamide	acetazolamide	NN	23
acetazolamide	acetazolamide	NNP	3
acetazolamide-induced	acetazolamide-induced	JJ	1
acetazolamide-induced	acetazolamide-induced	NNP	1
acetic	acetic	JJ	49
acetic	acetic	NNP	1
acetivorans	acetivoran	NNS	4
acetobutylicum	acetobutylicum	NN	13
acetol	acetol	NN	1
acetomeniphin	acetomeniphin	NN	1
acetominophen	acetominophen	NN	1
acetone	acetone	NN	41
acetone	acetone	NNP	3
acetone-dried	acetone-dried	JJ	5
acetone-dry	acetone-dry	JJ	1
acetonitrile	acetonitrile	NN	22
acetonitrile	acetonitrile	NNP	1
acetoxylmethyl	acetoxylmethyl	NN	1
acetoxymethyl	acetoxymethyl	NN	8
acetoxymethylester	acetoxymethylester	NN	2
acetyl	acetyl	NN	34
acetyl-leu-leu-norleucinal	acetyl-leu-leu-norleucinal	JJ	1
acetyl-leucyl-leucyl-norleucinal	acetyl-leucyl-leucyl-norleucinal	JJ	1
acetyl-leucyl-leucyl-norleucinal	acetyl-leucyl-leucyl-norleucinal	NNP	1
acetyl-transferase	acetyl-transferase	JJ	1
acetyl-transferases	acetyl-transferase	JJ	1
acetylase	acetylase	NN	1
acetylated	acetylated	JJ	20
acetylation	acetylation	NN	33
acetylbarlerin	acetylbarlerin	NN	1
acetylcholine	acetylcholine	NN	69
acetylcholine	acetylcholine	NNP	4
acetylcholine-mediated	acetylcholine-mediated	JJ	1
acetylcholine-stimulated	acetylcholine-stimulated	JJ	1
acetylcholinesterase	acetylcholinesterase	NN	4
acetylcysteine	acetylcysteine	NN	3
acetylenic	acetylenic	JJ	1
acetylglucosamine	acetylglucosamine	NN	1
acetylhydorolase	acetylhydorolase	NNP	1
acetyllysines	acetyllysine	NNS	1
acetylmuramate	acetylmuramate	NN	3
acetylornithine	acetylornithine	NN	1
acetyloxy	acetyloxy	NN	2
acetylsalicylic	acetylsalicylic	JJ	1
acetylserine	acetylserine	NN	1
acetylshanzhiside	acetylshanzhiside	NN	1
acetyltransferase	acetyltransferase	NN	35
acetyltransferases	acetyltransferase	NNS	3
acevedo	acevedo	NNP	3
aceves	aceve	NNP	2
acf	acf	NN	1
acf	acf	NNP	15
acfirmi	acfirmus	NNP	7
acg	acg	NN	2
acg	acg	NNP	20
acgaacagcatctcct	acgaacagcatctcct	NNP	1
acgcgcggagttggc	acgcgcggagttggc	NNP	1
acgcgttgcgtatcgcgcg	acgcgttgcgtatcgcgcg	NNP	1
acggcttttcc	acggcttttcc	NNP	1
acgme	acgme	NNP	3
acgtca	acgtca	NNP	1
acgtgc	acgtgc	NNP	1
acgttgcgagctgctgcggc	acgttgcgagctgctgcggc	NNP	2
ach	ach	NN	3
ach	ach	NNP	80
achada	achada	NNP	4
achaean	achaean	NNP	1
achaeans	achaean	NNP	3
achaiac	achaiac	NNP	1
achange	achange	NN	1
achapman	achapman	NN	2
achbp	achbp	NNP	33
ache	ache	NN	35
ache	ache	NNP	1
achebe	achebe	NNP	4
ached	ached	JJ	5
acheh	acheh	NNP	2
acheive	acheive	JJ	3
acheived	acheived	JJ	3
acheivement	acheivement	NN	2
achenbach	achenbach	NNP	4
aches	ache	NNS	25
acheson	acheson	NNP	52
achey	achey	NN	11
acheyness	acheyness	NNS	1
achh	achh	NNP	1
achiasmatic	achiasmatic	JJ	22
achievable	achievable	JJ	33
achievable	achievable	NNP	3
achieve	achieve	NNP	11
achieve	achieve	VB	846
achieve	achieve	VBP	60
achieved	achieve	VBD	151
achieved	achieve	VBN	609
achieved	achieved	NNP	6
achieved	achieved	UNC	2
achieved-can	achieved-can	JJ	1
achievedby	achievedby	NN	1
achievement	achievement	JJ	2
achievement	achievement	NN	322
achievement	achievement	NNP	18
achievement	achievement	UNC	1
achievements	achievement	NNP	15
achievements	achievement	NNS	151
achievements	achievements	UNC	3
achiever	achiever	NN	3
achiever	achiever	NNP	1
achievers	achiever	NNS	9
achievers	achievers	UNC	1
achieves	achieve	NNP	1
achieves	achieve	VBZ	67
achieves	achieves	NN	1
achieving	achieve	VBG	278
achieving	achieving	NNP	28
achieving	achieving	UNC	1
achille	achille	NNP	1
achillea	achillea	NN	1
achilles	achille	NNP	38
achilles	achille	NNS	2
aching	ache	VBG	41
achingly	achingly	RB	6
achingly-long	achingly-long	JJ	1
achiron	achiron	NNP	1
achives	achive	NNS	1
achla	achlum	NNP	1
achlamu	achlamu	NNP	1
achmed	achmed	NNP	38
achner	achner	NN	1
achomawi	achomawus	NN	1
achomawi	achomawus	NNP	2
achondroplastic	achondroplastic	UNC	1
achoo	achoo	NN	1
achos	acho	NNS	1
achr	achr	NNP	26
achromatic	achromatic	JJ	1
achromatopic	achromatopic	JJ	1
achromatopsia	achromatopsia	UNC	1
achromatopsia	achromatopsium	NN	1
achrs	achr	NNP	13
acht	acht	NNP	1
achterburg	achterburg	NNP	1
achtgroschenjunge	achtgroschenjunge	NNP	2
achtung	achtung	NNP	3
achy	achy	NN	6
achy	achy	NNP	1
aci	acus	NNP	113
acid	acid	JJ	1
acid	acid	NN	1926
acid	acid	NNP	105
acid	acid	UNC	2
acid-albumin-dextrose-catalase	acid-albumin-dextrose-catalase	JJ	1
acid-alcohol-formalin	acid-alcohol-formalin	JJ	1
acid-base	acid-base	JJ	2
acid-based	acid-based	JJ	5
acid-binding	acid-binding	JJ	4
acid-blooded	acid-blooded	JJ	1
acid-citrate-dextrose	acid-citrate-dextrose	JJ	1
acid-containing	acid-containing	JJ	1
acid-denatured	acid-denatured	JJ	1
acid-fast	acid-fast	JJ	4
acid-filled	acid-filled	JJ	1
acid-free	acid-free	JJ	2
acid-induced	acid-induced	JJ	4
acid-long	acid-long	JJ	1
acid-mediated	acid-mediated	JJ	2
acid-nucleotide	acid-nucleotide	JJ	1
acid-phenol	acid-phenol	JJ	1
acid-phosphate	acid-phosphate	JJ	1
acid-reactive	acid-reactive	JJ	2
acid-rich	acid-rich	JJ	1
acid-soaked	acid-soaked	JJ	1
acid-stable	acid-stable	JJ	1
acid-stimulated	acid-stimulated	JJ	1
acid-tolerant	acid-tolerant	JJ	3
acid-tolerant	acid-tolerant	NNP	1
acid-tongued	acid-tongued	JJ	2
acid-transporting	acid-transporting	JJ	2
acid-treated	acid-treated	JJ	8
acid-tris	acid-tri	JJ	2
acid-urea	acid-urea	JJ	2
acid-washing	acid-washing	JJ	1
acid-worded	acid-worded	JJ	1
acidarmanus	acidarmanus	JJ	1
acidemia	acidemium	NN	4
acidemias	acidemia	NNS	2
acidic	acidic	JJ	152
acidic	acidic	NNP	4
acidification	acidification	NN	14
acidification	acidification	NNP	3
acidified	acidify	VBN	13
acidify	acidify	NN	2
acidimetry	acidimetry	NN	1
acidiphilum	acidiphilum	NNP	1
acidithiobacillus	acidithiobacillus	NNP	1
acidity	acidity	NN	25
acidly	acidly	RB	4
acidogenic	acidogenic	JJ	1
acidop	acidop	NN	1
acidophilous	acidophilous	JJ	1
acidophilum	acidophilum	NN	35
acidophiluma-atpase	acidophiluma-atpase	JJ	1
acidophilumintein	acidophilumintein	NN	1
acidophilus	acidophilus	JJ	4
acidopholus	acidopholus	JJ	1
acidosis	acidosis	NNP	1
acidosis	acidosis	NNS	27
acids	acid	NNP	4
acids	acid	NNS	1045
acids	acids	UNC	3
aciduria	acidurium	NN	18
acid–	acid–	NN	2
acid–glutamic	acid–glutamic	JJ	1
acid–leucine	acid–leucine	NN	1
acinar	acinar	NN	4
acinetobacter	acinetobacter	NNP	12
acing	ace	VBG	3
acing	acing	NNP	1
acini	acinus	NN	14
acipenser	acipenser	NNP	3
acipenseriformes	acipenseriform	NNP	2
acis	aci	NNP	1
acitivy	acitivy	NN	1
aciv	aciv	NNP	1
ack	ack	NN	8
ack	ack	NNP	72
ackab	ackab	NN	3
ackee	ackee	NN	4
acker	acker	NNP	33
ackerly	ackerly	NNP	2
ackerman	ackerman	NNP	13
ackermann	ackermann	NNP	9
ackil	ackil	NNP	3
ackland	ackland	NNP	1
acklins	acklin	NNP	4
acknolwedge	acknolwedge	NN	1
acknowledge	acknowledge	NNP	1
acknowledge	acknowledge	UNC	1
acknowledge	acknowledge	VB	163
acknowledge	acknowledge	VBP	114
acknowledged	acknowledge	VBD	330
acknowledged	acknowledge	VBN	114
acknowledged	acknowledged	JJ	1
acknowledgedly	acknowledgedly	RB	1
acknowledgement	acknowledgement	NN	38
acknowledgement	acknowledgement	NNP	2
acknowledgements	acknowledgement	NNP	10
acknowledgements	acknowledgement	NNS	7
acknowledges	acknowledge	NNP	1
acknowledges	acknowledge	VBZ	133
acknowledges	acknowledges	UNC	1
acknowledging	acknowledge	VBG	95
acknowledging	acknowledging	NNP	8
acknowledgment	acknowledgment	NN	44
acknowledgment	acknowledgment	NNP	2
acknowledgment	acknowledgment	UNC	3
acknowledgments	acknowledgment	NNP	9
acknowledgments	acknowledgment	NNS	10
acknowlnotes	acknowlnote	NN	1
ackroyd	ackroyd	NNP	6
acl	acl	NN	4
acl	acl	NNP	17
acland	acland	NNP	1
acleod	acleod	NN	1
aclivmfy	aclivmfy	NNP	2
acls	acl	NNP	2
aclu	aclu	NNP	45
aclu	aclu	UNC	1
acly	acly	NNP	10
acm	acm	NNP	13
acmb	acmb	NNP	9
acmb-like	acmb-like	NNP	2
acme	acme	NN	2
acme	acme	NNP	8
acmed	acmed	NNP	1
acmepet	acmepet	NNP	1
acmm	acmm	NNP	1
acmnpv	acmnpv	NNP	4
acn	acn	NNP	2
acnab	acnab	NN	4
acne	acne	NN	7
acne	acne	NNP	1
acne-free	acne-free	JJ	1
acnv	acnv	NNP	1
aco	aco	NNP	2
acoa	acoa	NNP	2
acocella	acocellum	NNP	2
acocmplish	acocmplish	NN	1
acoel	acoel	NN	1
acoelomate	acoelomate	NN	1
acog	acog	NN	2
acog	acog	NNP	1
acoh	acoh	NNP	1
acolman	acolman	NNP	1
acolyte	acolyte	NN	7
acolytes	acolyte	NNS	13
acoma	acoma	NNP	4
acombined	acombined	JJ	1
acompany	acompany	NNP	1
acompared	acompared	NNP	1
acompares	acompare	NNP	1
acondition	acondition	NN	1
aconfession	aconfession	NNP	1
aconfirms	aconfirm	NNP	1
aconitase	aconitase	NNP	1
aconite	aconite	NN	1
acord	acord	NNP	1
acorn	acorn	NN	5
acorn	acorn	NNP	2
acorn-shape	acorn-shape	JJ	1
acorns	acorn	NNS	1
acosta	acosta	NNP	5
acosts	acost	NNS	1
acoustic	acoustic	JJ	69
acoustic	acoustic	NNP	8
acoustical	acoustical	JJ	5
acoustically	acoustically	RB	7
acoustics	acoustic	NNP	1
acoustics	acoustic	NNS	25
acoustiguide	acoustiguide	NN	1
acoustra	acoustra	NNP	1
acovers	acover	NNS	1
acp	acp	NNP	9
acpa	acpa	NN	2
acps	acp	NNP	1
acq	acq	NNP	1
acqua	acqua	NN	1
acquaint	acquaint	NN	5
acquaintance	acquaintance	NN	85
acquaintance	acquaintance	NNP	1
acquaintances	acquaintance	NNP	7
acquaintances	acquaintance	NNS	45
acquaintanceship	acquaintanceship	NN	1
acquaintanceships	acquaintanceship	NNS	1
acquainted	acquaint	VBN	42
acquainted	acquainted	NNP	1
acquainting	acquaint	VBG	1
acquaints	acquaint	NNS	1
acquiesce	acquiesce	VB	3
acquiesced	acquiesce	VBD	8
acquiescence	acquiescence	NN	12
acquiescent	acquiescent	NN	3
acquiesces	acquiesce	NNS	1
acquiescing	acquiesce	VBG	3
acquiesence	acquiesence	NN	1
acquire	acquire	NN	13
acquire	acquire	NNP	5
acquire	acquire	UNC	2
acquire	acquire	VB	312
acquireagency	acquireagency	NN	1
acquired	acquire	VBD	202
acquired	acquire	VBN	490
acquired	acquired	JJ	2
acquired	acquired	UNC	1
acquiree	acquiree	NN	1
acquirees	acquiree	NNS	1
acquirer	acquirer	NN	7
acquirers	acquirer	NNS	5
acquires	acquire	NNP	1
acquires	acquire	VBZ	24
acquiring	acquire	VBG	179
acquiring	acquiring	NNP	14
acquisition	acquisition	NN	638
acquisition	acquisition	NNP	144
acquisition-driven	acquisition-driven	JJ	1
acquisition-in-process	acquisition-in-process	JJ	1
acquisitionas	acquisitiona	NNS	1
acquisitionofficials	acquisitionofficial	NNS	1
acquisitions	acquisition	NNS	142
acquisitions	acquisitions	UNC	1
acquisitive	acquisitive	JJ	4
acquisitiveness	acquisitiveness	NNS	3
acquit	acquit	VB	17
acquits	acquit	NNP	1
acquits	acquit	NNS	3
acquittal	acquittal	NN	46
acquittal	acquittal	NNP	1
acquittal	acquittal	UNC	1
acquittals	acquittal	NNS	8
acquitted	acquit	VBN	53
acquitted	acquitted	NNP	2
acquitted	acquitted	UNC	1
acquitting	acquit	VBG	3
acqusitive	acqusitive	JJ	1
acr	acr	NN	1
acr	acr	NNP	32
acral	acral	NN	2
acrasin	acrasin	NN	2
acre	acre	NN	188
acre	acre	NNP	23
acreage	acreage	NN	14
acreage	acreage	NNP	1
acreman	acreman	NN	1
acres	acre	NNP	17
acres	acre	NNS	355
acres	acres	UNC	1
acrid	acrid	NN	13
acridine	acridine	NN	13
acrimonious	acrimonious	JJ	9
acrimony	acrimony	NN	10
acrimony	acrimony	NNP	1
acrisius	acrisius	NNP	2
acritude	acritude	NN	1
acro	acro	NN	2
acrobat	acrobat	NN	7
acrobat	acrobat	NNP	13
acrobatic	acrobatic	JJ	17
acrobatic	acrobatic	NNP	2
acrobatically	acrobatically	RB	2
acrobatics	acrobatics	NNP	3
acrobatics	acrobatics	NNS	12
acrobats	acrobat	NNP	4
acrobats	acrobat	NNS	4
acrocentric	acrocentric	JJ	4
acrocentrics	acrocentric	NNS	1
acrocomia	acrocomium	NNP	2
acrocorinth	acrocorinth	NNP	1
acrolein	acrolein	NN	1
acromegaly	acromegaly	RB	4
acronical	acronical	JJ	1
acronym	acronym	JJ	1
acronym	acronym	NN	75
acronym	acronym	NNP	6
acronym-farm	acronym-farm	NNP	1
acronymalicious	acronymalicious	JJ	1
acronymed	acronymed	JJ	2
acronymic	acronymic	JJ	2
acronymized	acronymized	JJ	1
acronyms	acronym	NNP	6
acronyms	acronym	NNS	56
acronyms	acronyms	UNC	1
acropolis	acropoli	NNP	49
acropolis	acropoli	NNS	3
acropper	acropper	NN	1
acros	acro	NNS	1
acrosomal	acrosomal	NN	1
acrosome	acrosome	NN	1
across	across	IN	3895
across	across	NNP	6
across	across	RP	5
across	across	UNC	8
across-array	across-array	JJ	1
across-array-design	across-array-design	JJ	1
across-sites	across-site	JJ	1
across-study	across-study	NNP	4
across-the-board	across-the-board	JJ	31
across-the-board-pay	across-the-board-pay	JJ	1
across-the-top	across-the-top	JJ	2
acrosss	acrosss	NNS	1
acrossthe	acrossthe	NN	1
acrostic	acrostic	JJ	2
acrostics	acrostic	NNP	1
acrostics	acrostic	NNS	2
acrybp	acrybp	NNP	1
acrydite	acrydite	NN	1
acrylamide	acrylamide	NN	22
acrylamide-urea	acrylamide-urea	JJ	1
acrylate	acrylate	NN	1
acrylic	acrylic	JJ	9
acrylic	acrylic	NNP	2
acr­oss	acr­oss	NNS	1
acs	ac	NNP	59
acs-grade	acs-grade	NNP	1
acse	acse	NN	4
acse-hp	acse-hp	JJ	4
acsension	acsension	NNP	1
acsf	acsf	NNP	6
acshun	acshun	NN	1
acsp	acsp	NNP	1
act	act	JJ	1
act	act	NN	1050
act	act	NNP	2060
act	act	UNC	12
act	act	VB	626
act	act	VBP	151
act-containing	act-containing	JJ	2
act-expressing	act-expressing	JJ	2
act-like	act-like	NNP	1
act-strategic	act-strategic	NNP	1
act-up-style	act-up-style	NNP	1
act-which	act-which	NNP	4
acta	acta	NN	20
acta	acta	NNP	2
acta-dependent	acta-dependent	NNP	2
actaatgctag	actaatgctag	NNP	1
actaeon	actaeon	NNP	2
actagtctcgagt	actagtctcgagt	NNP	1
actastrains	actastrain	NNS	1
actate	actate	NN	1
actb	actb	NNP	4
actccaaggctctcaacgaa	actccaaggctctcaacgaa	NNP	1
actd	actd	NNP	7
acted	act	VBD	234
acted	act	VBN	102
acted	acted	UNC	1
actess	actess	NNS	1
acteylated	acteylated	JJ	1
actgacgaattcagccaccatggcgctcctgctgtgc	actgacgaattcagccaccatggcgctcctgctgtgc	NNP	1
actgattttg	actgattttg	NNP	1
actgcgaagatccactga	actgcgaagatccactga	NNP	1
actggt	actggt	NNP	1
actgtg	actgtg	NNP	1
actgtggctactcagctgtg	actgtggctactcagctgtg	NNP	1
acth	acth	NNP	41
actifed	actifed	NNP	1
actillume	actillume	NNP	5
actin	actin	NN	395
actin	actin	NNP	14
actin-activated	actin-activated	JJ	2
actin-associated	actin-associated	JJ	1
actin-based	actin-based	JJ	12
actin-based	actin-based	NNP	1
actin-binding	actin-binding	JJ	17
actin-containing	actin-containing	JJ	1
actin-cytoskeletal	actin-cytoskeletal	JJ	1
actin-dependent	actin-dependent	JJ	3
actin-depolymerizing	actin-depolymerizing	JJ	1
actin-filament	actin-filament	JJ	1
actin-filled	actin-filled	JJ	1
actin-fragmin	actin-fragmin	JJ	1
actin-like	actin-like	JJ	1
actin-modulating	actin-modulating	JJ	1
actin-myosin	actin-myosin	JJ	5
actin-rich	actin-rich	JJ	3
actin-?-galactosidase	actin-?-galactosidase	JJ	1
acting	act	VBG	814
acting	acting	NN	133
acting	acting	NNP	31
acting	acting	UNC	9
acting-class	acting-class	JJ	2
acting-out	acting-out	JJ	2
acting-wise	acting-wise	JJ	4
actinic	actinic	JJ	7
actinic	actinic	NNP	1
actinin	actinin	NNP	1
actinobacillus	actinobacillus	NNP	1
actinobacteria	actinobacterium	NN	2
actinobacteria	actinobacterium	NNP	5
actinobacterial	actinobacterial	NN	1
actinomycetales	actinomycetale	NNP	2
actinomycete	actinomycete	NN	3
actinomycete	actinomycete	NNP	1
actinomycetemcomitans	actinomycetemcomitan	NNS	2
actinomycetes	actinomycete	NNP	4
actinomycetes	actinomycete	NNS	4
actinomycetes	actinomycetes	NNP	1
actinomycin	actinomycin	NN	16
actinomycin	actinomycin	NNP	2
actinomycin-based	actinomycin-based	JJ	1
actinopterygian	actinopterygian	NN	2
actinopterygians	actinopterygian	NNS	1
actinopterygii	actinopterygius	NNP	1
actinorhodin	actinorhodin	NN	1
actins	actin	NNS	1
actin–myosin	actin–myosin	NN	1
action	action	NN	2813
action	action	NNP	218
action	action	UNC	12
action-adventure	action-adventure	JJ	4
action-and-doing	action-and-doing	JJ	2
action-and-goal	action-and-goal	JJ	1
action-comedy	action-comedy	JJ	1
action-figure	action-figure	JJ	3
action-filled	action-filled	JJ	1
action-film	action-film	JJ	1
action-movie	action-movie	NNP	1
action-oriented	action-oriented	JJ	2
action-packed	action-packed	JJ	9
action-performance	action-performance	JJ	1
action-plan	action-plan	JJ	1
action-related	action-related	JJ	1
action-the	action-the	JJ	1
action-thriller	action-thriller	JJ	1
actionable	actionable	JJ	20
actionalert	actionalert	NN	1
actioner	actioner	NN	1
actioners	actioner	NNS	1
actionless	actionless	JJ	1
actionmeasurement	actionmeasurement	NN	2
actions	action	NNP	54
actions	action	NNS	1138
actions	actions	UNC	5
actions-spending	actions-spending	JJ	1
actiony	actiony	NN	1
activa	activa	NNP	4
activase	activase	NN	2
activatable	activatable	JJ	1
activate	activate	NNP	2
activate	activate	VBP	310
activated	activate	VBN	766
activated	activated	NNP	36
activates	activate	NNP	1
activates	activate	NNS	135
activating	activate	VBG	109
activating	activating	NNP	2
activation	activation	NN	1683
activation	activation	NNP	66
activation-induced	activation-induced	JJ	13
activation-regulated	activation-regulated	JJ	1
activation-related	activation-related	JJ	1
activations	activation	NNP	1
activations	activation	NNS	1
activationâ	activationâ	NN	1
activator	activator	NN	124
activator	activator	NNP	3
activators	activator	NNS	68
activats	activat	NNS	1
active	active	JJ	1532
active	active	NNP	7
active-control	active-control	JJ	1
active-controlled	active-controlled	JJ	3
active-duty	active-duty	JJ	15
active-site	active-site	JJ	10
actively	actively	RB	263
actively	actively	UNC	2
actively-traded	actively-traded	JJ	1
activelytraded	activelytraded	JJ	1
activeperl	activeperl	NNP	1
actives	active	NNP	1
actives	active	NNS	3
activestate	activestate	NNP	1
activewear	activewear	NN	1
activewear	activewear	NNP	1
activex	activex	NNP	9
activie	activie	NN	1
activies	activy	NNS	1
activin	activin	NN	5
activism	activism	NN	74
activism	activism	NNP	1
activist	activist	JJ	1
activist	activist	NN	155
activist	activist	NNP	6
activists	activist	NNS	239
activists	activists	JJ	1
activites	activite	NNS	1
activities	activities	NNP	2
activities	activities	UNC	7
activities	activity	NNP	1
activities	activity	NNPS	80
activities	activity	NNS	1921
activities-taking	activities-taking	JJ	1
activities-terrorist	activities-terrorist	JJ	1
activity	activity	NN	4197
activity	activity	NNP	6
activity	activity	UNC	12
activity-based	activity-based	JJ	4
activity-based	activity-based	NNP	1
activity-center	activity-center	JJ	1
activity-dependent	activity-dependent	JJ	9
activity-dependent	activity-dependent	NNP	2
activity-independent	activity-independent	JJ	2
activity-induced	activity-induced	JJ	1
activity-labeling	activity-labeling	JJ	1
activity-plasmid	activity-plasmid	JJ	1
activity-regarded	activity-regarded	JJ	1
activitybased	activitybased	JJ	1
activization	activization	NNP	1
activty	activty	NN	1
actmutation	actmutation	NN	1
acto	acto	NN	2
actof	actof	NNP	2
actogram	actogram	NN	2
actograms	actogram	NNP	1
actograms	actogram	NNS	2
actomyosin	actomyosin	NN	11
acton	acton	NNP	19
actonel	actonel	NNP	3
actor	actor	NN	701
actor	actor	NNP	52
actor	actor	UNC	4
actor-director	actor-director	JJ	3
actor-director	actor-director	NNP	1
actor-director-writer	actor-director-writer	NNP	1
actor-essayist-blogger	actor-essayist-blogger	JJ	1
actor-lossage	actor-lossage	JJ	1
actor-politician	actor-politician	JJ	1
actorboy	actorboy	NN	1
actorcasting	actorcast	VBG	1
actors	actor	NNP	40
actors	actor	NNS	625
actors	actors	JJ	1
actors	actors	UNC	9
actors-playing-the-same-characters	actors-playing-the-same-character	JJ	1
actors-turned-directors	actors-turned-director	JJ	1
actory	actory	NN	2
actos	acto	NNS	3
actovegin	actovegin	NNP	1
actprotein	actprotein	NN	1
actr	actr	NN	1
actr	actr	NNP	5
actr-i	actr-us	NNP	1
actr-ii	actr-ius	NNP	1
actress	actress	JJ	3
actress	actress	NN	426
actress	actress	NNP	27
actress	actress	UNC	2
actress-waitress	actress-waitress	JJ	2
actresses	actress	NNP	2
actresses	actress	NNS	64
actresses	actresses	UNC	3
actresss	actresss	NNS	1
actressy	actressy	NN	1
acts	act	NNP	63
acts	act	NNS	584
acts	act	VBZ	77
acts	acts	UNC	4
actttggatcattctatgcag	actttggatcattctatgcag	NNP	1
actual	actual	JJ	1776
actual	actual	NNP	9
actual	actual	UNC	2
actual-vampire-seeing-and-slaying	actual-vampire-seeing-and-slaying	JJ	1
actuality	actuality	NN	8
actualize	actualize	NN	1
actualized	actualized	JJ	2
actually	actually	JJ	3
actually	actually	NN	2
actually	actually	NNP	10
actually	actually	RB	5817
actually	actually	UNC	23
actuallyl	actuallyl	NN	1
actuals	actual	NNS	1
actualy	actualy	NNP	1
actualy	actualy	RB	3
actuarial	actuarial	JJ	37
actuarial	actuarial	NNP	12
actuarial-based	actuarial-based	JJ	1
actuaries	actuary	NNP	3
actuaries	actuary	NNS	19
actuaristas	actuarista	NNS	2
actuary	actuary	NN	13
actuary	actuary	NNP	12
actuates	actuate	NNS	2
actuator	actuator	NN	6
actuators	actuator	NNS	1
actully	actully	RB	1
actus	actus	JJ	2
actwas	actwa	NNP	1
actwith	actwith	NN	2
actwu	actwu	UNC	1
acuesta	acuesta	NN	2
acuestén	acuestén	NN	1
acuff	acuff	NNP	1
acuity	acuity	NN	16
aculeatus	aculeatus	JJ	1
acumen	acumen	NN	29
acuolation	acuolation	NN	1
acupressure	acupressure	NN	2
acupuncture	acupuncture	NN	14
acupuncture	acupuncture	NNP	1
acupuncturist	acupuncturist	NN	1
acupuncturists	acupuncturist	NNS	2
acura	acura	NNP	8
acure	acure	NNP	1
acutally	acutally	NNP	4
acutally	acutally	RB	1
acute	acute	JJ	712
acute	acute	NNP	83
acute-care	acute-care	JJ	3
acute-phase	acute-phase	JJ	3
acutee	acutee	NN	1
acutely	acutely	NNP	2
acutely	acutely	RB	47
acuto	acuto	NNP	1
acuview	acuview	NNP	1
acuvue	acuvue	NNP	4
acuvue-vision	acuvue-vision	NNP	2
acuático	acuático	NNP	1
acuña	acuña	NNP	2
acv	acv	NNP	40
acv-resistant	acv-resistant	NNP	2
acv-susceptible	acv-susceptible	NNP	1
acvb	acvb	NNP	4
acvtivated	acvtivated	JJ	1
acyclic	acyclic	JJ	5
acyclovir	acyclovir	NN	3
acyclovir	acyclovir	NNP	2
acyl	acyl	NN	27
acyl	acyl	NNP	1
acyl-acyl	acyl-acyl	JJ	1
acyl-chain	acyl-chain	JJ	1
acyl-enzyme	acyl-enzyme	JJ	1
acylation	acylation	NN	1
acylcarnitine	acylcarnitine	NN	2
acylcarnitines	acylcarnitine	NNS	3
acylethanolamine	acylethanolamine	NN	2
acylethanolamines	acylethanolamine	NNS	1
acylglycerophospho-ethanolamine	acylglycerophospho-ethanolamine	JJ	1
acyltransferase	acyltransferase	NN	3
acyltransferases	acyltransferase	NNS	1
acyrthosiphon	acyrthosiphon	NNP	2
acá	acá	NNP	1
acánsa	acánsa	NNP	1
ad	ad	JJ	2
ad	ad	NN	1198
ad	ad	NNP	410
ad	ad	UNC	5
ad-adsx	ad-adsx	NNP	5
ad-based	ad-based	JJ	1
ad-busting	ad-busting	JJ	1
ad-column	ad-column	NNP	4
ad-daar	ad-daar	JJ	1
ad-driven	ad-driven	JJ	1
ad-e	ad-e	NNP	8
ad-exec	ad-exec	JJ	1
ad-free	ad-free	JJ	2
ad-git	ad-git	NNP	1
ad-hoc	ad-hoc	JJ	6
ad-in	ad-in	JJ	1
ad-laden	ad-laden	JJ	1
ad-lib	ad-lib	JJ	3
ad-libbed	ad-libbed	JJ	1
ad-libbing	ad-libbing	JJ	1
ad-libitum	ad-libitum	JJ	1
ad-libs	ad-lib	JJ	1
ad-m	ad-m	NNP	55
ad-maker	ad-maker	JJ	1
ad-makers	ad-maker	JJ	2
ad-nad	ad-nad	NNP	2
ad-prey	ad-prey	NNP	1
ad-revenue-sharing	ad-revenue-sharing	JJ	1
ad-sales	ad-sale	JJ	1
ad-serving	ad-serving	JJ	1
ad-skipping	ad-skipping	JJ	3
ad-snatchers	ad-snatcher	JJ	1
ad-supported	ad-supported	JJ	1
ad-tracking	ad-tracking	JJ	1
ad-transduced	ad-transduced	NNP	9
ada	ada	NNP	40
adade	adade	NNP	1
adage	adage	NN	15
adages	adage	NNS	4
adagia	adagium	NNP	2
adagio	adagio	NN	1
adair	adair	NNP	5
adaja	adaja	NNP	1
adalar	adalar	NNP	1
adam	adam	NNP	410
adamance	adamance	NN	1
adamant	adamant	JJ	48
adamantium	adamantium	NNP	1
adamantly	adamantly	RB	16
adamao	adamao	NN	1
adame	adame	NNP	1
adament	adament	NN	1
adami	adamus	NNP	4
adamo	adamo	NNP	6
adamov	adamov	NNP	2
adams	adam	NNP	323
adams	adams	NNP	2
adams	adams	UNC	2
adamson	adamson	NNP	1
adamu	adamu	NNP	1
adana	adana	NNP	1
adao	adao	NNP	2
adapator	adapator	NN	1
adaped	adaped	JJ	1
adapt	adapt	NNP	69
adapt	adapt	VB	107
adapt	adapt	VBP	9
adaptability	adaptability	NN	13
adaptable	adaptable	JJ	21
adaptable	adaptable	NNP	2
adaptamer	adaptamer	NN	6
adaptamers	adaptamer	NNS	3
adaptation	adaptation	NN	232
adaptation	adaptation	NNP	9
adaptation-and	adaptation-and	NNP	1
adaptations	adaptation	NNP	5
adaptations	adaptation	NNS	62
adaptec	adaptec	NNP	1
adapted	adapt	VBD	31
adapted	adapt	VBN	198
adapted	adapted	NNP	2
adapted	adapted	UNC	3
adapter	adapter	NN	64
adapter	adapter	NNP	1
adapter-linked	adapter-linked	JJ	2
adapter-related	adapter-related	NNP	1
adapter-specific	adapter-specific	JJ	1
adapterized	adapterized	JJ	1
adapters	adapter	NNP	1
adapters	adapter	NNS	18
adapting	adapt	VBG	48
adapting	adapting	NNP	2
adaption	adaption	NN	1
adaptive	adaptive	JJ	98
adaptive	adaptive	NNP	6
adaptiveha	adaptiveha	NN	3
adaptively	adaptively	RB	6
adaptivity	adaptivity	NN	1
adaptor	adaptor	NN	50
adaptor	adaptor	NNP	1
adaptor-amplified	adaptor-amplified	JJ	1
adaptor-ligated	adaptor-ligated	JJ	1
adaptor-specific	adaptor-specific	JJ	1
adaptors	adaptor	NNS	24
adapts	adapt	NNS	11
adar	adar	NNP	4
adas	ada	NNP	1
adas-cog	adas-cog	NNP	31
adas?	adas?	NN	8
adas?	adas?	NNP	1
adata	ada	NN	2
aday	aday	NNP	1
adb	adb	NNP	2
adblock	adblock	NN	1
adbul	adbul	NNP	1
adbusters	adbuster	NNP	1
adc	adc	NNP	4
adcaps	adcap	NNP	4
adcc	adcc	NNP	2
adcell	adcell	NNP	1
adco	adco	NNP	1
adcock	adcock	NNP	4
add	add	NN	2
add	add	NNP	18
add	add	UNC	4
add	add	VB	1311
add	add	VBP	196
add-a-bead	add-a-bead	JJ	1
add-in	add-in	JJ	1
add-on	add-on	JJ	22
add-ons	add-on	JJ	4
addaia	addaium	NNP	1
addams	addam	NNP	22
addario	addario	NNP	2
adddecorations	adddecoration	NNP	1
added	add	VBD	1626
added	add	VBN	1405
added	added	JJ	37
added	added	NNP	4
added	added	UNC	3
added-soul	added-soul	JJ	1
addeled	addeled	JJ	1
addend	addend	NNP	2
addenda	addendum	NN	11
addenda	addendum	NNP	10
addends	addend	NNS	2
addendum	addendum	NN	14
addendum	addendum	NNP	5
addendums	addendum	NNS	1
adder	adder	NNP	6
adderal	adderal	NNP	1
adderall	adderall	NNP	1
adderley	adderley	NNP	1
addhighlights	addhighlight	NNP	1
addicated	addicated	JJ	1
addicition	addicition	NN	1
addict	addict	NN	57
addict	addict	NNP	9
addict	addict	UNC	1
addicted	addict	VBN	100
addicted	addicted	JJ	1
addicted	addicted	NNP	14
addicting	addict	VBG	5
addiction	addiction	NN	179
addiction	addiction	NNP	24
addiction	addiction	UNC	1
addiction-related	addiction-related	JJ	1
addictions	addiction	NNP	1
addictions	addiction	NNS	24
addictions	addictions	UNC	2
addictive	addictive	JJ	76
addictive	addictive	NNP	2
addictive	addictive	UNC	1
addictiveness	addictiveness	NNS	2
addicts	addict	NNP	3
addicts	addict	NNS	60
addicts	addicts	UNC	2
addie	addie	NN	1
addie	addie	NNP	2
addies	addy	NNS	1
adding	add	VBG	902
adding	adding	NN	1
adding	adding	NNP	1
adding	adding	UNC	3
addington	addington	NNP	1
addison	addison	NNP	19
addition	addition	NN	3658
addition	addition	NNP	44
additional	additional	JJ	4254
additional	additional	NNP	15
additionally	additionally	RB	394
additionaly	additionaly	RB	2
additionnal	additionnal	NN	1
additions	addition	NNP	4
additions	addition	NNS	86
additive	additive	JJ	124
additive	additive	NNP	2
additive-plus-multiplicative	additive-plus-multiplicative	JJ	1
additively	additively	RB	7
additives	additive	NNP	9
additives	additive	NNS	24
additivity	additivity	NN	6
additized	additized	JJ	1
additon	additon	NN	1
additonal	additonal	NN	12
addization	addization	NN	1
addizione	addizione	NNP	1
addi­tional	addi­tional	NNP	1
addle	addle	NN	1
addle-brained	addle-brained	JJ	1
addled	addled	JJ	23
addlepated	addlepated	JJ	4
addlistener	addlistener	NN	1
addo	addo	NNP	22
addopark	addopark	NN	1
address	address	JJ	1
address	address	NN	1012
address	address	NNP	367
address	address	UNC	6
address	address	VB	1075
address	address	VBP	109
address-book	address-book	JJ	1
address-change	address-change	JJ	1
addressable	addressable	JJ	2
addressc	addressc	NNP	1
addressed	address	VBD	146
addressed	address	VBN	454
addressed	addressed	NNP	12
addressed	addressed	UNC	5
addressee	addressee	NN	2
addressee	addressee	NNP	1
addressees	addressee	NNS	2
addresses	address	NNP	13
addresses	address	NNS	232
addresses	address	VBZ	119
addresses-one	addresses-one	JJ	1
addressin	addressin	NN	6
addressinformation	addressinformation	NN	1
addressing	address	VBG	325
addressing	addressing	NNP	1
addressing	addressing	UNC	2
addressins	addressin	NNS	2
addresss	addresss	NNS	1
addrln	addrln	NNP	1
adds	add	NNP	7
adds	add	VBZ	603
adds	adds	UNC	2
addsol	addsol	NNP	1
addtodesignreview	addtodesignreview	NNP	1
adduce	adduce	NN	1
adduced	adduced	JJ	10
adduces	adduce	NNS	4
adducing	adduce	VBG	4
adducins	adducin	NNS	1
adduct	adduct	NN	10
adducted	adducted	JJ	1
adducting	adduct	VBG	1
adductor	adductor	NN	1
adducts	adduct	NNS	23
adduxerunt	adduxerunt	NN	1
addy	addy	NN	54
addy	addy	NNP	2
ade	ade	NN	27
ade	ade	NNP	22
adeasy	adeasy	NNP	2
adecco	adecco	NNP	2
adecrease	adecrease	NN	1
adega	adega	NNP	2
adegas	adega	NNP	2
adeje	adeje	NNP	2
adel	adel	NNP	1
adelaide	adelaide	NNP	11
adelantado	adelantado	NNP	1
adele	adele	NNP	17
adeliae	adelia	NN	1
adelie	adelie	NNP	1
adelina	adelina	NNP	2
adelita	adelita	NNP	18
adelitas	adelita	NNP	3
adelman	adelman	NNP	3
adelphia	adelphium	NNP	69
adelson	adelson	NNP	1
adelstein	adelstein	NNP	2
adema	adema	NNP	2
ademonstrates	ademonstrate	NNS	3
aden	aden	NNP	16
adena	adena	NNP	12
adenauer	adenauer	NNP	1
adenine	adenine	NN	30
adenine	adenine	NNP	2
adenine-labeled	adenine-labeled	JJ	1
adenine-like	adenine-like	JJ	1
adenine-requiring	adenine-requiring	JJ	2
adenines	adenine	NNS	7
adeno	adeno	NN	17
adeno	adeno	NNP	2
adeno-associated	adeno-associated	JJ	1
adeno-?	adeno-?	JJ	2
adeno-?gal	adeno-?gal	JJ	3
adeno-?gal	adeno-?gal	NNP	2
adenocarcinoma	adenocarcinoma	NN	45
adenocarcinomas	adenocarcinoma	NNS	26
adenoidal	adenoidal	NN	2
adenoids	adenoids	NNS	1
adenoma	adenoma	NN	29
adenomas	adenoma	NNP	1
adenomas	adenoma	NNS	16
adenomatous	adenomatous	JJ	7
adenomatous	adenomatous	NNP	1
adenosine	adenosine	NN	51
adenosine	adenosine	NNP	1
adenosine-binding	adenosine-binding	JJ	1
adenosines	adenosine	NNS	12
adenosinetriphosphatase	adenosinetriphosphatase	NN	1
adenosis	adenosis	NNS	1
adenosylhomocysteine	adenosylhomocysteine	NN	2
adenosylmethionine	adenosylmethionine	NN	3
adenoviral	adenoviral	NN	167
adenoviral	adenoviral	NNP	15
adenoviral-mediated	adenoviral-mediated	JJ	5
adenoviral-mediated	adenoviral-mediated	NNP	1
adenoviral-resistant	adenoviral-resistant	JJ	1
adenovirally	adenovirally	RB	2
adenovirus	adenovirus	JJ	82
adenovirus	adenovirus	NN	1
adenovirus	adenovirus	NNP	5
adenovirus-based	adenovirus-based	JJ	1
adenovirus-infected	adenovirus-infected	JJ	1
adenovirus-mediated	adenovirus-mediated	JJ	11
adenovirus-microbead	adenovirus-microbead	JJ	4
adenoviruses	adenovirus	NNP	2
adenoviruses	adenovirus	NNS	11
adenylate	adenylate	NN	16
adenylate-uridylate-rich	adenylate-uridylate-rich	NNP	1
adenylated	adenylated	JJ	2
adenylates	adenylate	NNS	2
adenylation	adenylation	NN	5
adenyly	adenyly	RB	1
adenylyl	adenylyl	NN	35
adenylyl	adenylyl	NNP	1
adenylylated	adenylylated	JJ	4
adeo	adeo	NN	1
adepicts	adepict	NNP	3
adepicts	adepict	NNS	4
adept	adept	JJ	62
adept	adept	NNP	8
adeptly	adeptly	RB	3
adeptness	adeptness	NNS	1
adepts	adept	NNS	1
adequacy	adequacy	NN	42
adequacy	adequacy	NNP	3
adequate	adequate	JJ	454
adequate	adequate	NNP	13
adequate-to-great	adequate-to-great	JJ	1
adequately	adequately	NNP	2
adequately	adequately	RB	210
adescription	adescription	NN	1
adeshem	adeshem	NN	1
adesktop	adesktop	NN	1
adeus	adeus	NNP	2
adf	adf	NNP	2
adflugasdemo	adflugasdemo	NN	1
adge	adge	NNP	63
adgemicroarray	adgemicroarray	NNP	1
adger	adger	NNP	2
adh	adh	NN	1
adh	adh	NNP	31
adh-f	adh-f	NNP	1
adh-r	adh-r	NNP	1
adha	adha	NNP	1
adhd	adhd	NNP	114
adhd-obesity	adhd-obesity	NNP	1
adherants	adherant	NNS	1
adhere	adhere	VB	90
adhered	adhere	VBD	29
adherence	adherence	NN	122
adherence	adherence	NNP	4
adherens	adheren	NNS	2
adherent	adherent	NN	105
adherent	adherent	NNP	11
adherents	adherent	NNP	1
adherents	adherent	NNS	32
adheres	adhere	NNS	12
adherin	adherin	NN	1
adhering	adhere	VBG	27
adhering	adhering	NNP	1
adhesin	adhesin	NN	3
adhesins	adhesin	NNS	2
adhesion	adhesion	NN	272
adhesion	adhesion	NNP	15
adhesion-related	adhesion-related	JJ	1
adhesions	adhesion	NNS	7
adhesive	adhesive	NN	64
adhesiveness	adhesiveness	NNS	2
adhesives	adhesive	NNS	2
adhoc	adhoc	NN	4
adhoccery	adhoccery	NN	2
adhocist	adhocist	NN	1
adhr	adhr	NNP	1
adhregion	adhregion	NNP	1
adhuc	adhuc	NN	1
adhumbla	adhumblum	NNP	2
adi	adus	NNP	68
adiabatic	adiabatic	JJ	2
adiabne	adiabne	NNP	1
adidas	adida	NNP	15
adieu	adieu	NN	13
adieu	adieu	NNP	6
adieus	adieus	JJ	1
adieux	adieu	NN	1
adifferent	adifferent	NN	1
adifferent	adifferent	NNP	1
adige	adige	NNP	6
adiii	adiius	NNP	2
adil	adil	NNP	5
adin	adin	NNP	3
adina	adina	NNP	3
adinath	adinath	NNP	3
adinspection	adinspection	NNP	1
adioh	adioh	NN	1
adios	adio	NNP	4
adios	adio	NNS	4
adipic	adipic	JJ	1
adipocyte	adipocyte	NN	11
adipocyte-derived	adipocyte-derived	JJ	1
adipocytes	adipocyte	NNS	26
adipocytic	adipocytic	JJ	2
adipocytic	adipocytic	NNP	2
adipogenesis	adipogenesis	NNS	2
adipogenic	adipogenic	JJ	2
adiponectin	adiponectin	NN	10
adiponectin	adiponectin	NNP	2
adipose	adipose	NN	25
adiposity	adiposity	NN	19
adirondack	adirondack	NN	2
adirondack	adirondack	NNP	14
adirondacks	adirondack	NNP	11
adirondacks	adirondack	NNS	2
adis	adi	NNP	9
adisease-detection	adisease-detection	JJ	1
aditional	aditional	NN	3
adivinanzas	adivinanza	NNP	3
adiyaman	adiyaman	NNP	1
adiós	adiós	NNS	1
adj	adj	NN	47
adj	adj	NNP	6
adjacencies	adjacency	NNS	2
adjacency	adjacency	NN	1
adjacent	adjacent	JJ	609
adjacent	adjacent	NNP	39
adjacenting	adjacent	VBG	1
adjacently	adjacently	RB	1
adjangba	adjangba	NNP	1
adjani	adjanus	NNP	2
adjectival	adjectival	NN	12
adjectivally	adjectivally	RB	4
adjective	adjective	NN	122
adjective	adjective	NNP	5
adjective-abuser	adjective-abuser	JJ	1
adjective-names	adjective-name	JJ	1
adjectives	adjective	NNP	9
adjectives	adjective	NNS	84
adjectivewise	adjectivewise	NN	1
adjectivising	adjectivise	VBG	2
adjoin	adjoin	NN	1
adjoined	adjoined	JJ	2
adjoining	adjoining	JJ	91
adjoining	adjoining	NNP	10
adjoins	adjoin	NNS	12
adjourn	adjourn	NN	12
adjourned	adjourn	VBN	9
adjourning	adjourn	VBG	3
adjournment	adjournment	NN	5
adjourns	adjourn	NNP	1
adjourns	adjourn	NNS	6
adjrun	adjrun	NN	1
adjudged	adjudged	JJ	3
adjudges	adjudge	NNS	1
adjudicate	adjudicate	NN	13
adjudicate	adjudicate	NNP	1
adjudicated	adjudicated	JJ	30
adjudicates	adjudicate	NNS	3
adjudicating	adjudicate	VBG	2
adjudication	adjudication	NN	29
adjudication	adjudication	NNP	2
adjudicative	adjudicative	JJ	4
adjudicator	adjudicator	NN	3
adjudicatory	adjudicatory	NN	3
adjudicatory	adjudicatory	NNP	1
adjunct	adjunct	NN	36
adjunct	adjunct	NNP	2
adjunctive	adjunctive	JJ	1
adjuncts	adjunct	NNP	1
adjuncts	adjunct	NNS	3
adjured	adjured	JJ	1
adjurn	adjurn	NN	1
adjust	adjust	VB	212
adjust	adjust	VBP	35
adjustable	adjustable	JJ	55
adjustable	adjustable	NNP	2
adjusted	adjust	VBD	70
adjusted	adjust	VBN	503
adjusted	adjusted	JJ	2
adjusted	adjusted	NNP	16
adjusted	adjusted	UNC	1
adjusted-rates	adjusted-rate	JJ	1
adjuster	adjuster	NN	7
adjuster	adjuster	NNP	1
adjusters	adjuster	NNS	3
adjusting	adjust	VBG	145
adjusting	adjusting	NN	7
adjusting	adjusting	NNP	11
adjustment	adjustment	NN	296
adjustment	adjustment	NNP	24
adjustments	adjustment	NNP	13
adjustments	adjustment	NNS	166
adjustn	adjustn	NN	2
adjusts	adjust	NNP	1
adjusts	adjust	VBZ	37
adjustvar	adjustvar	NN	2
adjutant	adjutant	NN	3
adjuvant	adjuvant	NN	66
adjuvant	adjuvant	NNP	4
adjuvant-induced	adjuvant-induced	JJ	2
adjuvants	adjuvant	NNS	5
adkins	adkin	NNP	34
adl	adl	NNP	6
adlai	adlaus	NNP	14
adler	adler	NNP	43
adlestrop	adlestrop	NNP	11
adlestrop	adlestrop	UNC	1
adleta	adleta	NNP	1
adlon	adlon	NNP	1
adlum	adlum	NNP	2
adm	adm	NNP	28
admaker	admaker	NN	1
admakers	admaker	NNS	1
adman	adman	NN	7
adman	adman	NNP	1
adme	adme	NNP	4
admen	adman	NNP	1
admen	adman	NNS	1
admin	admin	NN	21
admin	admin	NNP	6
administer	administer	NNP	1
administer	administer	VB	81
administered	administer	VBN	325
administered	administered	NNP	5
administering	administer	VBG	65
administering	administering	NNP	3
administers	administer	VBZ	37
administrated	administrated	JJ	2
administration	administration	JJ	1
administration	administration	NN	2623
administration	administration	NNP	703
administration	administration	UNC	7
administration-sponsored	administration-sponsored	NNP	1
administrationn	administrationn	NNP	1
administrations	administration	NNP	4
administrations	administration	NNS	78
administrative	administrative	JJ	347
administrative	administrative	NNP	117
administratively	administratively	RB	12
administrator	administrator	NN	126
administrator	administrator	NNP	479
administrator	administrator	UNC	1
administratorand	administratorand	NNP	1
administrators	administrator	NNPS	15
administrators	administrator	NNS	150
administrators	administrators	UNC	1
administratorshall	administratorshall	NNP	4
administrivia	administrivium	NN	2
administrtation	administrtation	NN	1
admins	admin	NNS	5
adminster	adminster	NN	1
adminstration	adminstration	NN	1
adminstration	adminstration	NNP	1
adminstrator	adminstrator	NN	1
adminwise	adminwise	NN	1
adminy	adminy	NN	1
admirable	admirable	JJ	107
admirable	admirable	NNP	4
admirable	admirable	UNC	2
admirably	admirably	NNP	2
admirably	admirably	RB	42
admiral	admiral	NN	33
admiral	admiral	NNP	34
admirals	admiral	NNP	2
admirals	admiral	NNS	5
admiralty	admiralty	NN	1
admiralty	admiralty	NNP	4
admirans	admiran	NNS	1
admirari	admirarus	NN	1
admiration	admiration	NN	106
admire	admire	NN	195
admire	admire	NNP	2
admire	admire	UNC	1
admired	admire	VBD	45
admired	admire	VBN	107
admired	admired	NNP	1
admired	admired	UNC	2
admirer	admirer	NN	18
admirers	admirer	NNS	55
admires	admire	VBZ	20
admiring	admire	VBG	63
admiring	admiring	NNP	2
admiringly	admiringly	RB	10
admir­able	admir­able	JJ	1
admissibility	admissibility	NN	8
admissibility	admissibility	NNP	5
admissible	admissible	JJ	12
admission	admission	NN	493
admission	admission	NNP	36
admission	admission	UNC	2
admissions	admission	NNP	21
admissions	admission	NNS	290
admissions	admissions	NN	1
admissions	admissions	UNC	3
admissionsall	admissionsall	NNP	1
admisssions	admisssion	NNS	1
admist	admist	NNP	1
admit	admit	JJ	2
admit	admit	NNP	12
admit	admit	UNC	1
admit	admit	VB	492
admit	admit	VBP	195
admitedly	admitedly	RB	1
admitprecisely	admitprecisely	RB	1
admits	admit	NNP	8
admits	admit	NNS	3
admits	admit	VBZ	247
admits	admits	UNC	3
admittance	admittance	NN	5
admittance	admittance	NNP	1
admitted	admit	VBD	229
admitted	admit	VBN	382
admitted	admitted	NNP	2
admitted	admitted	UNC	3
admittedly	admittedly	RB	165
admittedly	admittedly	UNC	2
admittedpostoperatively	admittedpostoperatively	RB	1
admittedto	admittedto	NN	1
admittees	admittee	NNS	1
admitting	admit	VBG	134
admitting	admitting	NNP	8
admixed	admixed	JJ	1
admixture	admixture	NN	11
admixture	admixture	NNP	1
admixtures	admixture	NNS	2
admnistration	admnistration	NN	1
admonish	admonish	NN	6
admonished	admonished	JJ	22
admonishes	admonish	NNP	1
admonishes	admonish	NNS	7
admonishing	admonish	VBG	4
admonishment	admonishment	NN	2
admonition	admonition	JJ	1
admonition	admonition	NN	21
admonitione	admonitione	NN	1
admonitions	admonition	NNS	7
admonitor	admonitor	NN	1
admonitory	admonitory	NN	4
adn	adn	NN	10
adn	adn	NNP	1
adna	adna	NN	21
adnan	adnan	NNP	9
adnd	adnd	NNP	2
ado	ado	NN	8
ado	ado	NNP	6
adobe	adobe	NN	33
adobe	adobe	NNP	67
adobepdf	adobepdf	NN	1
adoberas	adobera	NNS	1
adobo	adobo	NN	1
adoke	adoke	NNP	1
adol	adol	NNP	5
adolesc	adolesc	NNP	3
adolescence	adolescence	NN	73
adolescence	adolescence	NNP	3
adolescence	adolescence	UNC	2
adolescencia	adolescencium	NNP	1
adolescent	adolescent	JJ	119
adolescent	adolescent	NN	18
adolescent	adolescent	NNP	2
adolescent	adolescent	UNC	1
adolescent-adventure	adolescent-adventure	JJ	1
adolescent-angsty	adolescent-angsty	JJ	1
adolescent-use	adolescent-use	JJ	1
adolescents	adolescent	NNP	10
adolescents	adolescent	NNS	99
adolescents-at-heart	adolescents-at-heart	JJ	1
adolesence	adolesence	NN	1
adolf	adolf	NNP	49
adolfo	adolfo	NNP	4
adolph	adolph	NNP	11
adolphe	adolphe	NNP	3
adolsecent	adolsecent	NN	1
adomet	adomet	NNP	5
adonais	adonai	NNP	1
adonay	adonay	NN	1
adone	adone	NN	1
adone	adone	NNP	1
adonis	adoni	NNP	5
adonitol	adonitol	NN	1
adopt	adopt	NNP	6
adopt	adopt	VB	247
adopt	adopt	VBP	39
adopt-a	adopt-a	NNP	1
adoptable	adoptable	NNP	1
adopted	adopt	VBD	199
adopted	adopt	VBN	478
adopted	adopted	NNP	4
adopted	adopted	UNC	2
adopted-to	adopted-to	JJ	1
adoptee	adoptee	NN	1
adoptees	adoptee	NNS	3
adopter	adopter	NN	3
adopters	adopter	NNS	8
adopting	adopt	VBG	131
adoption	adoption	NN	176
adoption	adoption	NNP	10
adoption-related	adoption-related	JJ	2
adoptions	adoption	NNS	11
adoptive	adoptive	JJ	45
adoptive	adoptive	NNP	6
adoptively	adoptively	RB	7
adoptively-transferred	adoptively-transferred	JJ	1
adopts	adopt	NNP	2
adopts	adopt	VBZ	47
adopts	adopts	UNC	1
adoquín	adoquín	NNP	1
adora	adora	NNP	2
adorability	adorability	NN	3
adorable	adorable	JJ	150
adorable	adorable	NNP	12
adorable	adorable	UNC	1
adorableness	adorableness	NNP	1
adorableness	adorableness	NNS	5
adorably	adorably	NNP	1
adorably	adorably	RB	2
adorably	adorably	UNC	1
adoran	adoran	NN	1
adoration	adoration	NN	18
adoration	adoration	NNP	10
adorations	adoration	NNS	1
adorble	adorble	JJ	1
adore	adore	NN	127
adore	adore	NNP	8
adored	adored	JJ	57
adored	adored	NNP	6
adores	adore	NNS	21
adoring	adore	VBG	30
adoring	adoring	NNP	2
adoringly	adoringly	RB	2
adorn	adorn	VB	38
adorned	adorn	VBD	22
adorned	adorn	VBN	12
adorned	adorned	NNP	3
adorning	adorn	VBG	7
adornment	adornment	NN	3
adornment	adornment	NNP	1
adornments	adornment	NNS	6
adorno	adorno	NNP	7
adorns	adorn	NNS	13
adowe	adowe	NNP	1
adp	adp	NNP	49
adp-glucose	adp-glucose	NNP	1
adp-ribose	adp-ribose	NNP	1
adp-ribosylates	adp-ribosylate	NNP	1
adp-ribosylation	adp-ribosylation	NNP	14
adpase	adpase	NNP	4
adpated	adpated	JJ	1
adpativeh	adpativeh	NN	4
adpnp	adpnp	NNP	9
adprt	adprt	NNP	3
adr	adr	NN	1
adr	adr	NNP	71
adr-res	adr-re	NNP	2
adr-sensitive	adr-sensitive	NNP	1
adra	adra	NNP	2
adrelevance	adrelevance	NNP	3
adrenal	adrenal	NN	50
adrenal	adrenal	NNP	2
adrenalectomized	adrenalectomized	JJ	25
adrenalectomized	adrenalectomized	NN	1
adrenalectomized-streptozotocin-injected-ad	adrenalectomized-streptozotocin-injected-ad	JJ	1
adrenalectomized-streptozotocin-injected-fasted	adrenalectomized-streptozotocin-injected-fasted	JJ	1
adrenalectomy	adrenalectomy	NN	87
adrenalectomy	adrenalectomy	NNP	13
adrenalin	adrenalin	NN	11
adrenaline	adrenaline	NN	26
adrenaline	adrenaline	NNP	1
adrenaline-happy	adrenaline-happy	JJ	1
adrenaline-induced	adrenaline-induced	JJ	1
adrenaline-pumping	adrenaline-pumping	JJ	1
adrenaline-rush	adrenaline-rush	JJ	1
adrenaline-soaked	adrenaline-soaked	JJ	1
adrenaline-swamped	adrenaline-swamped	JJ	1
adrenals	adrenal	NNS	1
adrenergic	adrenergic	JJ	57
adrenergic-receptor	adrenergic-receptor	JJ	1
adrenergic-renin-angiotensin	adrenergic-renin-angiotensin	JJ	1
adrenergicand	adrenergicand	NN	1
adrenoceptor	adrenoceptor	NN	2
adrenocortical	adrenocortical	JJ	3
adrenocorticotrophic	adrenocorticotrophic	JJ	1
adrenocorticotrophin	adrenocorticotrophin	NN	2
adrenocorticotropic	adrenocorticotropic	JJ	2
adrenoreceptor	adrenoreceptor	NN	1
adressing	adress	VBG	2
adriaen	adriaen	NNP	3
adriaensz	adriaensz	NNP	1
adriamycin	adriamycin	NN	2
adriamycin	adriamycin	NNP	3
adrian	adrian	NNP	61
adriana	adriana	NNP	6
adriane	adriane	NNP	1
adrianne	adrianne	NNP	3
adriano	adriano	NNP	1
adrianople	adrianople	NNP	2
adrianou	adrianou	NNP	6
adrian­ople	adrian­ople	NNP	1
adriatic	adriatic	NNP	20
adrien	adrien	NNP	13
adrienne	adrienne	NNP	8
adrift	adrift	NN	26
adrift	adrift	NNP	1
adroit	adroit	JJ	7
adroitly	adroitly	RB	14
ads	ad	NN	3
ads	ad	NNP	8
ads	ad	NNPS	10
ads	ad	NNS	770
ads	ads	JJ	2
ads	ads	UNC	7
ads-no	ads-no	JJ	1
adscendit	adscendit	NN	2
adsiduos	adsiduo	NNS	1
adsl	adsl	NNP	4
adsorb	adsorb	NN	2
adsorbed	adsorbed	JJ	15
adsorbent	adsorbent	NN	1
adsorption	adsorption	NN	27
adsp	adsp	NN	1
adsubtract	adsubtract	NNP	2
adsurdity	adsurdity	NN	1
adsx	adsx	NNP	20
adsx-nad	adsx-nad	NNP	1
aduana	aduana	NNP	3
adubato	adubato	NNP	3
adulation	adulation	NN	13
adulation	adulation	NNP	1
adulatory	adulatory	NN	8
adult	adult	JJ	14
adult	adult	NN	1226
adult	adult	NNP	105
adult	adult	UNC	2
adult-acting	adult-acting	JJ	1
adult-book	adult-book	JJ	1
adult-care	adult-care	NNP	1
adult-child	adult-child	JJ	3
adult-development	adult-development	JJ	1
adult-directed	adult-directed	JJ	1
adult-emergence	adult-emergence	JJ	1
adult-film	adult-film	JJ	1
adult-flavored	adult-flavored	JJ	1
adult-free	adult-free	JJ	1
adult-imposed	adult-imposed	JJ	1
adult-incest	adult-incest	JJ	1
adult-like	adult-like	JJ	1
adult-onset	adult-onset	JJ	3
adult-organized	adult-organized	JJ	1
adult-oriented	adult-oriented	JJ	5
adult-quality	adult-quality	JJ	1
adult-relationship	adult-relationship	JJ	1
adult-specific	adult-specific	JJ	1
adult-structured	adult-structured	JJ	1
adult-supervised	adult-supervised	JJ	1
adult-supremacy	adult-supremacy	JJ	1
adult-themed	adult-themed	JJ	1
adulterant	adulterant	NN	1
adulterated	adulterated	JJ	1
adulterating	adulterate	VBG	2
adulteration	adulteration	NN	1
adulterator	adulterator	NN	1
adulterer	adulterer	NN	13
adulterer	adulterer	UNC	1
adulterers	adulterer	NNP	1
adulterers	adulterer	NNS	8
adulteress	adulteress	NNS	2
adulterous	adulterous	JJ	34
adultery	adultery	NN	127
adultery	adultery	NNP	33
adultery	adultery	UNC	5
adulthood	adulthood	NN	114
adulthood	adulthood	NNP	1
adulthood	adulthood	UNC	2
adultiness	adultiness	NNS	1
adultless	adultless	JJ	1
adults	adult	NNP	3
adults	adult	NNS	951
adults	adults	UNC	6
adults-only	adults-only	JJ	5
adulty	adulty	NN	2
adult–	adult–	NN	1
adult–	adult–	NNP	3
adult–child	adult–child	NN	29
adult–child	adult–child	NNP	1
adulyadeh	adulyadeh	NNP	1
adumbrated	adumbrated	JJ	4
adumbrations	adumbration	NNS	3
adumim	adumim	NNP	1
aduncity	aduncity	NN	1
adup	adup	NNP	4
adur	adur	NNP	1
adurt	adurt	NNP	1
adustion	adustion	NN	1
aduuka	aduuka	NN	1
adv	adv	NNP	103
adv-t	adv-t	NNP	1
advance	advance	NN	583
advance	advance	NNP	51
advance	advance	UNC	5
advance	advance	VB	146
advance	advance	VBP	15
advance-purchase	advance-purchase	JJ	3
advance-royalty	advance-royalty	JJ	1
advanced	advance	VBD	273
advanced	advance	VBN	217
advanced	advanced	JJ	73
advanced	advanced	NNP	110
advanced-country	advanced-country	JJ	1
advanced-placement	advanced-placement	JJ	1
advanced-stage	advanced-stage	JJ	1
advancement	advancement	NN	48
advancement	advancement	NNP	23
advancements	advancement	NNS	20
advancepcs	advancepc	NNP	1
advances	advance	NNP	5
advances	advance	NNS	285
advances	advances	JJ	1
advances	advances	UNC	1
advancing	advance	VBG	112
advancing	advancing	NNP	1
advanta	advanta	NNP	1
advantage	advantage	NN	1147
advantage	advantage	NNP	32
advantage	advantage	UNC	4
advantage	advantage	VB	2
advantage-we	advantage-we	JJ	1
advantaged	advantaged	JJ	8
advantageous	advantageous	JJ	62
advantageously	advantageously	RB	4
advantages	advantage	NNP	21
advantages	advantage	NNS	323
advantages	advantages	UNC	4
advective	advective	JJ	1
advenissent	advenissent	NN	1
advent	advent	NN	143
advent	advent	NNP	8
adventis	adventi	NNP	1
adventist	adventist	NNP	4
adventists	adventist	NNP	1
adventitia	adventitium	NN	11
adventitial	adventitial	NN	1
adventitious	adventitious	JJ	1
advents	advent	NNP	1
adventure	adventure	NN	221
adventure	adventure	NNP	39
adventure	adventure	UNC	2
adventure-drama	adventure-drama	JJ	1
adventure-tourism	adventure-tourism	JJ	1
adventureland	adventureland	NNP	3
adventurer	adventurer	NN	15
adventurer	adventurer	NNP	1
adventurers	adventurer	NNP	3
adventurers	adventurer	NNS	18
adventures	adventure	NNP	54
adventures	adventure	NNS	120
adventuresome	adventuresome	NN	3
adventuring	adventure	VBG	3
adventurism	adventurism	NN	6
adventurous	adventurous	JJ	73
adventurous	adventurous	NNP	2
adventurously	adventurously	RB	1
adverb	adverb	NN	29
adverb	adverb	NNP	2
adverb-adjective	adverb-adjective	JJ	1
adverbial	adverbial	NN	3
adverbial	adverbial	NNP	2
adverbially	adverbially	RB	1
adverbs	adverb	NNS	27
adversarial	adversarial	JJ	20
adversaries	adversary	NNS	42
adversary	adversary	NN	33
adversary	adversary	NNP	1
adversary	adversary	UNC	1
adverse	adverse	JJ	429
adversely	adversely	RB	55
adversities	adversity	NNS	1
adversity	adversity	NN	37
adversity	adversity	NNP	3
adversitycakes	adversitycake	NNS	1
advert	advert	NN	1
adverting	advert	VBG	1
advertise	advertise	VB	61
advertise	advertise	VBP	23
advertised	advertise	VBD	23
advertised	advertise	VBN	84
advertised	advertised	NNP	1
advertised	advertised	UNC	1
advertisement	advertisement	JJ	1
advertisement	advertisement	NN	109
advertisement-free	advertisement-free	JJ	1
advertisementb	advertisementb	NN	1
advertisements	advertisement	NNP	4
advertisements	advertisement	NNS	105
advertisements	advertisements	UNC	1
advertiser	advertiser	NN	18
advertiser	advertiser	NNP	2
advertisers	advertiser	NNPS	1
advertisers	advertiser	NNS	168
advertisers	advertisers	UNC	3
advertises	advertise	VBZ	15
advertising	advertise	VBG	58
advertising	advertising	NN	773
advertising	advertising	NNP	62
advertising	advertising	UNC	7
advertising-based	advertising-based	JJ	1
advertising-copywriter-cum-pope	advertising-copywriter-cum-pope	JJ	1
advertising-driven	advertising-driven	JJ	1
advertising-supported	advertising-supported	JJ	2
advertisser	advertisser	NNP	1
advertizing	advertize	VBG	1
advertorial	advertorial	JJ	5
advertorials	advertorial	NNS	4
advertrise	advertrise	NN	1
adverts	advert	NNP	1
advice	advice	NN	1002
advice	advice	NNP	45
advice	advice	UNC	7
advice-giving	advice-giving	JJ	1
advice-hounds	advice-hound	JJ	1
advice-seeker	advice-seeker	JJ	1
advices	advice	NNP	2
advil	advil	NN	2
advil	advil	NNP	5
advino	advino	NNP	1
adviosed	adviosed	JJ	1
advisability	advisability	NN	4
advisable	advisable	JJ	53
advise	advise	NNP	1
advise	advise	UNC	1
advise	advise	VB	133
advise	advise	VBP	28
advised	advise	VBD	159
advised	advise	VBN	144
advised	advised	NNP	1
advisedly	advisedly	RB	2
advisement	advisement	NN	1
adviser	adviser	NN	258
adviser	adviser	NNP	38
adviser	adviser	UNC	1
advisers	adviser	NNP	5
advisers	adviser	NNPS	22
advisers	adviser	NNS	240
advisers	advisers	UNC	1
advises	advise	VBZ	106
advising	advise	VBG	82
advising	advising	NN	2
advisor	advisor	NN	74
advisor	advisor	NNP	36
advisories	advisory	NNP	1
advisories	advisory	NNS	30
advisors	advisor	NNP	25
advisors	advisor	NNS	105
advisors	advisors	UNC	1
advisory	advisory	JJ	149
advisory	advisory	NN	7
advisory	advisory	NNP	110
advocacy	advocacy	NN	197
advocacy	advocacy	NNP	46
advocate	advocate	NN	173
advocate	advocate	NNP	35
advocate	advocate	UNC	1
advocate	advocate	VB	43
advocate	advocate	VBP	33
advocate-expressed	advocate-expressed	NNP	1
advocated	advocate	VBD	45
advocated	advocate	VBN	48
advocates	advocate	NNP	1
advocates	advocate	NNS	410
advocates	advocate	VBZ	28
advocates	advocates	UNC	2
advocating	advocate	VBG	80
advocating	advocating	NNP	3
advoctaes	advoctae	NNS	1
advokaat	advokaat	NNP	2
advt	advt	NNP	1
adwan	adwan	NNP	26
adwatch	adwatch	NNP	1
adweek	adweek	NNP	2
adx-stz	adx-stz	NNP	3
adx-stz-fast	adx-stz-fast	NNP	4
adygea	adygea	NNP	1
adze	adze	NN	1
adzuki	adzukus	NN	1
ad­­vanced	ad­­vanced	JJ	1
adán	adán	NNP	1
adèle	adèle	NNP	1
adélie	adélie	NNP	3
adélies	adélies	NNP	4
ad?	ad?	NN	1
ad?rvan	ad?rvan	NN	1
ae	ae	NN	8
ae	ae	NNP	81
ae	ae	UNC	1
aea	aea	NNP	4
aeaea	aeaea	NNP	1
aebersole	aebersole	NNP	1
aebi	aebus	NNP	1
aebsf	aebsf	NNP	1
aec	aec	NNP	15
aecer	aecer	NN	1
aecom	aecom	NN	5
aecom	aecom	NNP	1
aect	aect	NN	7
aected	aected	JJ	5
aecting	aect	VBG	5
aection	aection	NN	4
aection	aection	UNC	1
aectionate	aectionate	NN	2
aects	aect	NNS	6
aedes	aede	NNP	3
aedicule	aedicule	NN	1
aeegintrs	aeegintr	NNP	1
aeesome	aeesome	NNP	1
aeg	aeg	NNP	6
aegean	aegean	NNP	109
aegina	aegina	NNP	4
aegis	aegis	NN	6
aegis	aegis	NNP	1
aegon	aegon	NNP	1
aegypti	aegyptus	NN	1
aehy	aehy	NNP	1
aei	aeus	NNP	7
aek	aek	NNP	1
ael	ael	NN	1
aelfric	aelfric	NNP	4
aelfwine	aelfwine	NNP	3
aelia	aelium	NNP	3
aeneid	aeneid	NNP	4
aeneus	aeneus	JJ	1
aenlle	aenlle	NNP	1
aeo	aeo	NNP	19
aeolians	aeolian	NNP	1
aeolicus	aeolicus	JJ	17
aeon	aeon	NN	2
aeon	aeon	NNP	2
aeons	aeon	NNP	1
aeons	aeon	NNS	1
aep	aep	NNP	3
aer	aer	NNP	7
aer-a	aer-a	NNP	1
aer-d	aer-d	NNP	2
aerate	aerate	NN	2
aerate	aerate	NNP	7
aerated	aerated	JJ	16
aeration	aeration	NN	23
aeration	aeration	NNP	11
aerial	aerial	JJ	56
aerial	aerial	NNP	10
aerialist	aerialist	NN	1
aerially	aerially	RB	2
aerials	aerial	NNS	1
aerie	aerie	NN	5
aeries	aerie	NNS	1
aerio	aerio	NNP	1
aero	aero	NN	2
aero	aero	NNP	10
aero-engine	aero-engine	JJ	2
aerobed	aerobed	NNP	2
aerobes	aerobe	NNS	1
aerobic	aerobic	JJ	47
aerobic	aerobic	NNP	9
aerobic-type	aerobic-type	JJ	1
aerobically	aerobically	RB	3
aerobicise	aerobicise	NN	1
aerobics	aerobic	NN	21
aerobics	aerobic	NNP	3
aerodigestive	aerodigestive	JJ	3
aerodium	aerodium	NNP	1
aerodrome	aerodrome	NNP	3
aerodynamic	aerodynamic	JJ	11
aerodynamics	aerodynamics	NNS	7
aerogenes	aerogene	NNS	2
aeromax	aeromax	NNP	1
aerometric	aerometric	NNP	1
aeromonas	aeromona	NNP	9
aeromousse	aeromousse	NNP	1
aeronautic	aeronautic	JJ	1
aeronautic	aeronautic	NNP	3
aeronautical	aeronautical	JJ	15
aeronautical	aeronautical	NNP	8
aeronautics	aeronautics	NNP	16
aeronautics	aeronautics	NNS	4
aeroperu	aeroperu	NNP	1
aerophilum	aerophilum	NN	3
aeroplane	aeroplane	NN	1
aeroplane	aeroplane	NNP	2
aeroplane	aeroplane	UNC	1
aeroporto	aeroporto	NNP	1
aeropyrum	aeropyrum	NNP	9
aeros	aero	NNP	1
aerosmith	aerosmith	NNP	27
aerosol	aerosol	NN	48
aerosol	aerosol	NNP	3
aerosoles	aerosole	NNP	9
aerosolization	aerosolization	NN	6
aerosolization	aerosolization	NNP	1
aerosolized	aerosolized	JJ	8
aerosols	aerosol	NNP	9
aerosols	aerosol	NNS	12
aerospace	aerospace	NN	47
aerospace	aerospace	NNP	15
aerospatiale	aerospatiale	NNP	1
aerpe	aerpe	NNP	1
aertoercken	aertoercken	NN	1
aerts	aert	NNP	14
aeruginos	aerugino	NNS	1
aeruginosa	aeruginosa	NN	145
aeruginosaand	aeruginosaand	NN	1
aeruginosaperiplasm	aeruginosaperiplasm	NN	2
aerugionsa	aerugionsa	NN	1
aeryn	aeryn	NNP	7
aeryn-oost	aeryn-oost	NNP	1
aes	ae	NNP	10
aes-drafted	aes-drafted	NNP	1
aeschbacher	aeschbacher	NNP	1
aeschylus	aeschylus	NNP	3
aesculap	aesculap	NNP	1
aeshma	aeshma	NNP	7
aesop	aesop	NNP	8
aesopian	aesopian	NNP	1
aestheic	aestheic	JJ	1
aesthete	aesthete	NN	8
aesthete-mystic	aesthete-mystic	JJ	1
aesthetes	aesthete	NNS	1
aesthetic	aesthetic	JJ	172
aesthetic	aesthetic	NN	30
aesthetic	aesthetic	NNP	10
aesthetic	aesthetic	UNC	2
aesthetically	aesthetically	NNP	1
aesthetically	aesthetically	RB	19
aestheticienne	aestheticienne	NN	1
aestheticism	aestheticism	NN	2
aestheticism	aestheticism	NNP	1
aestheticizing	aestheticize	VBG	4
aesthetics	aesthetics	NNP	4
aesthetics	aesthetics	NNS	48
aesthetics	aesthetics	UNC	1
aestivum	aestivum	NN	2
aeterna	aeterna	NNP	1
aetheistic	aetheistic	JJ	1
aether	aether	NN	1
aethiopis	aethiopi	NNS	1
aetiological	aetiological	JJ	1
aetiology	aetiology	NN	7
aetna	aetna	NNP	20
aev	aev	NNP	5
ae­gean	ae­gean	NNP	1
af	af	NN	5
af	af	NNP	253
afa	afa	NN	1
afa	afa	NNP	39
afac	afac	NN	1
afacility	afacility	NN	1
afaic	afaic	NNP	3
afaict	afaict	NNP	1
afaik	afaik	NN	2
afaik	afaik	NNP	29
afar	afar	NN	34
afar	afar	NNP	4
afarensis	afarensis	NNS	1
afatk	afatk	NNP	1
afb	afb	NNP	12
afc	afc	NNP	15
afca	afca	NNP	1
afdc	afdc	NNP	28
afdc-unemployed	afdc-unemployed	NNP	1
afeared	afeared	JJ	6
afer	afer	NN	1
aferguson	aferguson	NNP	1
afew	afew	NNP	3
afewerki	afewerkus	NNP	1
aff	aff	NN	1
aff	aff	NNP	1
affability	affability	NN	4
affable	affable	JJ	19
affably	affably	RB	3
affair	affair	NN	611
affair	affair	NNP	47
affair	affair	UNC	4
affaire	affaire	NN	22
affaire	affaire	NNP	1
affaires	affaire	NNS	3
affairs	affair	NNP	200
affairs	affair	NNPS	77
affairs	affair	NNS	387
affairs	affairs	UNC	3
affairspartnership	affairspartnership	NN	1
affairsthe	affairsthe	NNP	1
affarisc	affarisc	NNP	1
affeared	affeared	JJ	1
affect	affect	NN	70
affect	affect	NNP	23
affect	affect	UNC	1
affect	affect	VB	912
affect	affect	VBP	236
affectation	affectation	NN	7
affectation	affectation	NNP	1
affectations	affectation	NNS	4
affected	affect	VBD	137
affected	affect	VBN	1117
affected	affected	JJ	21
affected	affected	NNP	19
affected	affected	UNC	1
affectedunits	affectedunit	NNS	1
affecting	affect	VBG	309
affecting	affecting	NNP	8
affectingly	affectingly	RB	1
affection	affection	NN	182
affection	affection	NNP	7
affectionat	affectionat	NN	1
affectionate	affectionate	JJ	45
affectionate	affectionate	NNP	2
affectionately	affectionately	NNP	2
affectionately	affectionately	RB	21
affections	affection	NNP	3
affections	affection	NNS	22
affective	affective	JJ	12
affectivity	affectivity	NN	1
affectless	affectless	JJ	8
affectless	affectless	UNC	1
affectlessness	affectlessness	NNS	3
affects	affect	VBZ	309
affects	affects	NN	1
affects	affects	UNC	1
affen	affen	NNP	1
afferent	afferent	NN	44
afferents	afferent	NNP	2
afferents	afferent	NNS	57
afffection	afffection	NN	1
affi	affi	NNP	2
affianced	affianced	JJ	1
affiche	affiche	NNP	1
afficionado	afficionado	NN	1
affictions	affiction	NNS	1
affidavit	affidavit	NN	98
affidavit	affidavit	NNP	1
affidavit	affidavit	UNC	2
affidavits	affidavit	NNS	15
affigel	affigel	NNP	6
affiliate	affiliate	NN	67
affiliate	affiliate	NNP	1
affiliated	affiliate	VBN	94
affiliated	affiliated	JJ	1
affiliated	affiliated	NNP	3
affiliateid	affiliateid	NN	1
affiliates	affiliate	NNP	1
affiliates	affiliate	NNS	43
affiliating	affiliate	VBG	1
affiliation	affiliation	NN	53
affiliation	affiliation	NNP	6
affiliations	affiliation	NNS	13
affine	affine	NN	1
affinities	affinity	NNP	1
affinities	affinity	NNS	60
affinity	affinity	NN	495
affinity	affinity	NNP	17
affinity-purification	affinity-purification	JJ	1
affinity-purified	affinity-purified	JJ	17
affinity-purified	affinity-purified	NNP	5
affirm	affirm	NN	35
affirm	affirm	NNP	4
affirmation	affirmation	NN	39
affirmation	affirmation	NNP	1
affirmations	affirmation	NNS	2
affirmative	affirmative	JJ	281
affirmative	affirmative	NNP	25
affirmative	affirmative	UNC	2
affirmative-action	affirmative-action	NN	20
affirmative-action-friendly	affirmative-action-friendly	JJ	1
affirmatively	affirmatively	RB	6
affirmed	affirm	VBD	39
affirmed	affirmed	NNP	4
affirmed	affirmed	UNC	1
affirming	affirm	VBG	28
affirming	affirming	NNP	1
affirms	affirm	NNS	12
affix	affix	NN	14
affix	affix	NNP	3
affixations	affixation	NNP	3
affixed	affixed	JJ	24
affixes	affix	NNS	5
affixing	affix	VBG	1
afflatus	afflatus	JJ	2
affleck	affleck	NNP	88
afflecks	affleck	NNP	2
afflerbach	afflerbach	NNP	3
affliate	affliate	NN	1
afflict	afflict	VB	17
afflicted	afflict	VBN	71
afflicted	afflicted	NNP	3
afflicting	afflict	VBG	15
affliction	affliction	NN	20
affliction	affliction	NNP	11
afflictions	affliction	NNS	9
afflicts	afflict	NNP	1
afflicts	afflict	VBZ	18
affluence	affluence	NN	18
affluent	affluent	JJ	98
affluent	affluent	NN	5
affluent	affluent	NNP	3
affluentials	affluential	NNS	1
affluenza	affluenza	NN	1
afford	afford	NNP	4
afford	afford	VB	571
afford	afford	VBP	31
affordability	affordability	NN	14
affordability	affordability	NNP	2
affordabilty	affordabilty	NN	1
affordable	affordable	JJ	151
affordable	affordable	NNP	6
affordable	affordable	UNC	1
affordably	affordably	RB	6
afforded	afford	VBN	71
affording	afford	VBG	22
affords	afford	NNS	48
affricate	affricate	NN	1
affront	affront	NN	38
affronted	affronted	JJ	2
affronts	affront	NNS	1
affusion	affusion	NN	2
affusions	affusion	NNS	1
affx	affx	NN	1
affx	affx	NNP	1
affy	affy	NNP	1
affymetirx	affymetirx	NNP	1
affymetnx	affymetnx	NNP	1
affymetrix	affymetrix	NN	8
affymetrix	affymetrix	NNP	357
affymetrx	affymetrx	NNP	1
afg	afg	NNP	3
afganistan	afganistan	NNP	2
afge	afge	NNP	2
afghan	afghan	JJ	209
afghan	afghan	NN	1
afghan	afghan	NNP	35
afghan-army	afghan-army	NNP	2
afghan-austin	afghan-austin	NNP	1
afghan-based	afghan-based	NNP	2
afghan-bomb	afghan-bomb	NNP	3
afghan-islam	afghan-islam	NNP	1
afghan-journal	afghan-journal	NNP	2
afghan-military	afghan-military	NNP	1
afghan-security	afghan-security	NNP	1
afghan-u	afghan-u	NNP	1
afghan-valley	afghan-valley	NNP	1
afghani	afghanus	NN	1
afghani	afghanus	NNP	12
afghania	afghanium	NNP	1
afghanis	afghani	NNP	3
afghanistan	afghanistan	NN	2
afghanistan	afghanistan	NNP	895
afghanistan	afghanistan	UNC	1
afghanistan-a	afghanistan-a	NNP	1
afghanistan-based	afghanistan-based	NNP	3
afghanistan-in	afghanistan-in	NNP	1
afghans	afghan	NNP	2
afghans	afghan	NNPS	30
afghans-meet	afghans-meet	NNP	2
afgp	afgp	NNP	2
afi	afi	UNC	2
afi	afus	NNP	30
afia	afium	NNP	1
aficionado	aficionado	NN	10
aficionado	aficionado	NNP	1
aficionado	aficionado	UNC	1
aficionados	aficionado	NNP	2
aficionados	aficionado	NNS	40
afield	afield	RB	24
afif	afif	NNP	1
afilliate	afilliate	NN	1
afire	afire	NNP	1
afire	afire	RB	4
afits	afit	NNS	1
afix	afix	NN	1
afl	afl	NNP	5
afl-cio	afl-cio	NNP	75
afl-cio-organized	afl-cio-organized	NNP	1
afl-nfl	afl-nfl	NNP	1
aflac	aflac	NNP	2
aflame	aflame	NN	3
aflame	aflame	NNP	1
aflii	aflius	NNP	3
aflitos	aflito	NNP	3
afloat	afloat	NNP	1
afloat	afloat	RB	46
afloat	afloat	UNC	1
aflp	aflp	NNP	19
aflp-based	aflp-based	NNP	1
aflps	aflp	NNP	1
aflutter	aflutter	NN	3
afm	afm	NNP	2
afmb	afmb	NNP	1
afmd	afmd	NNP	1
afo	afo	NN	1
afonsin	afonsin	NNP	1
afonso	afonso	NNP	15
afoot	afoot	NNP	3
afoot	afoot	RB	30
afor	afor	NN	3
afor	afor	NNP	2
afore	afore	NN	2
afore-mentioned	afore-mentioned	JJ	1
aforementioned	aforementioned	JJ	87
aforementioned	aforementioned	NNP	1
aforesaid	aforesaid	NN	5
aforethought	aforethought	JJ	5
afoul	afoul	NN	34
afp	afp	NNP	2
afquarterly	afquarterly	RB	1
afraid	afraid	JJ	640
afraid	afraid	NNP	24
afraid	afraid	UNC	4
aframomum	aframomum	NNP	5
afresh	afresh	NN	10
afri	afrus	NNP	2
afriad	afriad	NN	1
africa	africa	NNP	824
africa	africa	UNC	6
africa-wide	africa-wide	NNP	1
africa-with-intention-of-getting-soul	africa-with-intention-of-getting-soul	NNP	1
africaine	africaine	NNP	1
african	african	JJ	423
african	african	NN	2
african	african	NNP	665
african-american	african-american	JJ	2
african-artifacts	african-artifact	NNP	1
african-descended	african-descended	NNP	1
african-grown	african-grown	NNP	1
african-style	african-style	NNP	1
africana	africana	NNP	39
africanamericans	africanamerican	NNP	1
africanism	africanism	NNP	1
africanist	africanist	NNP	2
africanity	africanity	NNP	2
africanize	africanize	NNP	1
africanoodian	africanoodian	NNP	1
africans	african	NNPS	76
africans	african	NNS	1
africare	africare	NNP	1
africaworld	africaworld	NNP	1
afridi	afridus	NNP	1
afriend	afriend	NN	1
afriend	afriend	NNP	2
afrika	afrika	NNP	1
afrikaans	afrikaan	NNP	17
afrikan	afrikan	NNP	1
afrikaner	afrikaner	JJ	3
afrikaners	afrikaner	NNPS	2
afrikaners	afrikaners	UNC	1
afrikas	afrika	NNP	1
afriyachts	afriyacht	NNP	1
afro	afro	NN	3
afro	afro	NNP	40
afro-futurist	afro-futurist	NNP	1
afro-pop	afro-pop	NNP	2
afroamerican	afroamerican	NNP	1
afrocentric	afrocentric	NNP	7
afrocentrism	afrocentrism	NNP	3
afrocentrist	afrocentrist	NNP	1
afrocentrists	afrocentrist	NNP	3
afroed	afroed	NNP	1
afront	afront	NNP	1
afrophile	afrophile	NNP	2
afropick	afropick	NN	1
afros	afro	NNS	1
afs	af	NNP	2
afsa	afsa	NNP	3
afsc	afsc	NNP	1
afscme	afscme	NNP	1
afshin	afshin	NNP	1
afsluitdijk	afsluitdijk	NNP	2
aft	aft	JJ	10
aft	aft	NNP	5
afta	afta	NN	1
afta	afta	NNP	1
after	after	IN	22042
after	after	NN	3
after	after	NNP	76
after	after	RB	45
after	after	UNC	57
after-action	after-action	JJ	5
after-after-party	after-after-party	JJ	1
after-birth	after-birth	JJ	1
after-care	after-care	JJ	1
after-college	after-college	JJ	1
after-dark	after-dark	JJ	4
after-days	after-day	JJ	1
after-death	after-death	JJ	1
after-dinner	after-dinner	JJ	10
after-effect	after-effect	JJ	1
after-effects	after-effect	JJ	2
after-hours	after-hour	JJ	21
after-life	after-life	JJ	2
after-market	after-market	JJ	2
after-movie	after-movie	JJ	1
after-office	after-office	JJ	1
after-party	after-party	JJ	1
after-purchase	after-purchase	JJ	6
after-sales	after-sale	JJ	3
after-school	after-school	JJ	21
after-school	after-school	NNP	1
after-shave	after-shave	JJ	1
after-tax	after-tax	JJ	12
after-tax	after-tax	NNP	1
after-the-fact	after-the-fact	JJ	3
after-the-rapture	after-the-rapture	JJ	1
after-wit	after-wit	JJ	1
after-work	after-work	JJ	4
afteraction	afteraction	NN	1
afteraffects	afteraffect	NNS	1
afterall	afterall	NN	3
afterall	afterall	NNP	2
afterbirth	afterbirth	NN	1
afterburn	afterburn	NN	1
afterburner	afterburner	NN	3
afterburners	afterburner	NNS	1
aftercare	aftercare	NN	1
aftercare-follow-up	aftercare-follow-up	JJ	1
afterday	afterday	NN	1
aftereffect	aftereffect	NN	2
aftereffects	aftereffect	NNS	6
afterewards	aftereward	NNS	1
afterglow	afterglow	NN	10
afterglow	afterglow	NNP	6
afterimage	afterimage	NN	2
afterlife	afterlife	NN	38
afterlife	afterlife	NNP	3
afterload	afterload	NN	4
aftermarket	aftermarket	NN	3
aftermarkof	aftermarkof	NN	1
aftermath	aftermath	NN	166
aftermath	aftermath	NNP	1
aftermath	aftermath	UNC	1
aftermaths	aftermath	NNS	1
afternoon	afternoon	NN	906
afternoon	afternoon	NNP	22
afternoon	afternoon	UNC	3
afternoon-drive	afternoon-drive	JJ	1
afternoons	afternoon	NNP	3
afternoons	afternoon	NNS	48
afternovember	afternovember	NN	1
afteroon	afteroon	NN	1
afterparties	afterparty	NNS	1
afterplay	afterplay	NN	1
afters	afters	NNS	1
afterschool	afterschool	NN	4
afterschool	afterschool	NNP	1
aftershave	aftershave	NN	1
aftershock	aftershock	NN	5
aftershocks	aftershock	NNS	17
aftertaste	aftertaste	NN	13
aftertaste	aftertaste	NNP	1
aftertaste	aftertaste	UNC	1
aftertax	aftertax	JJ	2
afterthefact	afterthefact	NN	1
afterthought	afterthought	NN	21
afterthought	afterthought	NNP	1
afterthoughts	afterthought	NNP	2
afterthoughts	afterthought	NNS	2
afterward	afterward	RB	192
afterward	afterward	UNC	1
afterwards	afterward	RB	161
afterwards	afterwards	UNC	1
afterword	afterword	NN	5
afterword	afterword	NNP	3
afterwords	afterword	NNS	1
afterwork	afterwork	NN	1
afteryou	afteryou	NN	1
aftra	aftra	NNP	1
aftrer	aftrer	NN	1
aftyr	aftyr	NN	1
afu	afu	NN	1
afu	afu	NNP	1
afuer	afuer	NNP	1
afuera	afuera	NN	1
aful	aful	NNP	1
afunny	afunny	NNP	1
afw	afw	NNP	1
afx	afx	NNP	1
afyon	afyon	NNP	1
ag	ag	NN	1
ag	ag	NNP	215
ag-gt	ag-gt	NNP	1
ag-pandering	ag-pandering	JJ	1
ag-specific	ag-specific	NNP	1
ag-stuff	ag-stuff	JJ	1
aga	aga	NN	2
aga	aga	NNP	48
agaa	agaa	NNP	1
agaaattgccgttgcagtgac	agaaattgccgttgcagtgac	NNP	1
agaacagcaagtgct	agaacagcaagtgct	NNP	1
agaaggagcaggacaccagc	agaaggagcaggacaccagc	NNP	1
agac	agac	NNP	3
agacacaatcgactgaagg	agacacaatcgactgaagg	NNP	1
agacattgacttagctgtggat	agacattgacttagctgtggat	NN	1
agacgfm	agacgfm	NN	2
agacuugaggucggucaacguguac	agacuugaggucggucaacguguac	NNP	1
agaete	agaete	NNP	3
agaetis	agaeti	NNP	2
agaggaagacactgttgagtag	agaggaagacactgttgagtag	NNP	1
agaggtgctggtgccaac	agaggtgctggtgccaac	NNP	1
agahi	agahus	NNP	8
agahst	agahst	NN	1
again	again	JJ	8
again	again	NN	1
again	again	NNP	48
again	again	RB	6452
again	again	UNC	49
again-it	again-it	JJ	1
again-off	again-off	JJ	1
againand	againand	NN	1
againe	againe	NN	1
against	against	IN	8886
against	against	NNP	33
against	against	UNC	8
against-the-odds	against-the-odd	JJ	1
agaion	agaion	NN	1
agambiae	agambia	NN	1
agame	agame	NNP	1
agamemnon	agamemnon	NNP	12
agamenmon	agamenmon	NNP	1
agammaglobulinemia	agammaglobulinemium	NN	3
agammemnon	agammemnon	NNP	3
aganda	aganda	NN	1
aganist	aganist	NN	1
agapanthus	agapanthus	JJ	4
agape	agape	NN	11
agape	agape	NNP	1
agapemone	agapemone	NNP	1
agar	agar	NN	142
agar	agar	NNP	5
agarase	agarase	NN	1
agarcia	agarcium	NN	3
agaricus	agaricus	NNP	1
agarose	agarose	NN	220
agarose	agarose	NNP	10
agarose-cast	agarose-cast	NNP	1
agarose-coated	agarose-coated	JJ	1
agarose-formaldehyde	agarose-formaldehyde	JJ	3
agarose-gel	agarose-gel	JJ	1
agarrar	agarrar	NN	1
agarwal	agarwal	NNP	8
agarwals	agarwal	NNP	1
agas	aga	NNP	2
agassi	agassus	NNP	74
agassiz	agassiz	NNP	1
agastache	agastache	NNP	1
agat	agat	NNP	5
agatcc	agatcc	NNP	1
agatcccaggggtctgtgaaaatggagtgt	agatcccaggggtctgtgaaaatggagtgt	NNP	1
agatct	agatct	NNP	1
agatctgattctaaccatatcgagtgg	agatctgattctaaccatatcgagtgg	NNP	1
agate	agate	NN	6
agate-type	agate-type	NNP	1
agatep	agatep	NNP	1
agateware	agateware	NN	1
agatgcgggcacggctgttcaagga	agatgcgggcacggctgttcaagga	NNP	1
agatgctggccatcataggg	agatgctggccatcataggg	NNP	1
agatha	agatha	NNP	7
agathe-des	agathe-des	NNP	1
agathism	agathism	NN	1
agathistic	agathistic	JJ	1
agavachado	agavachado	NN	1
agavachado	agavachado	NNP	1
agave	agave	NN	7
agave	agave	NNP	1
agaves	agave	NNS	1
agawan	agawan	NNP	1
agayne	agayne	NN	1
agazine	agazine	NN	1
agbayani	agbayanus	NNP	2
agbout	agbout	NN	1
agc	agc	NN	2
agc	agc	NNP	19
agc-related	agc-related	NNP	1
agcactgtgttggcgtacag	agcactgtgttggcgtacag	NNP	1
agcagatgtaggtcctgcacttg	agcagatgtaggtcctgcacttg	NNP	1
agccac	agccac	NNP	1
agccagcagccggaaaactccagt	agccagcagccggaaaactccagt	NNP	2
agccatcaatgataggatcca	agccatcaatgataggatcca	NNP	1
agccccccagcgtaaagat	agccccccagcgtaaagat	NNP	1
agcccgtgcagccatcagcc	agcccgtgcagccatcagcc	NNP	2
agcctggatggctacgtaca	agcctggatggctacgtaca	NNP	1
agcn	agcn	NNP	3
agcop	agcop	NNP	2
agcp	agcp	NN	5
agct	agct	NNP	2
agctcagggagtacttcaaga	agctcagggagtacttcaaga	NN	1
agctcatcatgcagctcat	agctcatcatgcagctcat	NNP	1
agctctgcagcacaaactttaataaatccgaaac	agctctgcagcacaaactttaataaatccgaaac	NNP	1
agctg	agctg	NNP	1
agctgaattccacaaactttaataaatccgaaac	agctgaattccacaaactttaataaatccgaaac	NNP	1
agctgcggccgccctgaaccggttgggtgccac	agctgcggccgccctgaaccggttgggtgccac	NNP	2
agctggccctggcactgctctgctct	agctggccctggcactgctctgctct	NNP	1
agde	agde	NNP	6
age	age	JJ	2
age	age	NN	3982
age	age	NNP	496
age	age	UNC	11
age	age	VBP	39
age-adjusted	age-adjusted	JJ	33
age-adjusted	age-adjusted	NNP	2
age-appropriate	age-appropriate	JJ	6
age-appropriate	age-appropriate	NNP	1
age-associated	age-associated	JJ	3
age-at-onset	age-at-onset	JJ	2
age-based	age-based	JJ	2
age-blip	age-blip	JJ	1
age-bsa	age-bsa	NNP	27
age-bsa-induced	age-bsa-induced	NNP	1
age-conditional	age-conditional	JJ	8
age-darkened	age-darkened	JJ	1
age-dependent	age-dependent	JJ	5
age-discrimination	age-discrimination	JJ	1
age-eligible	age-eligible	JJ	2
age-emphasizing	age-emphasizing	JJ	1
age-gender-matched	age-gender-matched	JJ	1
age-group	age-group	JJ	3
age-groups	age-group	JJ	1
age-inappropriate	age-inappropriate	JJ	1
age-intensity	age-intensity	JJ	1
age-matched	age-matched	JJ	29
age-modified	age-modified	JJ	8
age-old	age-old	JJ	40
age-peers	age-peer	JJ	2
age-range	age-range	JJ	1
age-ravaged	age-ravaged	JJ	1
age-related	age-related	JJ	52
age-retardation	age-retardation	JJ	1
age-smoking	age-smoking	JJ	2
age-specific	age-specific	JJ	50
age-specific	age-specific	NNP	3
age-specificity	age-specificity	JJ	1
age-squared	age-squared	JJ	2
age-stratified	age-stratified	NNP	1
aged	age	VBN	383
aged	aged	JJ	1
aged	aged	NNP	6
aged	aged	UNC	1
aged-matched	aged-matched	JJ	3
agedly	agedly	RB	1
agee	agee	NNP	2
agei	ageus	NNP	3
agei-nhei	agei-nheus	NNP	1
ageing	age	VBG	26
ageing	ageing	NNP	1
ageing	ageing	UNC	2
ageing-can-be-regulated	ageing-can-be-regulated	JJ	1
ageism	ageism	NN	2
ageist	ageist	NN	4
ageless	ageless	JJ	7
ageless	ageless	NNP	1
agellon	agellon	NNP	3
agemates	agemate	NNS	13
agemates	agemates	UNC	1
agemilestone	agemilestone	NNP	1
agen	agen	NN	1
agenbite	agenbite	NN	1
agenbroad	agenbroad	NNP	1
agence	agence	NNP	10
agencies	agencies	JJ	1
agencies	agencies	NN	1
agencies	agencies	UNC	10
agencies	agency	NNP	9
agencies	agency	NNPS	122
agencies	agency	NNS	2110
agencies-and	agencies-and	JJ	1
agencies-away	agencies-away	JJ	1
agencies-missionary	agencies-missionary	JJ	1
agencies-the	agencies-the	JJ	1
agencies-unaccustomed	agencies-unaccustomed	JJ	1
agencies-while	agencies-while	JJ	1
agenciesacquisition	agenciesacquisition	NN	1
agenciesgsa	agenciesgsa	NN	1
agency	agency	NN	2431
agency	agency	NNP	547
agency	agency	UNC	1
agency-are	agency-are	JJ	1
agency-based	agency-based	JJ	2
agency-believed	agency-believed	JJ	1
agency-designated	agency-designated	JJ	8
agency-determined	agency-determined	JJ	1
agency-specific	agency-specific	JJ	5
agencydesignated	agencydesignated	JJ	3
agencyoffice	agencyoffice	NNP	2
agencyprotocols	agencyprotocol	NNP	2
agencyspecific	agencyspecific	JJ	2
agencyusers	agencyuser	NNS	1
agencywide	agencywide	NN	17
agend	agend	NN	1
agenda	agenda	JJ	1
agenda	agenda	NN	480
agenda	agenda	NNP	20
agenda	agenda	UNC	4
agenda-driven	agenda-driven	JJ	1
agenda-save	agenda-save	JJ	1
agenda-setting	agenda-setting	JJ	1
agendas	agenda	NNP	1
agendas	agenda	NNS	47
agendum	agendum	NN	2
agendum	agendum	NNP	1
agenerase	agenerase	NNP	1
ageneration	ageneration	NNP	1
agenes	agene	NNP	1
agenesis	agenesis	NNP	1
agenesis	agenesis	NNS	3
agenseeing	agensee	VBG	2
agent	agent	NN	1101
agent	agent	NNP	57
agent	agent	UNC	4
agent-based	agent-based	JJ	1
agent-noun	agent-noun	JJ	1
agent-provocateur	agent-provocateur	NNP	1
agent-speak	agent-speak	JJ	1
agent-y	agent-y	NNP	1
agentdom	agentdom	NN	1
agentries	agentry	NNS	1
agentry	agentry	NN	1
agentry	agentry	NNP	1
agents	agent	NNPS	9
agents	agent	NNS	1391
agents	agents	UNC	4
agents-even	agents-even	JJ	1
agentur	agentur	NNP	1
agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle	agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle	NNP	1
ager	ager	NNP	3
ager	ager	UNC	1
agere	agere	NNP	2
agers	ager	NNP	7
agers	agers	UNC	2
ages	age	NNP	4
ages	age	NNPS	102
ages	age	NNS	579
ages	ages	UNC	4
ages-old	ages-old	JJ	1
agettin	agettin	NN	1
agey	agey	NN	1
agey	agey	NNP	8
age–bovine	age–bovine	NNP	1
agfa	agfa	NNP	1
agg	agg	NN	1
agg	agg	NNP	35
aggaccaaagaagaagtagga	aggaccaaagaagaagtagga	NNP	1
aggaccctcatggccttg	aggaccctcatggccttg	NNP	1
aggactttgatggaacacgg	aggactttgatggaacacgg	NNP	1
aggaggcggttagccctg	aggaggcggttagccctg	NNP	1
aggcacacaagcccaaaaagac	aggcacacaagcccaaaaagac	NNP	1
aggcactccgaggctagaccag	aggcactccgaggctagaccag	NNP	1
aggccca	aggccca	NNP	1
agggaccggg	agggaccggg	NNP	1
agggagctctgacatcggg	agggagctctgacatcggg	NNP	1
agggah	agggah	NNP	1
agggataacaatatcgccaa	agggataacaatatcgccaa	NNP	1
agggcagt	agggcagt	NNP	3
agggctgctaattgctggta	agggctgctaattgctggta	NNP	1
agggghhhh	agggghhhh	NNP	1
agggh	agggh	NNP	1
aggie	aggie	NNP	3
aggies	aggy	NNP	11
agglomerans	agglomeran	NNS	2
agglomerate	agglomerate	NN	2
agglomeration	agglomeration	NN	4
agglomerations	agglomeration	NNS	1
agglomerative	agglomerative	JJ	12
agglomerative	agglomerative	NNP	2
agglutination	agglutination	NN	2
agglutinative	agglutinative	JJ	1
agglutinin	agglutinin	NN	1
agglutinins	agglutinin	NNS	4
aggrandize	aggrandize	NN	1
aggrandized	aggrandized	JJ	1
aggrandizement	aggrandizement	NN	5
aggrandizements	aggrandizement	NNS	3
aggrandizing	aggrandize	VBG	1
aggrastat	aggrastat	NNP	2
aggravate	aggravate	VB	6
aggravate	aggravate	VBP	2
aggravated	aggravate	VBD	8
aggravated	aggravate	VBN	27
aggravated	aggravated	NNP	1
aggravates	aggravate	VBZ	1
aggravating	aggravate	VBG	4
aggravating	aggravating	JJ	22
aggravating	aggravating	NNP	1
aggravatingly	aggravatingly	RB	1
aggravation	aggravation	NN	9
aggravation	aggravation	NNP	2
aggravations	aggravation	NNS	3
aggravator	aggravator	NNP	1
aggrecan	aggrecan	NN	11
aggrecan	aggrecan	NNP	1
aggrecanase	aggrecanase	NN	1
aggregata	aggrega	NN	2
aggregate	aggregate	JJ	202
aggregate	aggregate	NN	33
aggregate	aggregate	NNP	12
aggregated	aggregated	JJ	46
aggregates	aggregate	NNP	2
aggregates	aggregate	NNS	256
aggregating	aggregate	VBG	25
aggregating	aggregating	NNP	2
aggregation	aggregation	NN	165
aggregation	aggregation	NNP	5
aggregation-compatible	aggregation-compatible	JJ	1
aggregation-competent	aggregation-competent	JJ	1
aggregation-prone	aggregation-prone	JJ	1
aggregations	aggregation	NNS	7
aggregator	aggregator	NN	2
aggregrate	aggregrate	NN	1
aggresive	aggresive	JJ	1
aggresome	aggresome	NN	1
aggresome-like	aggresome-like	JJ	4
aggresomes	aggresome	NNS	1
aggress	aggress	NNS	1
aggression	aggression	NN	130
aggression	aggression	NNP	7
aggression	aggression	UNC	4
aggression-burner	aggression-burner	JJ	1
aggression-inducing	aggression-inducing	JJ	1
aggressions	aggression	NNS	2
aggressive	aggressive	JJ	519
aggressive	aggressive	NNP	19
aggressively	aggressively	NNP	3
aggressively	aggressively	RB	160
aggressively	aggressively	UNC	2
aggressiveness	aggressiveness	NN	14
aggressiveness	aggressiveness	UNC	1
aggressor	aggressor	NN	9
aggressor	aggressor	UNC	1
aggressors	aggressor	NNP	1
aggressors	aggressor	NNS	10
aggressosexual	aggressosexual	NNP	1
aggrievance	aggrievance	NN	1
aggrieved	aggrieved	JJ	29
aggrievement	aggrievement	NN	2
aggrievor	aggrievor	NN	1
aggrivate	aggrivate	NN	2
aggrivates	aggrivate	NNS	1
aggrivating	aggrivate	VBG	1
aggro	aggro	NN	2
aggtca	aggtca	NNP	1
aggtcacattgccgaacct	aggtcacattgccgaacct	NNP	1
aggtcgccggctccctaatatttaggg-tamra	aggtcgccggctccctaatatttaggg-tamra	NNP	1
agha	agha	NNP	1
aghajari	aghajarus	NNP	1
aghanistan	aghanistan	NNP	1
aghast	aghast	JJ	25
aghiasos	aghiaso	NNP	2
aghion	aghion	NNP	1
aghlaghlaghlaghlaghl	aghlaghlaghlaghlaghl	NN	1
aghlghlghlghhgll	aghlghlghlghhgll	NNP	1
aghía	aghía	NNP	1
agi	agus	NN	1
agi	agus	NNP	5
agia	agium	NNP	5
agian	agian	NN	2
agie-bp	agie-bp	NNP	1
agiero	agiero	NN	1
agii	agius	NNP	1
agikuyu	agikuyu	NNP	1
agile	agile	FW	1
agile	agile	NN	17
agilent	agilent	NNP	11
agilis	agili	NNS	1
agility	agility	NN	20
agility	agility	NNP	2
agin	agin	NN	2
agina	agina	JJ	1
agincourt	agincourt	NNP	8
aging	age	VBG	312
aging	aging	NN	54
aging	aging	NNP	49
aging	aging	UNC	1
aging-at	aging-at	JJ	1
aging-boomer	aging-boomer	JJ	1
aging-friendly	aging-friendly	JJ	1
aging-in	aging-in	NNP	1
aging-related	aging-related	JJ	1
agins	agin	NNP	7
agios	agio	NNP	2
agiou	agiou	NNP	1
agita	agita	NN	1
agitans	agitan	NNS	1
agitate	agitate	NN	5
agitated	agitate	VBN	41
agitated	agitated	NNP	2
agitated	agitated	UNC	1
agitatedly	agitatedly	RB	1
agitates	agitate	NNS	2
agitating	agitate	VBG	8
agitating	agitating	NNP	1
agitation	agitation	NN	59
agitation	agitation	NNP	4
agitator	agitator	NN	3
agitator	agitator	UNC	1
agitators	agitator	NNS	4
agitoxin	agitoxin	NN	1
agitpop	agitpop	NN	1
agitprop	agitprop	NN	8
agkistrodon	agkistrodon	NNP	1
agkpqetfld	agkpqetfld	NNP	1
aglint	aglint	NN	1
aglitter	aglitter	NN	1
aglow	aglow	NN	7
aglozenge	aglozenge	NNP	1
aglt	aglt	NN	1
aglycone	aglycone	NN	1
agmon	agmon	NNP	6
agne	agne	NNP	1
agnelli	agnellus	NNP	33
agnellis	agnelli	NNPS	5
agnes	agn	NNP	29
agnese	agnese	NNP	1
agnew	agnew	NNP	5
agnieszka	agnieszka	NNP	2
agnodice	agnodice	NNP	1
agnolo	agnolo	NNP	1
agnondas	agnonda	NNP	1
agnos	agno	NNP	1
agnostic	agnostic	JJ	16
agnostic	agnostic	NNP	1
agnosticism	agnosticism	NN	5
agnosticism	agnosticism	NNP	1
agnostics	agnostic	NNS	7
agnst	agnst	NN	1
agnsty	agnsty	NN	2
agnus	agnus	NNP	1
agnv	agnv	NNP	1
ago	ago	IN	14
ago	ago	JJ	6
ago	ago	NN	2
ago	ago	NNP	11
ago	ago	RB	4855
ago	ago	UNC	38
ago-are	ago-are	JJ	1
ago-before	ago-before	JJ	1
ago-what	ago-what	JJ	1
agodoa	agodoa	NNP	1
agog	agog	NN	9
agoggle	agoggle	NN	1
agon	agon	NN	1
agona	agona	NNP	1
agonale	agonale	NNP	1
agonalis	agonali	NNP	1
agone	agone	NN	1
agone	agone	NNP	2
agonia	agonium	NNP	1
agonies	agony	NNS	3
agonism	agonism	NN	9
agonism	agonism	NNP	2
agonist	agonist	NN	278
agonist	agonist	NNP	9
agonist-activated	agonist-activated	JJ	1
agonist-antagonist	agonist-antagonist	JJ	2
agonist-antagonists	agonist-antagonist	JJ	1
agonist-bound	agonist-bound	JJ	5
agonist-dependent	agonist-dependent	JJ	6
agonist-derivative	agonist-derivative	JJ	1
agonist-induced	agonist-induced	JJ	15
agonist-induced	agonist-induced	NNP	1
agonist-mediated	agonist-mediated	JJ	3
agonist-regulated	agonist-regulated	JJ	1
agonist-selective	agonist-selective	JJ	2
agonist-specific	agonist-specific	JJ	1
agonist-stimulated	agonist-stimulated	JJ	1
agonist-stimulation	agonist-stimulation	JJ	1
agonist-treated	agonist-treated	JJ	1
agonistic	agonistic	JJ	8
agonistic	agonistic	NNP	2
agonists	agonist	NNP	1
agonists	agonist	NNS	174
agonize	agonize	VB	10
agonized	agonized	JJ	19
agonizer	agonizer	NN	1
agonizers	agonizer	NNS	1
agonizes	agonize	NNS	1
agonizing	agonizing	JJ	44
agonizingly	agonizingly	RB	4
agony	agony	NN	54
agony	agony	NNP	10
agony-making	agony-making	JJ	1
agood	agood	NNP	1
agora	agora	NN	7
agora	agora	NNP	23
agora	agora	UNC	1
agora-like	agora-like	JJ	1
agoraphobia	agoraphobia	NN	2
agoraphobics	agoraphobic	NNS	1
agoras	agora	NNP	2
agordon	agordon	NN	24
agostino	agostino	NNP	2
agotataki	agotatakus	NN	1
agoura	agoura	NNP	4
agouti	agoutus	NN	13
agouti	agoutus	NNP	3
agouti-related	agouti-related	JJ	3
agoutis	agouti	NNS	1
agp	agp	NNP	1
agpr	agpr	NNP	1
agr	agr	NN	2
agra	agra	NNP	25
agramonte	agramonte	NNP	3
agranulocytosis	agranulocytosis	NNS	5
agrarian	agrarian	NN	13
agrarian	agrarian	NNP	1
agrarians	agrarian	NNS	1
agrawal	agrawal	NNP	2
agre	agre	NNP	1
agreda	agreda	NNP	4
agredo	agredo	NNP	1
agree	agree	NN	2
agree	agree	NNP	17
agree	agree	UNC	10
agree	agree	VB	601
agree	agree	VBP	1215
agree-imo	agree-imo	JJ	1
agreeable	agreeable	JJ	42
agreeably	agreeably	RB	12
agreeance	agreeance	NN	2
agreed	agree	VBD	1087
agreed	agree	VBN	331
agreed	agreed	NN	5
agreed	agreed	NNP	2
agreed	agreed	UNC	3
agreed-on	agreed-on	JJ	2
agreed-to	agreed-to	JJ	1
agreed-upon	agreed-upon	JJ	31
agreed-upon	agreed-upon	NNP	1
agreeement	agreeement	NN	1
agreein	agreein	NN	1
agreeing	agree	VBG	134
agreeing	agreeing	NNP	4
agreement	agreement	NN	1450
agreement	agreement	NNP	56
agreement	agreement	UNC	8
agreement-to-disagree	agreement-to-disagree	JJ	1
agreements	agreement	NNP	20
agreements	agreement	NNS	292
agreementto	agreementto	NN	1
agrees	agree	NNP	3
agrees	agree	VBZ	292
agrees	agrees	UNC	2
agression	agression	UNC	1
agressive	agressive	JJ	3
agressively	agressively	RB	2
agrestis	agresti	NNS	1
agrevo	agrevo	NNP	1
agribiz	agribiz	NN	2
agribusiness	agribusiness	NNP	1
agribusiness	agribusiness	NNS	17
agricola	agricolum	NNP	1
agricole	agricole	NNP	6
agricultural	agricultural	JJ	256
agricultural	agricultural	NNP	37
agriculturalist	agriculturalist	NN	1
agriculturalists	agriculturalist	NNS	1
agriculturally	agriculturally	RB	1
agriculture	agriculture	NN	128
agriculture	agriculture	NNP	225
agriculture	agriculture	UNC	1
agriculture-dependent	agriculture-dependent	JJ	1
agriculturists	agriculturist	NNS	2
agrigento	agrigento	NNP	3
agrin	agrin	NN	69
agrin	agrin	NNP	5
agrinatura	agrinatura	NNP	1
agringado	agringado	NN	10
agringado	agringado	NNP	7
agringados	agringado	NNS	1
agrippa	agrippa	NNP	5
agrippas	agrippa	NNP	1
agrippina	agrippina	NNP	1
agris	agri	NNP	14
agritainment	agritainment	NN	1
agri­culture	agri­culture	NN	1
agro-drug	agro-drug	JJ	3
agrobacteria	agrobacterium	NN	2
agrobacterium	agrobacterium	NNP	36
agrobacteriumbinary	agrobacteriumbinary	NNP	1
agrocin	agrocin	NNP	2
agrocin-encoding	agrocin-encoding	JJ	1
agrocin-like	agrocin-like	JJ	1
agrocinopine	agrocinopine	NN	1
agrocins	agrocin	NNS	1
agron	agron	NNP	2
agronomic	agronomic	JJ	4
agronomic	agronomic	NNP	1
agronomist	agronomist	NN	1
agronomy	agronomy	NNP	1
agross	agross	NNS	1
agrotourism	agrotourism	NN	1
aground	aground	NN	14
aground	aground	NNP	1
agrp	agrp	NNP	40
agrregate	agrregate	NN	1
agrument	agrument	NN	1
agrunt	agrunt	NNP	2
agréable	agréable	JJ	1
agržable	agržable	JJ	1
ags	ag	NNP	29
ags	ag	NNS	1
agsim	agsim	NNP	3
agt	agt	NN	4
agt	agt	NNP	26
agtacg	agtacg	NNP	1
agtactagggtagctcctcc	agtactagggtagctcctcc	NNP	1
agtcaaggctcacagagctaa	agtcaaggctcacagagctaa	NN	1
agtcaggaatggctgcacc	agtcaggaatggctgcacc	NNP	1
agtgactgtccttcctctgt	agtgactgtccttcctctgt	NNP	1
agtgaggttcatgtaccag	agtgaggttcatgtaccag	NNP	1
agtgct	agtgct	NNP	1
agtggcctatgcggccgcgg	agtggcctatgcggccgcgg	NNP	1
agtgtaatggaacagatgccaagg	agtgtaatggaacagatgccaagg	NNP	1
agtii	agtius	NNP	4
agttgaggggactttcccaggc	agttgaggggactttcccaggc	NNP	1
agttggttttcctttggctgtgtg	agttggttttcctttggctgtgtg	NNP	1
agttgtgtttgtgtccgacg	agttgtgtttgtgtccgacg	NNP	1
agtx	agtx	NNP	1
agu	agu	NN	1
agua	agua	NN	3
agua	agua	NNP	8
agua-cate	agua-cate	JJ	1
aguacate	aguacate	NN	3
aguada	aguada	NNP	1
aguadilla	aguadillum	NNP	3
aguadulce	aguadulce	NNP	1
aguardando	aguardando	NN	1
aguardente	aguardente	NN	3
aguardiente	aguardiente	NN	2
aguas	agua	NNP	1
aguayo	aguayo	NNP	1
agudo	agudo	NN	1
ague	ague	NN	1
ague	ague	NNP	1
aguecheek	aguecheek	NNP	2
agueface	agueface	NNP	1
aguelo	aguelo	NN	1
aguideforevaluatingagencies	aguideforevaluatingagency	NNP	1
aguideforfederalagenciesin	aguideforfederalagenciesin	NNP	1
aguilar	aguilar	NNP	9
aguilas	aguila	NNP	1
aguilera	aguilera	NNP	30
aguinaga	aguinaga	NNP	1
aguinaldo	aguinaldo	NNP	1
aguinaldos	aguinaldo	NNP	4
aguinaldos	aguinaldo	NNS	6
aguinis	aguini	NNP	1
aguirre	aguirre	NNP	7
agular	agular	NNP	1
agulo	agulo	NNP	1
agung	agung	NNP	18
agustain	agustain	NNP	4
agustin	agustin	NNP	1
agustinillo	agustinillo	NNP	1
agustín	agustín	NNP	5
aguárdenlas	aguárdenlas	NNP	1
agva	agva	NNP	1
agwale	agwale	NNP	1
agworks	agwork	NNP	4
agía	agía	NNP	21
agías	agías	NNP	1
ah	ah	NN	90
ah	ah	NNP	132
ah	ah	UH	606
ah	ah	UNC	7
ah-ah-ah	ah-ah-ah	JJ	1
ah-ah-ah	ah-ah-ah	NNP	1
ah-choo	ah-choo	NNP	1
ah-doh-nees	ah-doh-nee	NNP	1
ah-gwa	ah-gwa	NNP	1
ah-ha	ah-ha	JJ	1
ah-ha	ah-ha	NNP	5
ah-ha-ha	ah-ha-ha	JJ	6
ah-ha-ha	ah-ha-ha	NNP	11
ah-ha-ha-ha	ah-ha-ha-ha	NNP	4
ah-ha-ha-ha-ha	ah-ha-ha-ha-ha	NNP	1
ah-hem	ah-hem	JJ	1
ah-kai-nah	ah-kai-nah	NNP	1
ah-lone	ah-lone	JJ	1
ah-mtv-um	ah-mtv-um	NNP	1
ah-oo-gah	ah-oo-gah	NNP	1
ah-to-nym	ah-to-nym	NNP	1
ah-yup	ah-yup	NNP	1
aha	aha	NN	8
aha	aha	NNP	92
aha	aha	UNC	1
aha-wa	aha-wa	NNP	5
ahab	ahab	NNP