'cause	257	1.1594865E-5
'd	13647	6.1570085E-4
'em	601	2.711484E-5
'll	13866	6.255813E-4
'm	33489	0.0015108966
'n	20	9.0232413E-7
'n'	187	8.43673E-6
're	32626	0.0014719614
's	240281	0.010840567
't	193	8.707428E-6
'til	22	9.925566E-7
've	23516	0.0010609527
-losing	1	4.5116206E-8
1069	17	7.669755E-7
727	34	1.533951E-6
?	5149	2.3230336E-4
?-?	20	9.0232413E-7
?-?-?	2	9.023241E-8
?-actin	99	4.4665044E-6
?-actine	1	4.5116206E-8
?-actinin	18	8.1209174E-7
?-active	1	4.5116206E-8
?-adrenergic	9	4.0604587E-7
?-adrenergic-receptor	1	4.5116206E-8
?-adrenergicblockade	1	4.5116206E-8
?-adrenoceptor	6	2.7069723E-7
?-agarase	1	4.5116206E-8
?-agonist	1	4.5116206E-8
?-amino	10	4.5116207E-7
?-aminoadipoyl	1	4.5116206E-8
?-aminobutyric	1	4.5116206E-8
?-aminoethyl	1	4.5116206E-8
?-aminoethylether	1	4.5116206E-8
?-amylase	2	9.023241E-8
?-amylase-like	1	4.5116206E-8
?-amyloid	2	9.023241E-8
?-arrestin	2	9.023241E-8
?-barrel	21	9.4744036E-7
?-barrel-like	1	4.5116206E-8
?-barrels	2	9.023241E-8
?-binding	3	1.3534861E-7
?-blockade	4	1.8046482E-7
?-blocker	15	6.767431E-7
?-blockeri	1	4.5116206E-8
?-blockers	5	2.2558103E-7
?-blocking	3	1.3534861E-7
?-box	19	8.572079E-7
?-branched	3	1.3534861E-7
?-bungarotoxin	6	2.7069723E-7
?-carboxyl	2	9.023241E-8
?-carboxylate	1	4.5116206E-8
?-carotene	3	1.3534861E-7
?-catenin	123	5.5492933E-6
?-catenin-mediated	2	9.023241E-8
?-cell	22	9.925566E-7
?-cell-like	1	4.5116206E-8
?-cells	51	2.3009266E-6
?-chain	3	1.3534861E-7
?-chains-?	1	4.5116206E-8
?-chemokine	1	4.5116206E-8
?-cholestane	1	4.5116206E-8
?-chymotrypsin	1	4.5116206E-8
?-cleavage	1	4.5116206E-8
?-coefficient	1	4.5116206E-8
?-configuration	2	9.023241E-8
?-counter	2	9.023241E-8
?-cryptoxanthin	2	9.023241E-8
?-ct	3	1.3534861E-7
?-cyclodextrin	2	9.023241E-8
?-d	2	9.023241E-8
?-defensins	1	4.5116206E-8
?-dependent	3	1.3534861E-7
?-dihydroprogesterone	1	4.5116206E-8
?-dihydrotestosterone	2	9.023241E-8
?-dimethyl	3	1.3534861E-7
?-diol	3	1.3534861E-7
?-distribution	3	1.3534861E-7
?-dystrobrevin	2	9.023241E-8
?-dystrobrevin-interacting	1	4.5116206E-8
?-elimination	1	4.5116206E-8
?-endorphin	15	6.767431E-7
?-estradiol	25	1.1279052E-6
?-factor	2	9.023241E-8
?-factor-free	1	4.5116206E-8
?-fibrinogen	7	3.1581345E-7
?-fodrin	1	4.5116206E-8
?-fold	1	4.5116206E-8
?-gal	16	7.218593E-7
?-galactosidase	95	4.2860397E-6
?-galatosidase	1	4.5116206E-8
?-globin	16	7.218593E-7
?-glucuronidase	12	5.4139446E-7
?-glucuronide	1	4.5116206E-8
?-glutamyl	1	4.5116206E-8
?-glutamyl-?-amino-?	1	4.5116206E-8
?-glutamyl-meso-diaminopimelate	2	9.023241E-8
?-glutamylcysteine	1	4.5116206E-8
?-glutamylcysteinylserine	1	4.5116206E-8
?-glycero-phosphate	1	4.5116206E-8
?-glycerol	2	9.023241E-8
?-glycerolphosphate	2	9.023241E-8
?-glycerophosphate	10	4.5116207E-7
?-goat	1	4.5116206E-8
?-grasp	4	1.8046482E-7
?-gustducin	19	8.572079E-7
?-hairpin	5	2.2558103E-7
?-hairpins	1	4.5116206E-8
?-helical	20	9.0232413E-7
?-helices	11	4.962783E-7
?-helix	27	1.2181375E-6
?-hemolysin	1	4.5116206E-8
?-hemolysis	8	3.6092965E-7
?-hemolytic	17	7.669755E-7
?-human	1	4.5116206E-8
?-hydroxy	4	1.8046482E-7
?-hydroxyestrone	1	4.5116206E-8
?-hydroxylase	2	9.023241E-8
?-hydroxylation	1	4.5116206E-8
?-hydroxysteroid	6	2.7069723E-7
?-independent	5	2.2558103E-7
?-induced	2	9.023241E-8
?-innervation	2	9.023241E-8
?-isopropylmalate	1	4.5116206E-8
?-isotype	1	4.5116206E-8
?-ketobutyrate	3	1.3534861E-7
?-ketoglutarate	8	3.6092965E-7
?-lactam	19	8.572079E-7
?-lactamase	9	4.0604587E-7
?-lactamases	9	4.0604587E-7
?-lactams	2	9.023241E-8
?-like	2	9.023241E-8
?-linolenic	5	2.2558103E-7
?-mannosidase	1	4.5116206E-8
?-meanders	2	9.023241E-8
?-melanocyte	1	4.5116206E-8
?-mercaptoethanol	30	1.3534863E-6
?-methyl	1	4.5116206E-8
?-mouse	1	4.5116206E-8
?-neo	1	4.5116206E-8
?-nerve	1	4.5116206E-8
?-nicotinamide	1	4.5116206E-8
?-octyl	2	9.023241E-8
?-opioid	41	1.8497644E-6
?-opioid-mediated	2	9.023241E-8
?-opioids	5	2.2558103E-7
?-oscillation	1	4.5116206E-8
?-oscillations	2	9.023241E-8
?-oxidation	10	4.5116207E-7
?-p	1	4.5116206E-8
?-pc	1	4.5116206E-8
?-phage	1	4.5116206E-8
?-phosphate	14	6.316269E-7
?-phosphates	1	4.5116206E-8
?-phosphatidyl	1	4.5116206E-8
?-phosphatidylcholine	1	4.5116206E-8
?-phosphatidylethanolamine	1	4.5116206E-8
?-phosphatidylinositol	2	9.023241E-8
?-phosphonate-group	1	4.5116206E-8
?-phosphorothioate	2	9.023241E-8
?-progesterone	1	4.5116206E-8
?-propeller	1	4.5116206E-8
?-protein	1	4.5116206E-8
?-proteobacteria	34	1.533951E-6
?-proteobacterial	3	1.3534861E-7
?-proteobacterium	5	2.2558103E-7
?-rabbit	1	4.5116206E-8
?-receptor	1	4.5116206E-8
?-reduced	1	4.5116206E-8
?-reductase	3	1.3534861E-7
?-replacement	1	4.5116206E-8
?-responsive	1	4.5116206E-8
?-rich	3	1.3534861E-7
?-sandwich	3	1.3534861E-7
?-sandwich-like	1	4.5116206E-8
?-scintillation	6	2.7069723E-7
?-secretase	30	1.3534863E-6
?-secretase-cleaved	1	4.5116206E-8
?-secretase-mediated	3	1.3534861E-7
?-secretase-type	2	9.023241E-8
?-secretases	1	4.5116206E-8
?-secretion	1	4.5116206E-8
?-selection	1	4.5116206E-8
?-sheet	13	5.865107E-7
?-sheets	2	9.023241E-8
?-signaling	1	4.5116206E-8
?-site	3	1.3534861E-7
?-sitosterol	1	4.5116206E-8
?-smooth	6	2.7069723E-7
?-specific	1	4.5116206E-8
?-squared	2	9.023241E-8
?-stimulated	5	2.2558103E-7
?-strand	4	1.8046482E-7
?-strand-?-helix	1	4.5116206E-8
?-strand-rich	3	1.3534861E-7
?-strands	18	8.1209174E-7
?-structure	3	1.3534861E-7
?-subdivision	2	9.023241E-8
?-subunit	15	6.767431E-7
?-subunits	11	4.962783E-7
?-synthase	1	4.5116206E-8
?-synuclein	32	1.4437186E-6
?-synuclein-mediated	1	4.5116206E-8
?-thalassemia	3	1.3534861E-7
?-thick	1	4.5116206E-8
?-thio	1	4.5116206E-8
?-thiophosphorylated	1	4.5116206E-8
?-thrombin	1	4.5116206E-8
?-thymosin	2	9.023241E-8
?-tocopherol	4	1.8046482E-7
?-toxin	1	4.5116206E-8
?-transducin	1	4.5116206E-8
?-trehalose	1	4.5116206E-8
?-tubulin	97	4.376272E-6
?-tubulins	1	4.5116206E-8
?-turn	2	9.023241E-8
?-type	9	4.0604587E-7
??	80	3.6092965E-6
??-ct	1	4.5116206E-8
??-dependent	1	4.5116206E-8
???	1	4.5116206E-8
???-proteobacterial	1	4.5116206E-8
?????	2	9.023241E-8
??????	1	4.5116206E-8
??c	4	1.8046482E-7
??ct	4	1.8046482E-7
??neo	1	4.5116206E-8
??pgk-neo	5	2.2558103E-7
??tcr	3	1.3534861E-7
?a	9	4.0604587E-7
?a-crystallin	1	4.5116206E-8
?aaand	1	4.5116206E-8
?abc	1	4.5116206E-8
?acbetween	1	4.5116206E-8
?acrybp	2	9.023241E-8
?actin	1	4.5116206E-8
?ade	5	2.2558103E-7
?age	1	4.5116206E-8
?ailing	1	4.5116206E-8
?amboyant	1	4.5116206E-8
?amenco	1	4.5116206E-8
?amingos	1	4.5116206E-8
?amp	1	4.5116206E-8
?ancé	3	1.3534861E-7
?and	1	4.5116206E-8
?anking	1	4.5116206E-8
?apek	2	9.023241E-8
?ar	2	9.023241E-8
?ashcards	1	4.5116206E-8
?at	2	9.023241E-8
?atoms	1	4.5116206E-8
?atter	1	4.5116206E-8
?b	22	9.925566E-7
?b-like	3	1.3534861E-7
?b?	2	9.023241E-8
?bers	2	9.023241E-8
?bgt	2	9.023241E-8
?c	20	9.0232413E-7
?can	1	4.5116206E-8
?cat	1	4.5116206E-8
?cbf	11	4.962783E-7
?ccfor	1	4.5116206E-8
?cells	1	4.5116206E-8
?chain	1	4.5116206E-8
?ci	49	2.2106942E-6
?crd	2	9.023241E-8
?ct	8	3.6092965E-7
?ction	1	4.5116206E-8
?ctional	1	4.5116206E-8
?d	3	1.3534861E-7
?dbf	1	4.5116206E-8
?dere	1	4.5116206E-8
?dg	2	9.023241E-8
?dht	1	4.5116206E-8
?di	2	9.023241E-8
?e	21	9.4744036E-7
?ea-market	2	9.023241E-8
?ed	2	9.023241E-8
?edrr	2	9.023241E-8
?eld	5	2.2558103E-7
?elding	2	9.023241E-8
?elds	1	4.5116206E-8
?erko	7	3.1581345E-7
?ew	2	9.023241E-8
?exible	5	2.2558103E-7
?exibly	1	4.5116206E-8
?extime	1	4.5116206E-8
?f	35	1.5790672E-6
?farads	1	4.5116206E-8
?fteen	1	4.5116206E-8
?g	1680	7.579523E-5
?g-?h	1	4.5116206E-8
?gdna	1	4.5116206E-8
?geo	2	9.023241E-8
?ghting	1	4.5116206E-8
?ghts	1	4.5116206E-8
?glucan	1	4.5116206E-8
?gs	1	4.5116206E-8
?gt	4	1.8046482E-7
?gure	5	2.2558103E-7
?gureheads	1	4.5116206E-8
?gures	7	3.1581345E-7
?h	4	1.8046482E-7
?i	7	3.1581345E-7
?in	1	4.5116206E-8
?ir	5	2.2558103E-7
?itted	1	4.5116206E-8
?j	10	4.5116207E-7
?ja	8	3.6092965E-7
?k	2	9.023241E-8
?l	1369	6.176408E-5
?lac	1	4.5116206E-8
?lacz	5	2.2558103E-7
?lc	1	4.5116206E-8
?lh	14	6.316269E-7
?ll	3	1.3534861E-7
?llb?	1	4.5116206E-8
?lled	6	2.7069723E-7
?lling	2	9.023241E-8
?lls	1	4.5116206E-8
?log	1	4.5116206E-8
?loxpneo	5	2.2558103E-7
?loxpneo-tk	1	4.5116206E-8
?lrr	2	9.023241E-8
?lter	1	4.5116206E-8
?lw	10	4.5116207E-7
?lz	5	2.2558103E-7
?m	1407	6.34785E-5
?m-filtered	1	4.5116206E-8
?m-thick	1	4.5116206E-8
?mhc	4	1.8046482E-7
?mhc-lacz	2	9.023241E-8
?mhclacz	2	9.023241E-8
?mol	40	1.8046483E-6
?mole	4	1.8046482E-7
?moles	2	9.023241E-8
?most	1	4.5116206E-8
?mtv-ir-cat	2	9.023241E-8
?n	52	2.3460427E-6
?n-de-siècle	1	4.5116206E-8
?n-snip	1	4.5116206E-8
?nal	5	2.2558103E-7
?nally	10	4.5116207E-7
?nancial	4	1.8046482E-7
?nancially	2	9.023241E-8
?nd	44	1.9851132E-6
?nding	7	3.1581345E-7
?ndings	13	5.865107E-7
?nds	2	9.023241E-8
?ne	15	6.767431E-7
?ne-tuned	1	4.5116206E-8
?nest	10	4.5116207E-7
?nger	2	9.023241E-8
?nish	3	1.3534861E-7
?nished	4	1.8046482E-7
?nishing	2	9.023241E-8
?nls-far	1	4.5116206E-8
?od	1	4.5116206E-8
?ogg	2	9.023241E-8
?ood	1	4.5116206E-8
?oodlit	1	4.5116206E-8
?oor	4	1.8046482E-7
?oorshows	1	4.5116206E-8
?or	2	9.023241E-8
?orf	1	4.5116206E-8
?oundering	1	4.5116206E-8
?ourish	1	4.5116206E-8
?ourished	2	9.023241E-8
?ourishes	2	9.023241E-8
?ow	1	4.5116206E-8
?owers	2	9.023241E-8
?ows	1	4.5116206E-8
?p	4	1.8046482E-7
?pd	2	9.023241E-8
?pgk	1	4.5116206E-8
?pk	2	9.023241E-8
?pop	4	1.8046482E-7
?pre	18	8.1209174E-7
?pv	1	4.5116206E-8
?q	1	4.5116206E-8
?r	3	1.3534861E-7
?rare	3	1.3534861E-7
?rare-tk-luc	1	4.5116206E-8
?re	3	1.3534861E-7
?ring	1	4.5116206E-8
?ringwas	1	4.5116206E-8
?rm	9	4.0604587E-7
?rmly	4	1.8046482E-7
?rmness	1	4.5116206E-8
?routine	2	9.023241E-8
?rst	78	3.5190642E-6
?rst-borns	1	4.5116206E-8
?rst-class	2	9.023241E-8
?rst-grade	1	4.5116206E-8
?rst-time	1	4.5116206E-8
?rstborn	1	4.5116206E-8
?rsthand	1	4.5116206E-8
?s	15	6.767431E-7
?s?	2	9.023241E-8
?sec	3	1.3534861E-7
?self-preservation-minded	1	4.5116206E-8
?sh	4	1.8046482E-7
?shermen	1	4.5116206E-8
?shes	1	4.5116206E-8
?shing	3	1.3534861E-7
?sini-?pwäwa	1	4.5116206E-8
?sland	1	4.5116206E-8
?slt	1	4.5116206E-8
?t	12	5.4139446E-7
?tpr	1	4.5116206E-8
?tpr-pfpp	7	3.1581345E-7
?trcp	1	4.5116206E-8
?triplex	3	1.3534861E-7
?ts	2	9.023241E-8
?u	4	1.8046482E-7
?uctuated	1	4.5116206E-8
?v	1	4.5116206E-8
?v?	7	3.1581345E-7
?ve	2	9.023241E-8
?x	1	4.5116206E-8
?xed	2	9.023241E-8
?xing	1	4.5116206E-8
?xj	2	9.023241E-8
?y	5	2.2558103E-7
?ying	1	4.5116206E-8
?yj	4	1.8046482E-7
?yover	2	9.023241E-8
?í?o?	1	4.5116206E-8
a	492669	0.022227356
a-a	3	1.3534861E-7
a-a-c	9	4.0604587E-7
a-abaker	1	4.5116206E-8
a-adrenoceptor	1	4.5116206E-8
a-alternate	1	4.5116206E-8
a-ank-fgf	1	4.5116206E-8
a-atp	24	1.0827889E-6
a-b	16	7.218593E-7
a-b-b-bye-bye	1	4.5116206E-8
a-b-c	5	2.2558103E-7
a-b-c-d	1	4.5116206E-8
a-b-x-y	1	4.5116206E-8
a-babble	1	4.5116206E-8
a-barrel	1	4.5116206E-8
a-bed	1	4.5116206E-8
a-bigger	1	4.5116206E-8
a-brewin	2	9.023241E-8
a-brewing	1	4.5116206E-8
a-bustin	1	4.5116206E-8
a-c	21	9.4744036E-7
a-c-c	9	4.0604587E-7
a-c-p	5	2.2558103E-7
a-c-t	1	4.5116206E-8
a-c-t-h	7	3.1581345E-7
a-callin	1	4.5116206E-8
a-calling	1	4.5116206E-8
a-cand	1	4.5116206E-8
a-cappella	1	4.5116206E-8
a-changin	1	4.5116206E-8
a-child	2	9.023241E-8
a-cockbill	1	4.5116206E-8
a-comin	1	4.5116206E-8
a-cut	1	4.5116206E-8
a-d	16	7.218593E-7
a-d-d	1	4.5116206E-8
a-d-h	1	4.5116206E-8
a-d-p	8	3.6092965E-7
a-day	2	9.023241E-8
a-derived	2	9.023241E-8
a-diaza-s-indacine	1	4.5116206E-8
a-dna	3	1.3534861E-7
a-duplicate	1	4.5116206E-8
a-e	5	2.2558103E-7
a-f	6	2.7069723E-7
a-f-s	1	4.5116206E-8
a-factor	1	4.5116206E-8
a-feared	1	4.5116206E-8
a-flutter	1	4.5116206E-8
a-g	5	2.2558103E-7
a-general	1	4.5116206E-8
a-glimmering	1	4.5116206E-8
a-gonna	2	9.023241E-8
a-got	1	4.5116206E-8
a-gvhd	53	2.391159E-6
a-h	10	4.5116207E-7
a-ha	2	9.023241E-8
a-hehm	1	4.5116206E-8
a-hem	2	9.023241E-8
a-ho	1	4.5116206E-8
a-hp	1	4.5116206E-8
a-i	3	1.3534861E-7
a-join-ed	1	4.5116206E-8
a-k	1	4.5116206E-8
a-kan	1	4.5116206E-8
a-l	5	2.2558103E-7
a-l-b	1	4.5116206E-8
a-l-s	1	4.5116206E-8
a-leaping	1	4.5116206E-8
a-line	2	9.023241E-8
a-list	3	1.3534861E-7
a-loo-min-um-foil	1	4.5116206E-8
a-love	1	4.5116206E-8
a-lovin	1	4.5116206E-8
a-lu-min-i-um	1	4.5116206E-8
a-lying	1	4.5116206E-8
a-m	12	5.4139446E-7
a-m-a	1	4.5116206E-8
a-mazing	1	4.5116206E-8
a-me	1	4.5116206E-8
a-million-to-one	1	4.5116206E-8
a-minus	1	4.5116206E-8
a-month	4	1.8046482E-7
a-month-for-domestic-help	1	4.5116206E-8
a-more	1	4.5116206E-8
a-myc	6	2.7069723E-7
a-n	6	2.7069723E-7
a-n-a	1	4.5116206E-8
a-n-p	1	4.5116206E-8
a-night	5	2.2558103E-7
a-not	2	9.023241E-8
a-nt	2	9.023241E-8
a-ny	106	4.782318E-6
a-ok	8	3.6092965E-7
a-p	35	1.5790672E-6
a-p-a	3	1.3534861E-7
a-person	2	9.023241E-8
a-phorbol	2	9.023241E-8
a-pinin	1	4.5116206E-8
a-plate	5	2.2558103E-7
a-plinkin	1	4.5116206E-8
a-r	5	2.2558103E-7
a-r-b-d	1	4.5116206E-8
a-r-i	2	9.023241E-8
a-rattling	1	4.5116206E-8
a-really-bad-cold-where-you-say-it	1	4.5116206E-8
a-religiousness	1	4.5116206E-8
a-rockin	1	4.5116206E-8
a-rod-style	1	4.5116206E-8
a-rollin	1	4.5116206E-8
a-s	17	7.669755E-7
a-s-d	2	9.023241E-8
a-s-i-m-o-v	1	4.5116206E-8
a-share	1	4.5116206E-8
a-side	5	2.2558103E-7
a-swabbin	1	4.5116206E-8
a-t	8	3.6092965E-7
a-t-p	45	2.0302293E-6
a-team	1	4.5116206E-8
a-ticking	1	4.5116206E-8
a-titter	1	4.5116206E-8
a-turning	1	4.5116206E-8
a-typical	1	4.5116206E-8
a-u	2	9.023241E-8
a-v	1	4.5116206E-8
a-w	1	4.5116206E-8
a-wailing	1	4.5116206E-8
a-way	1	4.5116206E-8
a-week	2	9.023241E-8
a-well	1	4.5116206E-8
a-workin	1	4.5116206E-8
a-wt	1	4.5116206E-8
a-y	4	1.8046482E-7
a-yard	1	4.5116206E-8
a-yeah	1	4.5116206E-8
a-year	11	4.962783E-7
a-yup	1	4.5116206E-8
a-z	14	6.316269E-7
a-z-t	3	1.3534861E-7
a?	23	1.0376727E-6
a?eld	1	4.5116206E-8
aa	442	1.9941363E-5
aa-amino	1	4.5116206E-8
aa-binding	6	2.7069723E-7
aa-d	3	1.3534861E-7
aa-enriched	1	4.5116206E-8
aa-raxpé-ahu	1	4.5116206E-8
aa-rich	1	4.5116206E-8
aa-tttt	2	9.023241E-8
aaa	187	8.43673E-6
aaa-domain	3	1.3534861E-7
aaaa	2	9.023241E-8
aaaaa	2	9.023241E-8
aaaaaa	3	1.3534861E-7
aaaaaaa	1	4.5116206E-8
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa	1	4.5116206E-8
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaah	1	4.5116206E-8
aaaaaaaaaaare	1	4.5116206E-8
aaaaaaaagh	1	4.5116206E-8
aaaaaaaahahahahahahaha	1	4.5116206E-8
aaaaaaaccent	2	9.023241E-8
aaaaaaadddaaammmmmm	1	4.5116206E-8
aaaaaaagh	1	4.5116206E-8
aaaaaaahh	1	4.5116206E-8
aaaaaaand	1	4.5116206E-8
aaaaaagh	2	9.023241E-8
aaaaaah	3	1.3534861E-7
aaaaaahhh	1	4.5116206E-8
aaaaaannnnnd	1	4.5116206E-8
aaaaaarrrrrgh	1	4.5116206E-8
aaaaaggghhh	1	4.5116206E-8
aaaaaghhh	1	4.5116206E-8
aaaaahhh	1	4.5116206E-8
aaaaahhhhhh	1	4.5116206E-8
aaaaand	1	4.5116206E-8
aaaaargh	1	4.5116206E-8
aaaaauuughhh	1	4.5116206E-8
aaaaaw	1	4.5116206E-8
aaaacacaacgaaacctg	1	4.5116206E-8
aaaaccccaaaa	1	4.5116206E-8
aaaach	1	4.5116206E-8
aaaack	1	4.5116206E-8
aaaactgcagcggccgccaccatgcaccac-caccacaccaccaccacgtgagcaagggcgaggagctgttcaccg	1	4.5116206E-8
aaaagaaaaaa	1	4.5116206E-8
aaaagataaag	1	4.5116206E-8
aaaagcggccgcgagtggggggcggcggcc	1	4.5116206E-8
aaaagcttcttgaaaggagacttctgt	1	4.5116206E-8
aaaaggtgggcctgaggttca	1	4.5116206E-8
aaaagh	3	1.3534861E-7
aaaagtcgacgcgcccagcagcgagaccgc	1	4.5116206E-8
aaaah	3	1.3534861E-7
aaaahh	1	4.5116206E-8
aaaahhh	1	4.5116206E-8
aaaan-ist	2	9.023241E-8
aaaand	2	9.023241E-8
aaaargghhh	1	4.5116206E-8
aaaargh	2	9.023241E-8
aaaarrgh	1	4.5116206E-8
aaaarrrrrggghhhhh	1	4.5116206E-8
aaaawwww	1	4.5116206E-8
aaaawwwwww	1	4.5116206E-8
aaab	2	9.023241E-8
aaabs	1	4.5116206E-8
aaacaggattttcgcctgctggg	2	9.023241E-8
aaaccatctcactcgcatga	1	4.5116206E-8
aaaccent	1	4.5116206E-8
aaacgacggccagtgaattgtaatacgactcactataggcgc	1	4.5116206E-8
aaacgacggccagtgaattgtaatacgactcactataggg	1	4.5116206E-8
aaactgtacttgttatcaggat	1	4.5116206E-8
aaactgtgg	1	4.5116206E-8
aaag	1	4.5116206E-8
aaaggaccccacgaagtgtt	1	4.5116206E-8
aaagh	2	9.023241E-8
aaah	2	9.023241E-8
aaahh	1	4.5116206E-8
aaahhhh	1	4.5116206E-8
aaahing	1	4.5116206E-8
aaaieeeooh	1	4.5116206E-8
aaaieeeoooh	1	4.5116206E-8
aaaiiggghhh	1	4.5116206E-8
aaaiiiieeeee	1	4.5116206E-8
aaalac	1	4.5116206E-8
aaand	2	9.023241E-8
aaargh	9	4.0604587E-7
aaarrgghhh	1	4.5116206E-8
aaarrgh	1	4.5116206E-8
aaarrrggghhh	1	4.5116206E-8
aaarrrrrgggggghhhhh	1	4.5116206E-8
aaat	2	9.023241E-8
aaataaat	1	4.5116206E-8
aaatctcaat	1	4.5116206E-8
aaatgcagttgttactgtccctg	1	4.5116206E-8
aaatgcatctgcgagggc	1	4.5116206E-8
aaawwwww	1	4.5116206E-8
aab	3	1.3534861E-7
aabb	7	3.1581345E-7
aac	42	1.8948807E-6
aaca	4	1.8046482E-7
aacacagtgagacgctgtct	1	4.5116206E-8
aacc	3	1.3534861E-7
aaccaa	1	4.5116206E-8
aaccatgcaggtacagtc	1	4.5116206E-8
aacccacatgttcacggcgga	1	4.5116206E-8
aacctcctct	1	4.5116206E-8
aacctctccattcagc	1	4.5116206E-8
aacgggaagcccatcacc	1	4.5116206E-8
aachen	7	3.1581345E-7
aack	1	4.5116206E-8
aactagatgtagaagtcgttcatggattc	1	4.5116206E-8
aad	13	5.865107E-7
aadntp	1	4.5116206E-8
aadutp	2	9.023241E-8
aae	1	4.5116206E-8
aaf	5	2.2558103E-7
aafp	1	4.5116206E-8
aag	15	6.767431E-7
aag-gtggtaaaccagggggatc	1	4.5116206E-8
aagaattcaaactggggcct	1	4.5116206E-8
aagagtagctgctcaccgtgtacaag	1	4.5116206E-8
aagcagtggtaacaacgc	1	4.5116206E-8
aagcagtggtaacaacgcagagtacgcggg	1	4.5116206E-8
aagcagtggtatcaacgcagagtacgcggg	1	4.5116206E-8
aagccctctgaacagtgtcccatcccaagt	1	4.5116206E-8
aagccgggaaggatctgtat	1	4.5116206E-8
aagcctgaccacgctttcta	1	4.5116206E-8
aagctt	1	4.5116206E-8
aagg	1	4.5116206E-8
aaggagtgcggggaggag	1	4.5116206E-8
aaggghhh	1	4.5116206E-8
aaggtcaaaattcaacagctgcttgtacagctcgtccatgcc	1	4.5116206E-8
aaggtcaaaattcaacagctgggtgggtgctaatcctaatggttc	1	4.5116206E-8
aaggtgcggagcaaaat	1	4.5116206E-8
aagh	1	4.5116206E-8
aah	7	3.1581345E-7
aahed	5	2.2558103E-7
aahh	1	4.5116206E-8
aahing	2	9.023241E-8
aahp	14	6.316269E-7
aahs	2	9.023241E-8
aaib	1	4.5116206E-8
aaiii	2	9.023241E-8
aair	3	1.3534861E-7
aairs	1	4.5116206E-8
aak	2	9.023241E-8
aake	1	4.5116206E-8
aakp	2	9.023241E-8
aal	58	2.61674E-6
aal-american	1	4.5116206E-8
aala	1	4.5116206E-8
aalborg	1	4.5116206E-8
aalikum	1	4.5116206E-8
aaliyah	4	1.8046482E-7
aalso	1	4.5116206E-8
aalto	5	2.2558103E-7
aam	2	9.023241E-8
aamco	1	4.5116206E-8
aames	1	4.5116206E-8
aand	150	6.767431E-6
aap	12	5.4139446E-7
aapf-p-nitroanilide	1	4.5116206E-8
aapf-pna	3	1.3534861E-7
aapfakkk	1	4.5116206E-8
aaps	3	1.3534861E-7
aard	1	4.5116206E-8
aardvark	4	1.8046482E-7
aardvarken	1	4.5116206E-8
aardvarks	1	4.5116206E-8
aare	2	9.023241E-8
aarg	1	4.5116206E-8
aargh	10	4.5116207E-7
aarikkaa	1	4.5116206E-8
aaron	178	8.0306845E-6
aaronetta	2	9.023241E-8
aaronic	1	4.5116206E-8
aaronj	1	4.5116206E-8
aaronson	4	1.8046482E-7
aarp	47	2.1204617E-6
aarparific	1	4.5116206E-8
aarrrrrggghhhh	1	4.5116206E-8
aars	4	1.8046482E-7
aarss	4	1.8046482E-7
aas	6	2.7069723E-7
aasa	1	4.5116206E-8
aasland	3	1.3534861E-7
aassumes	1	4.5116206E-8
aat	30	1.3534863E-6
aataaa	1	4.5116206E-8
aataacctccaaattgacctg	1	4.5116206E-8
aatctgcagctatgaaatccc	1	4.5116206E-8
aatctttcatagttcatgcgtt	1	4.5116206E-8
aatgaagcggagttcccaaagc	1	4.5116206E-8
aatgaccaattatatgaatcaattatctg	1	4.5116206E-8
aatgggcagaggtataaagataagga	1	4.5116206E-8
aattaaaccatccaatgaaatagagc	1	4.5116206E-8
aattcagtgaactggccacc	1	4.5116206E-8
aattcatgctatgatgatgatgatgatggctac	1	4.5116206E-8
aattctgacaatcgacgccag	1	4.5116206E-8
aattctggagcttctggatccaagaatggaatcaaagttaag	1	4.5116206E-8
aatttatatggaatgctacgatt	1	4.5116206E-8
aau	3	1.3534861E-7
aauaaa	2	9.023241E-8
aaucmb	3	1.3534861E-7
aaup	4	1.8046482E-7
aava	2	9.023241E-8
aave	4	1.8046482E-7
aaw	2	9.023241E-8
aawww	1	4.5116206E-8
ab	253	1.14144E-5
ab-boin-ug	1	4.5116206E-8
ab-dependent	1	4.5116206E-8
ab-initio	1	4.5116206E-8
aba	59	2.6618561E-6
aba-mediated	1	4.5116206E-8
aba-nlada	1	4.5116206E-8
aba-response	1	4.5116206E-8
abaa	1	4.5116206E-8
ababa	1	4.5116206E-8
ababb	1	4.5116206E-8
abac	1	4.5116206E-8
abacavir	4	1.8046482E-7
abacha	11	4.962783E-7
aback	26	1.1730214E-6
abaco	9	4.0604587E-7
abaconians	1	4.5116206E-8
abacos	10	4.5116207E-7
abacus	11	4.962783E-7
abacuses	2	9.023241E-8
abad	4	1.8046482E-7
abade	1	4.5116206E-8
abadie	1	4.5116206E-8
abado	1	4.5116206E-8
abaft	1	4.5116206E-8
abagyan	3	1.3534861E-7
abajo	2	9.023241E-8
abalon	1	4.5116206E-8
abalone	11	4.962783E-7
aban	1	4.5116206E-8
abandandoned	1	4.5116206E-8
abandon	234	1.0557193E-5
abandoned	494	2.2287406E-5
abandoned-including	1	4.5116206E-8
abandoner	1	4.5116206E-8
abandonimg	1	4.5116206E-8
abandoning	116	5.23348E-6
abandonment	48	2.1655778E-6
abandons	16	7.218593E-7
abang	8	3.6092965E-7
abangales	1	4.5116206E-8
abanic	1	4.5116206E-8
abanus	1	4.5116206E-8
abarca	1	4.5116206E-8
abarcas	2	9.023241E-8
abarinov	1	4.5116206E-8
abarnard	1	4.5116206E-8
abas	1	4.5116206E-8
abase	1	4.5116206E-8
abashed	10	4.5116207E-7
abashment	1	4.5116206E-8
abasic	19	8.572079E-7
abate	18	8.1209174E-7
abated	16	7.218593E-7
abatement	10	4.5116207E-7
abating	7	3.1581345E-7
abattoir	4	1.8046482E-7
abaxial	1	4.5116206E-8
abb	17	7.669755E-7
abba	6	2.7069723E-7
abbaddaba	1	4.5116206E-8
abbado	2	9.023241E-8
abbas	7	3.1581345E-7
abbasid	1	4.5116206E-8
abbasiya	2	9.023241E-8
abbass	2	9.023241E-8
abbate	5	2.2558103E-7
abbatiale	2	9.023241E-8
abbaye	4	1.8046482E-7
abbayedefontenay	1	4.5116206E-8
abbayes	1	4.5116206E-8
abbdominal	1	4.5116206E-8
abbe	4	1.8046482E-7
abbella	1	4.5116206E-8
abberation	1	4.5116206E-8
abbess	2	9.023241E-8
abbesses	3	1.3534861E-7
abbeville	2	9.023241E-8
abbey	129	5.8199907E-6
abbeys	7	3.1581345E-7
abbie	9	4.0604587E-7
abbondanza	2	9.023241E-8
abbot	43	1.939997E-6
abbots	2	9.023241E-8
abbott	57	2.5716238E-6
abbotts	4	1.8046482E-7
abboud	4	1.8046482E-7
abboy	1	4.5116206E-8
abbr	2	9.023241E-8
abbreivations	1	4.5116206E-8
abbrev	6	2.7069723E-7
abbreviate	12	5.4139446E-7
abbreviated	60	2.7069725E-6
abbreviates	1	4.5116206E-8
abbreviating	4	1.8046482E-7
abbreviation	55	2.4813914E-6
abbreviations	302	1.3625095E-5
abbreviaturis	1	4.5116206E-8
abbreviatus	1	4.5116206E-8
abbrevs	1	4.5116206E-8
abbuehl	1	4.5116206E-8
abby	75	3.3837155E-6
abc	685	3.09046E-5
abc-dab	1	4.5116206E-8
abc-horseradish	1	4.5116206E-8
abc-hrp	1	4.5116206E-8
abc-kit	1	4.5116206E-8
abc-paramount	1	4.5116206E-8
abc-tv	7	3.1581345E-7
abca	7	3.1581345E-7
abcb	2	9.023241E-8
abcd	6	2.7069723E-7
abcdefghijklmnopqrstuvwxyz	1	4.5116206E-8
abce	3	1.3534861E-7
abcfamily	1	4.5116206E-8
abcg	86	3.879994E-6
abcissa	1	4.5116206E-8
abcnews	7	3.1581345E-7
abcs	11	4.962783E-7
abd	20	9.0232413E-7
abd-er	3	1.3534861E-7
abdalla	6	2.7069723E-7
abdallah	10	4.5116207E-7
abdalrahman	1	4.5116206E-8
abdel	47	2.1204617E-6
abdelamir	1	4.5116206E-8
abdelaziz	2	9.023241E-8
abdelbari	3	1.3534861E-7
abdelghani	14	6.316269E-7
abdeljaber	12	5.4139446E-7
abdelkader	1	4.5116206E-8
abdellatif	1	4.5116206E-8
abdelmajed	1	4.5116206E-8
abdelwahhab	1	4.5116206E-8
abdera	1	4.5116206E-8
abderrahman	2	9.023241E-8
abderraman	1	4.5116206E-8
abderraouf	4	1.8046482E-7
abdessalem	2	9.023241E-8
abdf	3	1.3534861E-7
abdi	14	6.316269E-7
abdia	2	9.023241E-8
abdicate	10	4.5116207E-7
abdicated	11	4.962783E-7
abdicating	3	1.3534861E-7
abdication	21	9.4744036E-7
abdications	1	4.5116206E-8
abdil	2	9.023241E-8
abdnr	1	4.5116206E-8
abdnu	1	4.5116206E-8
abdoh	4	1.8046482E-7
abdolghassem	3	1.3534861E-7
abdomen	38	1.7144158E-6
abdomen-crush	1	4.5116206E-8
abdomens	2	9.023241E-8
abdominal	124	5.5944097E-6
abdominals	4	1.8046482E-7
abdominis	2	9.023241E-8
abdoulaye	1	4.5116206E-8
abdoun	3	1.3534861E-7
abducens	5	2.2558103E-7
abduct	5	2.2558103E-7
abducted	50	2.2558104E-6
abductee	1	4.5116206E-8
abductees	2	9.023241E-8
abducting	4	1.8046482E-7
abduction	41	1.8497644E-6
abduction-molestation-murder	1	4.5116206E-8
abductions	45	2.0302293E-6
abductor	4	1.8046482E-7
abductors	2	9.023241E-8
abducts	1	4.5116206E-8
abdul	102	4.601853E-6
abdulaziz	3	1.3534861E-7
abdulla	3	1.3534861E-7
abdullah	208	9.384171E-6
abdullah-recalled	1	4.5116206E-8
abdulmuttaleb	1	4.5116206E-8
abdulrab	1	4.5116206E-8
abdulsalam	2	9.023241E-8
abdur	1	4.5116206E-8
abdurraham	1	4.5116206E-8
abdurrahman	7	3.1581345E-7
abdál	1	4.5116206E-8
abdül	8	3.6092965E-7
abe	60	2.7069725E-6
abeam	1	4.5116206E-8
abeautiful	1	4.5116206E-8
abebe	1	4.5116206E-8
abecedarium	4	1.8046482E-7
abecedarius	2	9.023241E-8
abed	4	1.8046482E-7
abedi	2	9.023241E-8
abednego	4	1.8046482E-7
abeer	2	9.023241E-8
abel	31	1.3986024E-6
abelard	1	4.5116206E-8
abele	2	9.023241E-8
abeline	1	4.5116206E-8
abell	1	4.5116206E-8
abelmoschus	1	4.5116206E-8
abelson	20	9.0232413E-7
abelsonprofessor	1	4.5116206E-8
abencerrajes	2	9.023241E-8
abend	1	4.5116206E-8
abendgarderobe	3	1.3534861E-7
aberamenthooulerthexanaxethreluoothnemareba	1	4.5116206E-8
abercombie	1	4.5116206E-8
abercrombie	25	1.1279052E-6
abercromby	3	1.3534861E-7
aberdeen	22	9.925566E-7
aberdonians	1	4.5116206E-8
aberg	1	4.5116206E-8
aberlour	7	3.1581345E-7
abernathy	9	4.0604587E-7
aberrancies	11	4.962783E-7
aberrancy	3	1.3534861E-7
aberrant	112	5.0530152E-6
aberrantly	14	6.316269E-7
aberration	19	8.572079E-7
aberrational	3	1.3534861E-7
aberrations	28	1.2632538E-6
abert	1	4.5116206E-8
abet	6	2.7069723E-7
abets	1	4.5116206E-8
abetted	16	7.218593E-7
abetter	1	4.5116206E-8
abetting	14	6.316269E-7
abettor	1	4.5116206E-8
abeyance	1	4.5116206E-8
abf	2	9.023241E-8
abfab	3	1.3534861E-7
abg	1	4.5116206E-8
abgene	3	1.3534861E-7
abh	1	4.5116206E-8
abhominable	1	4.5116206E-8
abhor	11	4.962783E-7
abhorred	7	3.1581345E-7
abhorrence	4	1.8046482E-7
abhorrent	7	3.1581345E-7
abhors	11	4.962783E-7
abi	127	5.7297584E-6
abi-prism	2	9.023241E-8
abia	1	4.5116206E-8
abiankapas	1	4.5116206E-8
abicada	1	4.5116206E-8
abid	1	4.5116206E-8
abide	58	2.61674E-6
abide-and	1	4.5116206E-8
abided	5	2.2558103E-7
abides	2	9.023241E-8
abidin	1	4.5116206E-8
abiding	38	1.7144158E-6
abidjan	2	9.023241E-8
abie	1	4.5116206E-8
abierto	1	4.5116206E-8
abies	3	1.3534861E-7
abig	2	9.023241E-8
abigail	36	1.6241835E-6
abigale	1	4.5116206E-8
abil	1	4.5116206E-8
abilene	38	1.7144158E-6
abilites	1	4.5116206E-8
abilities	188	8.481847E-6
ability	2506	1.13061215E-4
ability-to-make-fire-in-rain	1	4.5116206E-8
abilityto	1	4.5116206E-8
abim	1	4.5116206E-8
abingdon	4	1.8046482E-7
abiola	9	4.0604587E-7
abiotic	27	1.2181375E-6
abiotically	1	4.5116206E-8
abiquiu	1	4.5116206E-8
abir	8	3.6092965E-7
abirdsworld	1	4.5116206E-8
abisco	1	4.5116206E-8
abish	1	4.5116206E-8
abisynth	1	4.5116206E-8
abit	2	9.023241E-8
abita	2	9.023241E-8
abitation	2	9.023241E-8
abitur	1	4.5116206E-8
abj	1	4.5116206E-8
abject	31	1.3986024E-6
abjected	1	4.5116206E-8
abjection	3	1.3534861E-7
abjectly	7	3.1581345E-7
abjectness	1	4.5116206E-8
abjure	5	2.2558103E-7
abjured	1	4.5116206E-8
abjures	2	9.023241E-8
abjuring	1	4.5116206E-8
abkhazia	3	1.3534861E-7
abl	32	1.4437186E-6
abladen	1	4.5116206E-8
ablaqueate	2	9.023241E-8
ablasion	1	4.5116206E-8
ablata	1	4.5116206E-8
ablatable	1	4.5116206E-8
ablate	6	2.7069723E-7
ablated	19	8.572079E-7
ablates	2	9.023241E-8
ablating	3	1.3534861E-7
ablation	71	3.2032506E-6
ablations	3	1.3534861E-7
ablative	5	2.2558103E-7
ablaze	18	8.1209174E-7
able	5672	2.5589913E-4
able-bodied	12	5.4139446E-7
abled	1	4.5116206E-8
ableto	2	9.023241E-8
ablidged	1	4.5116206E-8
ablities	1	4.5116206E-8
abloom	1	4.5116206E-8
abluminal	5	2.2558103E-7
abluted	1	4.5116206E-8
ablution	2	9.023241E-8
ablutions	7	3.1581345E-7
ably	13	5.865107E-7
abm	14	6.316269E-7
abn	1	4.5116206E-8
abnaki	2	9.023241E-8
abnegation	2	9.023241E-8
abner	22	9.925566E-7
abnor	1	4.5116206E-8
abnormal	291	1.3128816E-5
abnormalities	236	1.06474245E-5
abnormality	66	2.9776697E-6
abnormally	33	1.4888349E-6
abnormals	1	4.5116206E-8
abnr	2	9.023241E-8
abo	7	3.1581345E-7
aboard	208	9.384171E-6
aboc	1	4.5116206E-8
abode	11	4.962783E-7
abodes	1	4.5116206E-8
abodiement	1	4.5116206E-8
abogadillo	1	4.5116206E-8
abogado	1	4.5116206E-8
abol	1	4.5116206E-8
abolish	69	3.1130182E-6
abolished	126	5.684642E-6
abolishes	11	4.962783E-7
abolishing	41	1.8497644E-6
abolition	52	2.3460427E-6
abolition-of-function	1	4.5116206E-8
abolitionism	2	9.023241E-8
abolitionist	13	5.865107E-7
abolitionists	11	4.962783E-7
abomelic	1	4.5116206E-8
abominable	12	5.4139446E-7
abominably	2	9.023241E-8
abominated	1	4.5116206E-8
abomination	25	1.1279052E-6
abominations	5	2.2558103E-7
abominationvegetable	1	4.5116206E-8
abominosus	1	4.5116206E-8
abonuses	1	4.5116206E-8
aboot	1	4.5116206E-8
abootty	2	9.023241E-8
abooty	1	4.5116206E-8
abor	1	4.5116206E-8
aboriginal	61	2.7520887E-6
aborigine	5	2.2558103E-7
aborigines	30	1.3534863E-6
aborigén	1	4.5116206E-8
abort	17	7.669755E-7
aborted	28	1.2632538E-6
abortifacent	1	4.5116206E-8
abortifacents	1	4.5116206E-8
abortifacient	2	9.023241E-8
aborting	7	3.1581345E-7
abortion	687	3.0994834E-5
abortion-abetting	1	4.5116206E-8
abortion-clinic	3	1.3534861E-7
abortion-free	1	4.5116206E-8
abortion-neutral	1	4.5116206E-8
abortion-related	5	2.2558103E-7
abortion-reporting	1	4.5116206E-8
abortion-rights	17	7.669755E-7
abortionist	4	1.8046482E-7
abortionists	4	1.8046482E-7
abortions	158	7.1283607E-6
abortive	31	1.3986024E-6
aborto	1	4.5116206E-8
aborts	1	4.5116206E-8
abortus	35	1.5790672E-6
abortuses	1	4.5116206E-8
abortusvaccine	1	4.5116206E-8
aborville	1	4.5116206E-8
abot	2	9.023241E-8
abotu	3	1.3534861E-7
abou	7	3.1581345E-7
abouhalima	4	1.8046482E-7
aboukir	1	4.5116206E-8
abound	100	4.511621E-6
abounded	9	4.0604587E-7
aboundeth	1	4.5116206E-8
abounding	1	4.5116206E-8
abounds	25	1.1279052E-6
about	59310	0.0026758423
about-face	18	8.1209174E-7
about-to-be	2	9.023241E-8
about-to-be-announced	2	9.023241E-8
about-to-be-born	2	9.023241E-8
about-to-be-created	1	4.5116206E-8
about-to-be-published	2	9.023241E-8
about-to-be-released	1	4.5116206E-8
about-to-be-resuscitated	1	4.5116206E-8
about-town	1	4.5116206E-8
abouts	6	2.7069723E-7
aboutthem	1	4.5116206E-8
abouttheportauthority	1	4.5116206E-8
above	3936	1.7757739E-4
above-average	9	4.0604587E-7
above-defined	1	4.5116206E-8
above-described	4	1.8046482E-7
above-detected	1	4.5116206E-8
above-discussed	1	4.5116206E-8
above-ground	5	2.2558103E-7
above-has	1	4.5116206E-8
above-hurdle	1	4.5116206E-8
above-it-all	2	9.023241E-8
above-listed	2	9.023241E-8
above-market	1	4.5116206E-8
above-mentioned	16	7.218593E-7
above-named	1	4.5116206E-8
above-noted	1	4.5116206E-8
above-politics	1	4.5116206E-8
above-the-eyebrow	1	4.5116206E-8
above-the-fold	26	1.1730214E-6
above-the-fray	2	9.023241E-8
above-the-knee	2	9.023241E-8
above-the-title	1	4.5116206E-8
above-threshold	2	9.023241E-8
aboveboard	5	2.2558103E-7
abovedescribed	1	4.5116206E-8
aboveground	2	9.023241E-8
abovementioned	1	4.5116206E-8
abox	1	4.5116206E-8
abp	35	1.5790672E-6
abp-containing	1	4.5116206E-8
abp-tg	37	1.6692996E-6
abpnn	1	4.5116206E-8
abr	1	4.5116206E-8
abra	13	5.865107E-7
abracadabra	3	1.3534861E-7
abrading	1	4.5116206E-8
abraham	138	6.2260365E-6
abrahamowicz	1	4.5116206E-8
abrahams	5	2.2558103E-7
abrahamsen	1	4.5116206E-8
abrahms	1	4.5116206E-8
abrain	1	4.5116206E-8
abram	1	4.5116206E-8
abramovic	1	4.5116206E-8
abramovich	1	4.5116206E-8
abramovitz	2	9.023241E-8
abramowitz	4	1.8046482E-7
abrams	63	2.842321E-6
abramson	5	2.2558103E-7
abrans	1	4.5116206E-8
abrant	1	4.5116206E-8
abrantes	1	4.5116206E-8
abrase	1	4.5116206E-8
abrash	2	9.023241E-8
abrasion	7	3.1581345E-7
abrasion-themed	1	4.5116206E-8
abrasions	6	2.7069723E-7
abrasive	26	1.1730214E-6
abrazo	1	4.5116206E-8
abre	3	1.3534861E-7
abre-like	1	4.5116206E-8
abreaction	1	4.5116206E-8
abreast	39	1.7595321E-6
abrejo	1	4.5116206E-8
abrell	1	4.5116206E-8
abres	1	4.5116206E-8
abreu	3	1.3534861E-7
abreuvoir	2	9.023241E-8
abri	1	4.5116206E-8
abridge	11	4.962783E-7
abridged	9	4.0604587E-7
abridgement	1	4.5116206E-8
abridges	1	4.5116206E-8
abridging	3	1.3534861E-7
abridgment	3	1.3534861E-7
abriel	1	4.5116206E-8
abrigo	2	9.023241E-8
abrikosov	1	4.5116206E-8
abril	9	4.0604587E-7
abroad	441	1.9896248E-5
abroad-limits	1	4.5116206E-8
abrode	1	4.5116206E-8
abrogate	11	4.962783E-7
abrogated	15	6.767431E-7
abrogates	2	9.023241E-8
abrogating	5	2.2558103E-7
abrogation	8	3.6092965E-7
abrotanum	3	1.3534861E-7
abrou	1	4.5116206E-8
abrupt	82	3.6995289E-6
abrupta	1	4.5116206E-8
abruptly	103	4.6469695E-6
abruptness	2	9.023241E-8
abruzzi	2	9.023241E-8
abs	51	2.3009266E-6
absalom	6	2.7069723E-7
absaroka	1	4.5116206E-8
abscam	2	9.023241E-8
abscence	1	4.5116206E-8
abscene	1	4.5116206E-8
abscess	9	4.0604587E-7
abscess-like	1	4.5116206E-8
abscessed	1	4.5116206E-8
abscesses	10	4.5116207E-7
abscessus	1	4.5116206E-8
abscisic	7	3.1581345E-7
abscissa	3	1.3534861E-7
abscond	3	1.3534861E-7
absconded	4	1.8046482E-7
absconding	1	4.5116206E-8
abscondment	1	4.5116206E-8
absdata	3	1.3534861E-7
abse	1	4.5116206E-8
absence	1460	6.586966E-5
absence-minded	1	4.5116206E-8
absences	31	1.3986024E-6
absense	1	4.5116206E-8
absent	452	2.0392525E-5
absent-minded	1	4.5116206E-8
absent-mindedly	3	1.3534861E-7
absente	1	4.5116206E-8
absented	1	4.5116206E-8
absentee	49	2.2106942E-6
absenteeism	18	8.1209174E-7
absentees	2	9.023241E-8
absenthe	1	4.5116206E-8
absentia	9	4.0604587E-7
absentionists	1	4.5116206E-8
absently	9	4.0604587E-7
absentminded	2	9.023241E-8
absentmindedly	1	4.5116206E-8
abshire	1	4.5116206E-8
absinth	1	4.5116206E-8
absinthe	10	4.5116207E-7
absinthe-fueled	1	4.5116206E-8
absinthium	13	5.865107E-7
absit	1	4.5116206E-8
absloutely	1	4.5116206E-8
abso-bleeding-lutely	1	4.5116206E-8
abso-freakin-lutely	1	4.5116206E-8
abso-friggin	1	4.5116206E-8
abso-fucking-lutely	2	9.023241E-8
absofxxxinglutely	1	4.5116206E-8
absolete	1	4.5116206E-8
absolom	1	4.5116206E-8
absolu	1	4.5116206E-8
absolut	4	1.8046482E-7
absolute	747	3.3701806E-5
absolute-beginners	1	4.5116206E-8
absolutely	1406	6.3433385E-5
absoluteness	5	2.2558103E-7
absolutes	9	4.0604587E-7
absolution	11	4.962783E-7
absolutism	11	4.962783E-7
absolutisms	1	4.5116206E-8
absolutist	14	6.316269E-7
absolutists	2	9.023241E-8
absolutly	1	4.5116206E-8
absolve	10	4.5116207E-7
absolved	9	4.0604587E-7
absolver	1	4.5116206E-8
absolves	4	1.8046482E-7
absolving	2	9.023241E-8
absolyutno	1	4.5116206E-8
absorb	128	5.7748744E-6
absorbable	2	9.023241E-8
absorbance	141	6.361385E-6
absorbances	4	1.8046482E-7
absorbed	200	9.023242E-6
absorbency	9	4.0604587E-7
absorbent	11	4.962783E-7
absorber	63	2.842321E-6
absorber-module	2	9.023241E-8
absorbers	32	1.4437186E-6
absorbing	65	2.9325533E-6
absorbs	28	1.2632538E-6
absorptiometry	2	9.023241E-8
absorption	285	1.2858119E-5
absorptions	1	4.5116206E-8
absorptive	3	1.3534861E-7
absorptivities	1	4.5116206E-8
abstain	22	9.925566E-7
abstained	9	4.0604587E-7
abstainers	3	1.3534861E-7
abstaining	6	2.7069723E-7
abstains	2	9.023241E-8
abstemious	2	9.023241E-8
abstemiousness	1	4.5116206E-8
abstention	3	1.3534861E-7
abstentions	5	2.2558103E-7
abstinence	66	2.9776697E-6
abstinence-based	2	9.023241E-8
abstinence-only	8	3.6092965E-7
abstinence-oriented	1	4.5116206E-8
abstinence-plus	1	4.5116206E-8
abstinent	4	1.8046482E-7
abstract	295	1.3309281E-5
abstractdataadapter	1	4.5116206E-8
abstracted	36	1.6241835E-6
abstracting	5	2.2558103E-7
abstraction	59	2.6618561E-6
abstractionist	2	9.023241E-8
abstractions	13	5.865107E-7
abstractly	8	3.6092965E-7
abstractness	1	4.5116206E-8
abstractors	3	1.3534861E-7
abstracts	86	3.879994E-6
abstruse	13	5.865107E-7
abstruse-seeming	1	4.5116206E-8
absurd	235	1.0602309E-5
absurd-looking	1	4.5116206E-8
absurd-sounding	1	4.5116206E-8
absurder	1	4.5116206E-8
absurdism	1	4.5116206E-8
absurdist	14	6.316269E-7
absurdist-tinged	1	4.5116206E-8
absurdities	12	5.4139446E-7
absurdity	55	2.4813914E-6
absurdly	40	1.8046483E-6
absurdum	3	1.3534861E-7
absurdus	1	4.5116206E-8
absures	1	4.5116206E-8
abt	19	8.572079E-7
abtei	1	4.5116206E-8
abts	4	1.8046482E-7
abu	218	9.835333E-6
abubakar	12	5.4139446E-7
abuela	2	9.023241E-8
abuelo	11	4.962783E-7
abuen	1	4.5116206E-8
abuja	1	4.5116206E-8
abukayak	1	4.5116206E-8
abukhalil	3	1.3534861E-7
abulia	2	9.023241E-8
abulous	1	4.5116206E-8
abumhrad	1	4.5116206E-8
abundance	402	1.8136716E-5
abundances	27	1.2181375E-6
abundant	304	1.37153265E-5
abundantly	46	2.0753455E-6
abundence	1	4.5116206E-8
abuot	1	4.5116206E-8
aburdeineh	1	4.5116206E-8
abusaad	1	4.5116206E-8
abusaid	2	9.023241E-8
abuse	1130	5.0981314E-5
abuse-of-fiction	1	4.5116206E-8
abuse-programs	1	4.5116206E-8
abuse-suggesting	1	4.5116206E-8
abused	202	9.113473E-6
abuseinfederal	2	9.023241E-8
abuseofpower	1	4.5116206E-8
abuser	18	8.1209174E-7
abusers	40	1.8046483E-6
abuses	214	9.654868E-6
abusing	90	4.0604587E-6
abusive	148	6.6771986E-6
abusive-cum-substance-abusive-cum-mooching	1	4.5116206E-8
abusively	1	4.5116206E-8
abut	11	4.962783E-7
abutments	1	4.5116206E-8
abuts	3	1.3534861E-7
abutted	2	9.023241E-8
abutting	6	2.7069723E-7
abuturab	1	4.5116206E-8
abuzz	7	3.1581345E-7
abwab	1	4.5116206E-8
abwender	1	4.5116206E-8
abx	1	4.5116206E-8
aby	1	4.5116206E-8
abydos	1	4.5116206E-8
abymes	1	4.5116206E-8
abysii	1	4.5116206E-8
abysinth	1	4.5116206E-8
abysmal	21	9.4744036E-7
abysmally	3	1.3534861E-7
abyss	20	9.0232413E-7
abyss-gazing	1	4.5116206E-8
abyssi	11	4.962783E-7
abyssinia	7	3.1581345E-7
abyssinian	2	9.023241E-8
abyssmally	1	4.5116206E-8
abzug	3	1.3534861E-7
ab­bey	1	4.5116206E-8
ac	288	1.2993468E-5
ac-hoteles	2	9.023241E-8
aca	32	1.4437186E-6
aca-limpia	1	4.5116206E-8
acaa	10	4.5116207E-7
acaaaaacc	1	4.5116206E-8
acaaataggggttccgcgcaca	1	4.5116206E-8
acaacaaagggcagcaacaacacc	1	4.5116206E-8
acaacaccgtg	1	4.5116206E-8
acaaccagtttgctctgcttatc	1	4.5116206E-8
acaba	1	4.5116206E-8
acacagataagttgctggcc	1	4.5116206E-8
acacia	8	3.6092965E-7
acacia-like	1	4.5116206E-8
acad	19	8.572079E-7
academe	10	4.5116207E-7
academese	1	4.5116206E-8
academia	60	2.7069725E-6
academic	835	3.767203E-5
academic-seeming	1	4.5116206E-8
academic-sounding	1	4.5116206E-8
academic-types	1	4.5116206E-8
academically	35	1.5790672E-6
academician	2	9.023241E-8
academicians	8	3.6092965E-7
academicism	1	4.5116206E-8
academics	123	5.5492933E-6
academic–industrial	1	4.5116206E-8
academie	4	1.8046482E-7
academies	16	7.218593E-7
academy	428	1.9309737E-5
academywomen	1	4.5116206E-8
acadia	15	6.767431E-7
acadian	7	3.1581345E-7
acadians	11	4.962783E-7
acadm	2	9.023241E-8
académica	1	4.5116206E-8
académie	12	5.4139446E-7
académies	1	4.5116206E-8
acadé­mie	1	4.5116206E-8
acagcctgaccgtggagaag	1	4.5116206E-8
acagtgaagagtagtggtcg	1	4.5116206E-8
acalda	1	4.5116206E-8
acampado	1	4.5116206E-8
acampora	2	9.023241E-8
acan	1	4.5116206E-8
acanthaceae	1	4.5116206E-8
acanthamoeba	2	9.023241E-8
acanthomoeba	1	4.5116206E-8
acanthostega	2	9.023241E-8
acanthus	4	1.8046482E-7
acap	1	4.5116206E-8
acapella	2	9.023241E-8
acapulco	90	4.0604587E-6
acarbon	1	4.5116206E-8
acarbose	1	4.5116206E-8
acars	7	3.1581345E-7
acas	2	9.023241E-8
acass	1	4.5116206E-8
acat	1	4.5116206E-8
acatccaaacagaacgtgcc	1	4.5116206E-8
acatcher	1	4.5116206E-8
acatggactgaggagtag	1	4.5116206E-8
acatgggacgtaacagatac	1	4.5116206E-8
acatgtccagcatcaaagcgg	1	4.5116206E-8
acathala	1	4.5116206E-8
acatitla	1	4.5116206E-8
acatn	1	4.5116206E-8
acaule	1	4.5116206E-8
acauses	1	4.5116206E-8
aca­demy	1	4.5116206E-8
aca­dé­mie	1	4.5116206E-8
acbd	1	4.5116206E-8
acc	74	3.3385993E-6
accaccgtggacaccttctdtdt	1	4.5116206E-8
accademia	15	6.767431E-7
accadian	1	4.5116206E-8
accaggacgatcaactgggcttc	1	4.5116206E-8
accagtcgactctacagtgc	1	4.5116206E-8
accattgagctcttcactgatgaacttcacc	1	4.5116206E-8
acccaagatacctcatcacag	1	4.5116206E-8
acccatgtcaaacccatcag	1	4.5116206E-8
acccccatctcactaattcc	1	4.5116206E-8
accclaimed	1	4.5116206E-8
accctctccaaaatcccataa	1	4.5116206E-8
accede	11	4.962783E-7
acceded	14	6.316269E-7
acceding	4	1.8046482E-7
accelerate	102	4.601853E-6
accelerate-the	1	4.5116206E-8
accelerated	159	7.1734767E-6
accelerates	17	7.669755E-7
accelerating	58	2.61674E-6
acceleration	73	3.2934831E-6
accelerations	1	4.5116206E-8
accelerator	19	8.572079E-7
accelerod	2	9.023241E-8
accelerometer	1	4.5116206E-8
accelerometer-based	3	1.3534861E-7
accelerometers	1	4.5116206E-8
acceleromyography	1	4.5116206E-8
accelrys	1	4.5116206E-8
accent	450	2.0302294E-5
accent-free	1	4.5116206E-8
accent-reduction	1	4.5116206E-8
accent-training	2	9.023241E-8
accented	14	6.316269E-7
accenting	6	2.7069723E-7
accents	145	6.54185E-6
accents-fighting-and-sweating-in-the-desert	1	4.5116206E-8
accentservices	1	4.5116206E-8
accentuate	16	7.218593E-7
accentuated	19	8.572079E-7
accentuates	5	2.2558103E-7
accentuating	7	3.1581345E-7
accenture	9	4.0604587E-7
accep-tance	1	4.5116206E-8
accept	1032	4.6559926E-5
accepta	1	4.5116206E-8
acceptab	1	4.5116206E-8
acceptability	52	2.3460427E-6
acceptable	543	2.44981E-5
acceptableî	1	4.5116206E-8
acceptably	5	2.2558103E-7
acceptance	343	1.547486E-5
acceptance-speech	1	4.5116206E-8
acceptanceprocedures	1	4.5116206E-8
acceptances	10	4.5116207E-7
accepted	938	4.2319003E-5
accepter	1	4.5116206E-8
accepters	1	4.5116206E-8
acceptible	1	4.5116206E-8
accepting	282	1.272277E-5
acceptive	1	4.5116206E-8
acceptor	68	3.067902E-6
acceptors	9	4.0604587E-7
accepts	110	4.962783E-6
accesorized	1	4.5116206E-8
access	2504	1.1297098E-4
access-restriction	1	4.5116206E-8
access-that	1	4.5116206E-8
access-to-justice	1	4.5116206E-8
access-to-records	1	4.5116206E-8
accessable	1	4.5116206E-8
accessdata	1	4.5116206E-8
accessed	73	3.2934831E-6
accessed-like	1	4.5116206E-8
accesses	5	2.2558103E-7
accessibilities	1	4.5116206E-8
accessibility	70	3.1581344E-6
accessible	383	1.7279508E-5
accessibly	3	1.3534861E-7
accessing	45	2.0302293E-6
accession	367	1.6557648E-5
accessioned	1	4.5116206E-8
accessions	14	6.316269E-7
accessionsperassembly	1	4.5116206E-8
accessit	1	4.5116206E-8
accessories	77	3.473948E-6
accessorise	2	9.023241E-8
accessorize	7	3.1581345E-7
accessorized	3	1.3534861E-7
accessorizing	1	4.5116206E-8
accessors	1	4.5116206E-8
accessory	76	3.4288316E-6
accessto	1	4.5116206E-8
accessworld	1	4.5116206E-8
accgtgaaaagatgatgacccag	1	4.5116206E-8
accgtgaccg	1	4.5116206E-8
acch	1	4.5116206E-8
accha	1	4.5116206E-8
accham	1	4.5116206E-8
acci	2	9.023241E-8
accid	1	4.5116206E-8
accident	673	3.0363208E-5
accident-prone	2	9.023241E-8
accident-related	1	4.5116206E-8
accidental	131	5.910223E-6
accidentalis	1	4.5116206E-8
accidentally	208	9.384171E-6
accidently	14	6.316269E-7
accidents	236	1.06474245E-5
acciderant	1	4.5116206E-8
accidnet	1	4.5116206E-8
accio	1	4.5116206E-8
accipiens	1	4.5116206E-8
accipitrine	1	4.5116206E-8
accival	1	4.5116206E-8
acclaim	56	2.5265076E-6
acclaimed	86	3.879994E-6
acclamabant	1	4.5116206E-8
acclamation	4	1.8046482E-7
acclimatation	3	1.3534861E-7
acclimate	8	3.6092965E-7
acclimated	19	8.572079E-7
acclimating	7	3.1581345E-7
acclimation	23	1.0376727E-6
acclimatization	4	1.8046482E-7
acclimatize	4	1.8046482E-7
acclimatized	1	4.5116206E-8
accn	1	4.5116206E-8
accnewsmedia	1	4.5116206E-8
accnu	1	4.5116206E-8
acco	13	5.865107E-7
accoberry	1	4.5116206E-8
accolade	11	4.962783E-7
accolades	24	1.0827889E-6
accom	1	4.5116206E-8
accomadating	1	4.5116206E-8
accommodate	219	9.880449E-6
accommodated	33	1.4888349E-6
accommodates	19	8.572079E-7
accommodating	38	1.7144158E-6
accommodatingly	1	4.5116206E-8
accommodation	86	3.879994E-6
accommodationism	2	9.023241E-8
accommodationist	5	2.2558103E-7
accommodationists	1	4.5116206E-8
accommodations	112	5.0530152E-6
accomodate	8	3.6092965E-7
accomodation	5	2.2558103E-7
accomodationists	1	4.5116206E-8
accomodations	2	9.023241E-8
accompanied	448	2.0212061E-5
accompanies	63	2.842321E-6
accompaniment	26	1.1730214E-6
accompaniments	6	2.7069723E-7
accompanist	3	1.3534861E-7
accompany	121	5.459061E-6
accompanying	273	1.2316725E-5
accompianied	1	4.5116206E-8
accompianment	2	9.023241E-8
accompli	10	4.5116207E-7
accomplice	32	1.4437186E-6
accomplices	19	8.572079E-7
accomplis	1	4.5116206E-8
accomplish	279	1.2587421E-5
accomplish-easily	1	4.5116206E-8
accomplished	367	1.6557648E-5
accomplishes	17	7.669755E-7
accomplishing	47	2.1204617E-6
accomplishment	120	5.413945E-6
accomplishments	143	6.4516175E-6
accomplit	1	4.5116206E-8
accompong	1	4.5116206E-8
accord	182	8.211149E-6
accordance	388	1.7505088E-5
accordancewith	1	4.5116206E-8
accordant	1	4.5116206E-8
accorded	48	2.1655778E-6
accordence	1	4.5116206E-8
accordianist	1	4.5116206E-8
accordians	1	4.5116206E-8
according	5113	2.3067917E-4
accordingly	276	1.2452073E-5
accordion	32	1.4437186E-6
accordion-laced	1	4.5116206E-8
accordion-like	1	4.5116206E-8
accordionated	1	4.5116206E-8
accordionist	4	1.8046482E-7
accordions	12	5.4139446E-7
accords	82	3.6995289E-6
accoring	1	4.5116206E-8
accorsi	1	4.5116206E-8
accosted	11	4.962783E-7
accosting	3	1.3534861E-7
accosts	1	4.5116206E-8
account	2215	9.99324E-5
accountabilities	2	9.023241E-8
accountability	465	2.0979036E-5
accountability-can	1	4.5116206E-8
accountability-with	1	4.5116206E-8
accountabilitycontrol	1	4.5116206E-8
accountabilityreportis	1	4.5116206E-8
accountable	231	1.0421843E-5
accountancy	12	5.4139446E-7
accountant	116	5.23348E-6
accountant-client	1	4.5116206E-8
accountantand	1	4.5116206E-8
accountants	184	8.301382E-6
accountants-www	2	9.023241E-8
accounted	277	1.2497189E-5
accounting	2075	9.361613E-5
accounting-fraud	1	4.5116206E-8
accounting-oversight	1	4.5116206E-8
accountingmalpractice	1	4.5116206E-8
accountingrelated	1	4.5116206E-8
accounts	1039	4.687574E-5
accounts-and	2	9.023241E-8
accounts-discussed	1	4.5116206E-8
accounts-to	1	4.5116206E-8
accout	1	4.5116206E-8
accouterment	2	9.023241E-8
accouterments	5	2.2558103E-7
accoutred	1	4.5116206E-8
accoutrements	12	5.4139446E-7
accra	12	5.4139446E-7
accreditation	38	1.7144158E-6
accreditations	1	4.5116206E-8
accredited	25	1.1279052E-6
accrediting	5	2.2558103E-7
accredits	3	1.3534861E-7
accreted	2	9.023241E-8
accreting	1	4.5116206E-8
accretion	17	7.669755E-7
accretions	3	1.3534861E-7
accross	1	4.5116206E-8
accrual	12	5.4139446E-7
accrue	36	1.6241835E-6
accrued	42	1.8948807E-6
accrues	8	3.6092965E-7
accruing	9	4.0604587E-7
acct	2	9.023241E-8
acctcccaaactatagattgggtg	1	4.5116206E-8
acctgcactc	1	4.5116206E-8
acctran	2	9.023241E-8
accttattttaaaaataaagttaa	1	4.5116206E-8
accttggaagaaccaaatc	1	4.5116206E-8
accu	1	4.5116206E-8
accucam	1	4.5116206E-8
accueillir	1	4.5116206E-8
accugel	1	4.5116206E-8
acculturated	3	1.3534861E-7
acculturating	2	9.023241E-8
acculturation	7	3.1581345E-7
accumbens	6	2.7069723E-7
accumen	1	4.5116206E-8
accummulated	1	4.5116206E-8
accumulate	169	7.624639E-6
accumulated	203	9.15859E-6
accumulates	60	2.7069725E-6
accumulating	80	3.6092965E-6
accumulation	487	2.1971593E-5
accumulations	18	8.1209174E-7
accumulative	1	4.5116206E-8
accumulators	2	9.023241E-8
accupressure	2	9.023241E-8
accur	1	4.5116206E-8
accurac	1	4.5116206E-8
accuracies	7	3.1581345E-7
accuracy	667	3.009251E-5
accuracy-the	1	4.5116206E-8
accuradio	2	9.023241E-8
accurate	899	4.055947E-5
accurately	370	1.6692997E-5
accuratelymodel	1	4.5116206E-8
accuray	1	4.5116206E-8
accurist	1	4.5116206E-8
accurs	1	4.5116206E-8
accursed	3	1.3534861E-7
accus	1	4.5116206E-8
accusation	109	4.9176665E-6
accusational	1	4.5116206E-8
accusations	211	9.51952E-6
accusative	6	2.7069723E-7
accusatory	9	4.0604587E-7
accuse	146	6.5869663E-6
accused	902	4.069482E-5
accuser	32	1.4437186E-6
accusers	25	1.1279052E-6
accuses	111	5.007899E-6
accusing	154	6.947896E-6
accusingly	4	1.8046482E-7
accusitive	3	1.3534861E-7
accustom	3	1.3534861E-7
accustomed	149	6.722315E-6
accutron	20	9.0232413E-7
accutrons	4	1.8046482E-7
accuvue	1	4.5116206E-8
accuweather	4	1.8046482E-7
accuzyme	1	4.5116206E-8
accytnarggt	1	4.5116206E-8
acd	8	3.6092965E-7
acdcrocks	1	4.5116206E-8
ace	162	7.3088254E-6
ace-i	4	1.8046482E-7
ace-inhibitor	2	9.023241E-8
ace-inhibitors	7	3.1581345E-7
acea	1	4.5116206E-8
acebuche	1	4.5116206E-8
acecray	1	4.5116206E-8
aced	6	2.7069723E-7
acedb	6	2.7069723E-7
aceee	3	1.3534861E-7
aceh	14	6.316269E-7
acehnese	4	1.8046482E-7
aceisms	2	9.023241E-8
aceitunasoliveslangostaspiny	1	4.5116206E-8
acela	10	4.5116207E-7
acellular	1	4.5116206E-8
acentric	1	4.5116206E-8
aceous	1	4.5116206E-8
acequia	1	4.5116206E-8
acer	4	1.8046482E-7
aceralia	1	4.5116206E-8
acerbic	14	6.316269E-7
acerbity	1	4.5116206E-8
acert	1	4.5116206E-8
aces	39	1.7595321E-6
acess	1	4.5116206E-8
acesulfame	2	9.023241E-8
acetabularia	4	1.8046482E-7
acetabulum	2	9.023241E-8
acetaminophen	15	6.767431E-7
acetate	190	8.572079E-6
acetates	1	4.5116206E-8
acetazolamide	26	1.1730214E-6
acetazolamide-induced	2	9.023241E-8
acetic	50	2.2558104E-6
acetivorans	4	1.8046482E-7
acetobutylicum	13	5.865107E-7
acetol	1	4.5116206E-8
acetomeniphin	1	4.5116206E-8
acetominophen	1	4.5116206E-8
acetone	44	1.9851132E-6
acetone-dried	5	2.2558103E-7
acetone-dry	1	4.5116206E-8
acetonitrile	23	1.0376727E-6
acetoxylmethyl	1	4.5116206E-8
acetoxymethyl	8	3.6092965E-7
acetoxymethylester	2	9.023241E-8
acetyl	64	2.8874372E-6
acetyl-leu-leu-norleucinal	1	4.5116206E-8
acetyl-leucyl-leucyl-norleucinal	2	9.023241E-8
acetyl-transferase	1	4.5116206E-8
acetyl-transferases	1	4.5116206E-8
acetylase	2	9.023241E-8
acetylated	20	9.0232413E-7
acetylation	33	1.4888349E-6
acetylbarlerin	1	4.5116206E-8
acetylcholine	73	3.2934831E-6
acetylcholine-mediated	1	4.5116206E-8
acetylcholine-stimulated	1	4.5116206E-8
acetylcholinesterase	4	1.8046482E-7
acetylcysteine	3	1.3534861E-7
acetylenic	1	4.5116206E-8
acetylglucosamine	1	4.5116206E-8
acetylhydorolase	1	4.5116206E-8
acetyllysines	1	4.5116206E-8
acetylmuramate	3	1.3534861E-7
acetylornithine	1	4.5116206E-8
acetyloxy	2	9.023241E-8
acetylsalicylic	1	4.5116206E-8
acetylserine	1	4.5116206E-8
acetylshanzhiside	1	4.5116206E-8
acetyltransferase	35	1.5790672E-6
acetyltransferases	3	1.3534861E-7
acevedo	3	1.3534861E-7
aceves	2	9.023241E-8
acf	16	7.218593E-7
acfirmi	7	3.1581345E-7
acg	22	9.925566E-7
acgaacagcatctcct	1	4.5116206E-8
acgcgcggagttggc	1	4.5116206E-8
acgcgttgcgtatcgcgcg	1	4.5116206E-8
acggcttttcc	1	4.5116206E-8
acgme	3	1.3534861E-7
acgtca	1	4.5116206E-8
acgtgc	1	4.5116206E-8
acgttgcgagctgctgcggc	2	9.023241E-8
ach	85	3.8348776E-6
achada	4	1.8046482E-7
achaean	1	4.5116206E-8
achaeans	3	1.3534861E-7
achaiac	1	4.5116206E-8
achange	1	4.5116206E-8
achapman	2	9.023241E-8
achbp	33	1.4888349E-6
ache	38	1.7144158E-6
achebe	4	1.8046482E-7
ached	5	2.2558103E-7
acheh	2	9.023241E-8
acheive	3	1.3534861E-7
acheived	3	1.3534861E-7
acheivement	2	9.023241E-8
achenbach	4	1.8046482E-7
aches	27	1.2181375E-6
acheson	52	2.3460427E-6
achey	11	4.962783E-7
acheyness	1	4.5116206E-8
achh	1	4.5116206E-8
achiasmatic	22	9.925566E-7
achievable	36	1.6241835E-6
achieve	948	4.2770163E-5
achieved	775	3.496506E-5
achieved-can	1	4.5116206E-8
achievedby	1	4.5116206E-8
achievement	353	1.5926022E-5
achievements	172	7.759988E-6
achiever	4	1.8046482E-7
achievers	10	4.5116207E-7
achieves	69	3.1130182E-6
achieving	308	1.3895792E-5
achille	1	4.5116206E-8
achillea	1	4.5116206E-8
achilles	43	1.939997E-6
aching	42	1.8948807E-6
achingly	6	2.7069723E-7
achingly-long	1	4.5116206E-8
achiron	1	4.5116206E-8
achives	1	4.5116206E-8
achla	1	4.5116206E-8
achlamu	1	4.5116206E-8
achmed	38	1.7144158E-6
achner	1	4.5116206E-8
achomawi	3	1.3534861E-7
achondroplastic	1	4.5116206E-8
achoo	1	4.5116206E-8
achos	1	4.5116206E-8
achr	26	1.1730214E-6
achromatic	1	4.5116206E-8
achromatopic	1	4.5116206E-8
achromatopsia	2	9.023241E-8
achrs	13	5.865107E-7
acht	1	4.5116206E-8
achterburg	1	4.5116206E-8
achtgroschenjunge	2	9.023241E-8
achtung	3	1.3534861E-7
achy	7	3.1581345E-7
aci	114	5.1432476E-6
acid	2138	9.645845E-5
acid-albumin-dextrose-catalase	1	4.5116206E-8
acid-alcohol-formalin	1	4.5116206E-8
acid-base	3	1.3534861E-7
acid-based	5	2.2558103E-7
acid-binding	4	1.8046482E-7
acid-blooded	1	4.5116206E-8
acid-citrate-dextrose	1	4.5116206E-8
acid-containing	1	4.5116206E-8
acid-denatured	1	4.5116206E-8
acid-fast	4	1.8046482E-7
acid-filled	1	4.5116206E-8
acid-free	2	9.023241E-8
acid-induced	4	1.8046482E-7
acid-long	1	4.5116206E-8
acid-mediated	2	9.023241E-8
acid-nucleotide	1	4.5116206E-8
acid-phenol	1	4.5116206E-8
acid-phosphate	1	4.5116206E-8
acid-reactive	2	9.023241E-8
acid-rich	1	4.5116206E-8
acid-soaked	1	4.5116206E-8
acid-stable	1	4.5116206E-8
acid-stimulated	1	4.5116206E-8
acid-tolerant	4	1.8046482E-7
acid-tongued	2	9.023241E-8
acid-transporting	2	9.023241E-8
acid-treated	8	3.6092965E-7
acid-tris	2	9.023241E-8
acid-urea	2	9.023241E-8
acid-washing	1	4.5116206E-8
acid-worded	1	4.5116206E-8
acidarmanus	1	4.5116206E-8
acidemia	4	1.8046482E-7
acidemias	2	9.023241E-8
acidic	171	7.714872E-6
acidification	17	7.669755E-7
acidified	13	5.865107E-7
acidify	2	9.023241E-8
acidimetry	1	4.5116206E-8
acidiphilum	1	4.5116206E-8
acidithiobacillus	1	4.5116206E-8
acidity	37	1.6692996E-6
acidly	4	1.8046482E-7
acidogenic	1	4.5116206E-8
acidop	1	4.5116206E-8
acidophilous	1	4.5116206E-8
acidophilum	35	1.5790672E-6
acidophiluma-atpase	1	4.5116206E-8
acidophilumintein	1	4.5116206E-8
acidophilus	4	1.8046482E-7
acidopholus	1	4.5116206E-8
acidosis	28	1.2632538E-6
acids	1082	4.8815735E-5
aciduria	18	8.1209174E-7
acid–	2	9.023241E-8
acid–glutamic	1	4.5116206E-8
acid–leucine	1	4.5116206E-8
acinar	4	1.8046482E-7
acinetobacter	12	5.4139446E-7
acing	4	1.8046482E-7
acini	14	6.316269E-7
acipenser	3	1.3534861E-7
acipenseriformes	2	9.023241E-8
acis	1	4.5116206E-8
acitivy	1	4.5116206E-8
acitotinase	1	4.5116206E-8
acitrate	1	4.5116206E-8
aciv	1	4.5116206E-8
ack	81	3.6544127E-6
ackab	3	1.3534861E-7
ackee	4	1.8046482E-7
acker	33	1.4888349E-6
ackerly	2	9.023241E-8
ackerman	13	5.865107E-7
ackermann	9	4.0604587E-7
ackil	3	1.3534861E-7
ackland	1	4.5116206E-8
acklins	4	1.8046482E-7
acknolwedge	1	4.5116206E-8
acknowledge	283	1.2767887E-5
acknowledged	447	2.0166945E-5
acknowledgedly	1	4.5116206E-8
acknowledgement	40	1.8046483E-6
acknowledgements	17	7.669755E-7
acknowledges	136	6.135804E-6
acknowledging	104	4.6920854E-6
acknowledgment	51	2.3009266E-6
acknowledgments	19	8.572079E-7
acknowlnotes	1	4.5116206E-8
ackroyd	6	2.7069723E-7
acl	21	9.4744036E-7
acland	1	4.5116206E-8
acleod	1	4.5116206E-8
aclivmfy	2	9.023241E-8
acls	2	9.023241E-8
aclu	49	2.2106942E-6
acly	10	4.5116207E-7
acm	14	6.316269E-7
acmb	9	4.0604587E-7
acmb-like	2	9.023241E-8
acme	10	4.5116207E-7
acmed	1	4.5116206E-8
acmepet	1	4.5116206E-8
acmm	1	4.5116206E-8
acmnpv	4	1.8046482E-7
acn	2	9.023241E-8
acnab	4	1.8046482E-7
acne	9	4.0604587E-7
acne-free	1	4.5116206E-8
acno	1	4.5116206E-8
acnv	1	4.5116206E-8
aco	2	9.023241E-8
acoa	2	9.023241E-8
acocella	2	9.023241E-8
acocmplish	1	4.5116206E-8
acoel	1	4.5116206E-8
acoelomate	1	4.5116206E-8
acog	3	1.3534861E-7
acoh	1	4.5116206E-8
acolman	1	4.5116206E-8
acolyte	7	3.1581345E-7
acolytes	13	5.865107E-7
acoma	4	1.8046482E-7
acombined	1	4.5116206E-8
acompany	1	4.5116206E-8
acompared	1	4.5116206E-8
acompares	1	4.5116206E-8
acondition	1	4.5116206E-8
aconfession	1	4.5116206E-8
aconfirms	1	4.5116206E-8
aconi	1	4.5116206E-8
aconicitrate	1	4.5116206E-8
aconitase	12	5.4139446E-7
aconite	1	4.5116206E-8
acononate	1	4.5116206E-8
acord	1	4.5116206E-8
acorn	9	4.0604587E-7
acorn-shape	1	4.5116206E-8
acorns	6	2.7069723E-7
acosta	5	2.2558103E-7
acosts	1	4.5116206E-8
acoustic	80	3.6092965E-6
acoustical	6	2.7069723E-7
acoustically	9	4.0604587E-7
acoustics	43	1.939997E-6
acoustiguide	1	4.5116206E-8
acoustra	1	4.5116206E-8
acovers	1	4.5116206E-8
acp	9	4.0604587E-7
acpa	2	9.023241E-8
acps	1	4.5116206E-8
acq	1	4.5116206E-8
acqua	1	4.5116206E-8
acquaint	5	2.2558103E-7
acquaintance	89	4.0153423E-6
acquaintances	56	2.5265076E-6
acquaintanceship	1	4.5116206E-8
acquaintanceships	1	4.5116206E-8
acquainted	60	2.7069725E-6
acquainting	1	4.5116206E-8
acquaints	1	4.5116206E-8
acquiesce	4	1.8046482E-7
acquiesced	9	4.0604587E-7
acquiescence	12	5.4139446E-7
acquiescent	3	1.3534861E-7
acquiesces	1	4.5116206E-8
acquiescing	3	1.3534861E-7
acquiesence	1	4.5116206E-8
acquire	339	1.5294394E-5
acquireagency	1	4.5116206E-8
acquired	709	3.198739E-5
acquiree	1	4.5116206E-8
acquirees	1	4.5116206E-8
acquirer	7	3.1581345E-7
acquirers	5	2.2558103E-7
acquires	25	1.1279052E-6
acquiring	196	8.842777E-6
acquisition	786	3.5461337E-5
acquisition-driven	1	4.5116206E-8
acquisition-in-process	1	4.5116206E-8
acquisitionas	1	4.5116206E-8
acquisitionofficials	1	4.5116206E-8
acquisitions	143	6.4516175E-6
acquisitive	4	1.8046482E-7
acquisitiveness	3	1.3534861E-7
acquit	18	8.1209174E-7
acquits	4	1.8046482E-7
acquittal	48	2.1655778E-6
acquittals	8	3.6092965E-7
acquitted	63	2.842321E-6
acquitting	4	1.8046482E-7
acqusitive	1	4.5116206E-8
acr	33	1.4888349E-6
acral	2	9.023241E-8
acrasin	2	9.023241E-8
acre	254	1.1459517E-5
acreage	19	8.572079E-7
acreman	1	4.5116206E-8
acres	413	1.8632993E-5
acrid	13	5.865107E-7
acridine	13	5.865107E-7
acrimonious	9	4.0604587E-7
acrimony	11	4.962783E-7
acrisius	2	9.023241E-8
acritude	1	4.5116206E-8
acro	2	9.023241E-8
acrobat	20	9.0232413E-7
acrobatic	19	8.572079E-7
acrobatically	2	9.023241E-8
acrobatics	15	6.767431E-7
acrobats	8	3.6092965E-7
acrocentric	4	1.8046482E-7
acrocentrics	1	4.5116206E-8
acrocomia	2	9.023241E-8
acrocorinth	1	4.5116206E-8
acrolein	1	4.5116206E-8
acromegaly	4	1.8046482E-7
acronical	1	4.5116206E-8
acronym	83	3.7446453E-6
acronym-farm	1	4.5116206E-8
acronymalicious	1	4.5116206E-8
acronymed	2	9.023241E-8
acronymic	2	9.023241E-8
acronymized	1	4.5116206E-8
acronyms	63	2.842321E-6
acropolis	52	2.3460427E-6
acropper	1	4.5116206E-8
acros	1	4.5116206E-8
acrosomal	1	4.5116206E-8
acrosome	1	4.5116206E-8
across	4358	1.9661643E-4
across-array	1	4.5116206E-8
across-array-design	1	4.5116206E-8
across-sites	1	4.5116206E-8
across-study	4	1.8046482E-7
across-the-board	31	1.3986024E-6
across-the-board-pay	1	4.5116206E-8
across-the-top	2	9.023241E-8
acrosss	1	4.5116206E-8
acrossthe	1	4.5116206E-8
acrostic	3	1.3534861E-7
acrostics	3	1.3534861E-7
acrybp	1	4.5116206E-8
acrydite	1	4.5116206E-8
acrylamide	22	9.925566E-7
acrylamide-urea	1	4.5116206E-8
acrylate	1	4.5116206E-8
acrylic	11	4.962783E-7
acrylics	1	4.5116206E-8
acr­oss	1	4.5116206E-8
acs	59	2.6618561E-6
acs-grade	1	4.5116206E-8
acse	4	1.8046482E-7
acse-hp	4	1.8046482E-7
acsension	1	4.5116206E-8
acsf	6	2.7069723E-7
acshun	1	4.5116206E-8
acsp	1	4.5116206E-8
act	4047	1.8258528E-4
act-containing	2	9.023241E-8
act-expressing	2	9.023241E-8
act-like	1	4.5116206E-8
act-strategic	1	4.5116206E-8
act-up-style	1	4.5116206E-8
act-which	4	1.8046482E-7
acta	22	9.925566E-7
acta-dependent	2	9.023241E-8
actaatgctag	1	4.5116206E-8
actaea	6	2.7069723E-7
actaeas	1	4.5116206E-8
actaeon	2	9.023241E-8
actagtctcgagt	1	4.5116206E-8
actastrains	1	4.5116206E-8
actate	1	4.5116206E-8
actb	4	1.8046482E-7
actccaaggctctcaacgaa	1	4.5116206E-8
actd	7	3.1581345E-7
acted	360	1.6241835E-5
actess	1	4.5116206E-8
acteylated	1	4.5116206E-8
actgacgaattcagccaccatggcgctcctgctgtgc	1	4.5116206E-8
actgattttg	1	4.5116206E-8
actgcgaagatccactga	1	4.5116206E-8
actggt	1	4.5116206E-8
actgtg	1	4.5116206E-8
actgtggctactcagctgtg	1	4.5116206E-8
acth	41	1.8497644E-6
actifed	1	4.5116206E-8
actillume	5	2.2558103E-7
actin	409	1.8452529E-5
actin-?-galactosidase	1	4.5116206E-8
actin-activated	2	9.023241E-8
actin-associated	1	4.5116206E-8
actin-based	13	5.865107E-7
actin-binding	17	7.669755E-7
actin-containing	1	4.5116206E-8
actin-cytoskeletal	1	4.5116206E-8
actin-dependent	3	1.3534861E-7
actin-depolymerizing	1	4.5116206E-8
actin-filament	1	4.5116206E-8
actin-filled	1	4.5116206E-8
actin-fragmin	1	4.5116206E-8
actin-like	1	4.5116206E-8
actin-modulating	1	4.5116206E-8
actin-myosin	5	2.2558103E-7
actin-rich	3	1.3534861E-7
acting	1027	4.6334346E-5
acting-class	2	9.023241E-8
acting-out	2	9.023241E-8
acting-wise	4	1.8046482E-7
actinic	8	3.6092965E-7
actinide	1	4.5116206E-8
actinin	1	4.5116206E-8
actinobacillus	1	4.5116206E-8
actinobacteria	7	3.1581345E-7
actinobacterial	1	4.5116206E-8
actinomycetales	2	9.023241E-8
actinomycete	4	1.8046482E-7
actinomycetemcomitans	2	9.023241E-8
actinomycetes	9	4.0604587E-7
actinomycin	18	8.1209174E-7
actinomycin-based	1	4.5116206E-8
actinopterygian	2	9.023241E-8
actinopterygians	1	4.5116206E-8
actinopterygii	1	4.5116206E-8
actinorhodin	1	4.5116206E-8
actins	1	4.5116206E-8
actin–myosin	1	4.5116206E-8
action	3171	1.4306349E-4
action-adventure	4	1.8046482E-7
action-and-doing	2	9.023241E-8
action-and-goal	1	4.5116206E-8
action-comedy	1	4.5116206E-8
action-figure	3	1.3534861E-7
action-filled	1	4.5116206E-8
action-film	1	4.5116206E-8
action-movie	1	4.5116206E-8
action-oriented	2	9.023241E-8
action-packed	9	4.0604587E-7
action-performance	1	4.5116206E-8
action-plan	1	4.5116206E-8
action-related	1	4.5116206E-8
action-the	1	4.5116206E-8
action-thriller	1	4.5116206E-8
actionable	20	9.0232413E-7
actionalert	1	4.5116206E-8
actioner	1	4.5116206E-8
actioners	1	4.5116206E-8
actionless	1	4.5116206E-8
actionmeasurement	2	9.023241E-8
actions	1228	5.5402703E-5
actions-spending	1	4.5116206E-8
actiony	1	4.5116206E-8
activa	4	1.8046482E-7
activase	2	9.023241E-8
activatable	1	4.5116206E-8
activate	321	1.44823025E-5
activated	809	3.6499012E-5
activates	141	6.361385E-6
activating	111	5.007899E-6
activation	1750	7.895336E-5
activation-induced	13	5.865107E-7
activation-regulated	1	4.5116206E-8
activation-related	1	4.5116206E-8
activations	2	9.023241E-8
activationâ	1	4.5116206E-8
activator	130	5.8651067E-6
activators	71	3.2032506E-6
activats	1	4.5116206E-8
active	1700	7.669755E-5
active-control	1	4.5116206E-8
active-controlled	3	1.3534861E-7
active-duty	15	6.767431E-7
active-site	10	4.5116207E-7
actively	281	1.2677654E-5
actively-traded	1	4.5116206E-8
activelytraded	1	4.5116206E-8
activeperl	1	4.5116206E-8
actives	4	1.8046482E-7
activestate	1	4.5116206E-8
activewear	2	9.023241E-8
activex	9	4.0604587E-7
activie	1	4.5116206E-8
activies	1	4.5116206E-8
activin	5	2.2558103E-7
activision	1	4.5116206E-8
activism	78	3.5190642E-6
activist	172	7.759988E-6
activists	257	1.1594865E-5
activites	1	4.5116206E-8
activities	2199	9.921054E-5
activities-taking	1	4.5116206E-8
activities-terrorist	1	4.5116206E-8
activity	4304	1.9418016E-4
activity-based	5	2.2558103E-7
activity-center	1	4.5116206E-8
activity-dependent	11	4.962783E-7
activity-independent	2	9.023241E-8
activity-induced	1	4.5116206E-8
activity-labeling	1	4.5116206E-8
activity-plasmid	1	4.5116206E-8
activity-regarded	1	4.5116206E-8
activitybased	1	4.5116206E-8
activization	1	4.5116206E-8
activty	1	4.5116206E-8
actly	1	4.5116206E-8
actmutation	1	4.5116206E-8
acto	2	9.023241E-8
actof	2	9.023241E-8
actogram	2	9.023241E-8
actograms	3	1.3534861E-7
actomyosin	11	4.962783E-7
acton	19	8.572079E-7
actonel	3	1.3534861E-7
actor	825	3.722087E-5
actor-director	4	1.8046482E-7
actor-director-writer	1	4.5116206E-8
actor-essayist-blogger	1	4.5116206E-8
actor-lossage	1	4.5116206E-8
actor-politician	1	4.5116206E-8
actorboy	1	4.5116206E-8
actorcasting	1	4.5116206E-8
actors	703	3.1716692E-5
actors-playing-the-same-characters	1	4.5116206E-8
actors-turned-directors	1	4.5116206E-8
actory	2	9.023241E-8
actos	3	1.3534861E-7
actovegin	1	4.5116206E-8
actprotein	1	4.5116206E-8
actr	6	2.7069723E-7
actr-i	1	4.5116206E-8
actr-ii	1	4.5116206E-8
actress	472	2.1294849E-5
actress-waitress	2	9.023241E-8
actresses	90	4.0604587E-6
actresss	1	4.5116206E-8
actressy	1	4.5116206E-8
acts	763	3.4423665E-5
actttggatcattctatgcag	1	4.5116206E-8
actu	1	4.5116206E-8
actua	1	4.5116206E-8
actual	1947	8.7841254E-5
actual-vampire-seeing-and-slaying	1	4.5116206E-8
actuality	9	4.0604587E-7
actualize	1	4.5116206E-8
actualized	2	9.023241E-8
actually	9404	4.2427282E-4
actuallyl	1	4.5116206E-8
actuals	1	4.5116206E-8
actualy	4	1.8046482E-7
actuarial	49	2.2106942E-6
actuarial-based	1	4.5116206E-8
actuaries	22	9.925566E-7
actuaristas	2	9.023241E-8
actuary	25	1.1279052E-6
actuates	2	9.023241E-8
actuator	6	2.7069723E-7
actuators	1	4.5116206E-8
actully	1	4.5116206E-8
actus	2	9.023241E-8
actwas	1	4.5116206E-8
actwith	2	9.023241E-8
actwu	1	4.5116206E-8
acuesta	2	9.023241E-8
acuestén	1	4.5116206E-8
acuff	1	4.5116206E-8
acuity	18	8.1209174E-7
aculeatus	1	4.5116206E-8
acumen	29	1.30837E-6
acuolation	1	4.5116206E-8
acupressure	2	9.023241E-8
acupuncture	16	7.218593E-7
acupuncturist	1	4.5116206E-8
acupuncturists	2	9.023241E-8
acura	11	4.962783E-7
acure	1	4.5116206E-8
acutally	5	2.2558103E-7
acute	799	3.6047848E-5
acute-care	3	1.3534861E-7
acute-phase	3	1.3534861E-7
acutee	1	4.5116206E-8
acutely	50	2.2558104E-6
acuto	1	4.5116206E-8
acuview	1	4.5116206E-8
acuvue	4	1.8046482E-7
acuvue-vision	2	9.023241E-8
acuático	1	4.5116206E-8
acuña	2	9.023241E-8
acv	40	1.8046483E-6
acv-resistant	2	9.023241E-8
acv-susceptible	1	4.5116206E-8
acvb	4	1.8046482E-7
acvtivated	1	4.5116206E-8
acyclic	5	2.2558103E-7
acyclovir	5	2.2558103E-7
acyl	28	1.2632538E-6
acyl-acyl	1	4.5116206E-8
acyl-chain	1	4.5116206E-8
acyl-enzyme	1	4.5116206E-8
acylation	1	4.5116206E-8
acylcarnitine	2	9.023241E-8
acylcarnitines	3	1.3534861E-7
acylethanolamine	2	9.023241E-8
acylethanolamines	1	4.5116206E-8
acylglycerophospho-ethanolamine	1	4.5116206E-8
acyltransferase	3	1.3534861E-7
acyltransferases	1	4.5116206E-8
acyrthosiphon	2	9.023241E-8
acá	1	4.5116206E-8
acánsa	1	4.5116206E-8
ad	1647	7.4306394E-5
ad-adsx	5	2.2558103E-7
ad-based	1	4.5116206E-8
ad-busting	1	4.5116206E-8
ad-column	4	1.8046482E-7
ad-daar	1	4.5116206E-8
ad-driven	1	4.5116206E-8
ad-e	8	3.6092965E-7
ad-exec	1	4.5116206E-8
ad-free	2	9.023241E-8
ad-git	1	4.5116206E-8
ad-hoc	6	2.7069723E-7
ad-in	1	4.5116206E-8
ad-laden	1	4.5116206E-8
ad-lib	3	1.3534861E-7
ad-libbed	1	4.5116206E-8
ad-libbing	1	4.5116206E-8
ad-libitum	1	4.5116206E-8
ad-libs	1	4.5116206E-8
ad-m	55	2.4813914E-6
ad-maker	1	4.5116206E-8
ad-makers	2	9.023241E-8
ad-nad	2	9.023241E-8
ad-prey	1	4.5116206E-8
ad-revenue-sharing	1	4.5116206E-8
ad-sales	1	4.5116206E-8
ad-serving	1	4.5116206E-8
ad-skipping	3	1.3534861E-7
ad-snatchers	1	4.5116206E-8
ad-supported	1	4.5116206E-8
ad-tracking	1	4.5116206E-8
ad-transduced	9	4.0604587E-7
ad?	1	4.5116206E-8
ad?rvan	1	4.5116206E-8
ada	41	1.8497644E-6
adade	1	4.5116206E-8
adage	21	9.4744036E-7
adages	4	1.8046482E-7
adagia	2	9.023241E-8
adagio	1	4.5116206E-8
adair	5	2.2558103E-7
adaja	1	4.5116206E-8
adalar	1	4.5116206E-8
adam	428	1.9309737E-5
adamance	1	4.5116206E-8
adamant	58	2.61674E-6
adamantium	1	4.5116206E-8
adamantly	17	7.669755E-7
adamao	1	4.5116206E-8
adame	1	4.5116206E-8
adament	1	4.5116206E-8
adami	4	1.8046482E-7
adamo	6	2.7069723E-7
adamov	2	9.023241E-8
adams	330	1.4888348E-5
adamson	1	4.5116206E-8
adamu	1	4.5116206E-8
adana	1	4.5116206E-8
adao	2	9.023241E-8
adapator	1	4.5116206E-8
adaped	1	4.5116206E-8
adapt	210	9.474404E-6
adaptability	13	5.865107E-7
adaptable	25	1.1279052E-6
adaptamer	6	2.7069723E-7
adaptamers	3	1.3534861E-7
adaptation	243	1.0963238E-5
adaptation-and	1	4.5116206E-8
adaptations	69	3.1130182E-6
adaptec	1	4.5116206E-8
adapted	249	1.1233936E-5
adapter	65	2.9325533E-6
adapter-linked	2	9.023241E-8
adapter-related	1	4.5116206E-8
adapter-specific	1	4.5116206E-8
adapterized	1	4.5116206E-8
adapters	19	8.572079E-7
adapting	54	2.436275E-6
adaption	1	4.5116206E-8
adaptive	104	4.6920854E-6
adaptiveha	3	1.3534861E-7
adaptively	6	2.7069723E-7
adaptivity	1	4.5116206E-8
adaptor	51	2.3009266E-6
adaptor-amplified	1	4.5116206E-8
adaptor-ligated	1	4.5116206E-8
adaptor-specific	1	4.5116206E-8
adaptors	24	1.0827889E-6
adapts	11	4.962783E-7
adar	4	1.8046482E-7
adas	1	4.5116206E-8
adas-cog	31	1.3986024E-6
adas?	9	4.0604587E-7
adata	2	9.023241E-8
aday	1	4.5116206E-8
adb	2	9.023241E-8
adblock	1	4.5116206E-8
adbul	1	4.5116206E-8
adbusters	1	4.5116206E-8
adc	4	1.8046482E-7
adcaps	4	1.8046482E-7
adcc	2	9.023241E-8
adcell	1	4.5116206E-8
adco	1	4.5116206E-8
adcock	4	1.8046482E-7
adcose	1	4.5116206E-8
add	1782	8.039708E-5
add-a-bead	1	4.5116206E-8
add-in	1	4.5116206E-8
add-on	23	1.0376727E-6
add-ons	4	1.8046482E-7
addaia	1	4.5116206E-8
addams	25	1.1279052E-6
addario	2	9.023241E-8
adddecorations	1	4.5116206E-8
added	3186	1.4374024E-4
added-soul	1	4.5116206E-8
addeled	1	4.5116206E-8
addend	2	9.023241E-8
addenda	21	9.4744036E-7
addends	2	9.023241E-8
addendum	19	8.572079E-7
addendums	1	4.5116206E-8
adder	7	3.1581345E-7
adderal	1	4.5116206E-8
adderall	1	4.5116206E-8
adderley	1	4.5116206E-8
addhighlights	1	4.5116206E-8
addicated	1	4.5116206E-8
addicition	1	4.5116206E-8
addict	72	3.248367E-6
addicted	137	6.1809205E-6
addicting	5	2.2558103E-7
addiction	212	9.564636E-6
addiction-related	1	4.5116206E-8
addictions	27	1.2181375E-6
addictive	88	3.9702263E-6
addictiveness	2	9.023241E-8
addicts	69	3.1130182E-6
addie	3	1.3534861E-7
addies	1	4.5116206E-8
adding	964	4.3492022E-5
addington	1	4.5116206E-8
addison	45	2.0302293E-6
addition	3766	1.6990764E-4
additional	4313	1.945862E-4
additionally	395	1.7820901E-5
additionaly	2	9.023241E-8
additionnal	1	4.5116206E-8
additions	91	4.1055746E-6
additive	131	5.910223E-6
additive-plus-multiplicative	1	4.5116206E-8
additively	7	3.1581345E-7
additives	39	1.7595321E-6
additivity	6	2.7069723E-7
additized	1	4.5116206E-8
additon	1	4.5116206E-8
additonal	12	5.4139446E-7
addization	1	4.5116206E-8
addizione	1	4.5116206E-8
addi­tional	1	4.5116206E-8
addle	1	4.5116206E-8
addle-brained	1	4.5116206E-8
addled	24	1.0827889E-6
addlepated	4	1.8046482E-7
addlistener	1	4.5116206E-8
addo	22	9.925566E-7
addopark	1	4.5116206E-8
address	2678	1.20821205E-4
address-book	1	4.5116206E-8
address-change	1	4.5116206E-8
addressable	2	9.023241E-8
addressc	1	4.5116206E-8
addressed	633	2.855856E-5
addressee	3	1.3534861E-7
addressees	2	9.023241E-8
addresses	378	1.7053926E-5
addresses-one	1	4.5116206E-8
addressin	6	2.7069723E-7
addressinformation	1	4.5116206E-8
addressing	339	1.5294394E-5
addressins	2	9.023241E-8
addresss	1	4.5116206E-8
addrln	1	4.5116206E-8
adds	663	2.9912046E-5
addsol	1	4.5116206E-8
addtodesignreview	1	4.5116206E-8
adduce	2	9.023241E-8
adduced	10	4.5116207E-7
adduces	4	1.8046482E-7
adducing	4	1.8046482E-7
adducins	1	4.5116206E-8
adduct	10	4.5116207E-7
adducted	1	4.5116206E-8
adducting	1	4.5116206E-8
adductor	1	4.5116206E-8
adducts	23	1.0376727E-6
adduxerunt	1	4.5116206E-8
addy	56	2.5265076E-6
ade	50	2.2558104E-6
adeasy	2	9.023241E-8
adecco	2	9.023241E-8
adecrease	1	4.5116206E-8
adega	2	9.023241E-8
adegas	2	9.023241E-8
adeje	2	9.023241E-8
adel	1	4.5116206E-8
adelaide	13	5.865107E-7
adelantado	1	4.5116206E-8
adele	21	9.4744036E-7
adeliae	1	4.5116206E-8
adelie	1	4.5116206E-8
adelina	2	9.023241E-8
adelita	18	8.1209174E-7
adelitas	3	1.3534861E-7
adelman	3	1.3534861E-7
adelphia	69	3.1130182E-6
adelson	1	4.5116206E-8
adelstein	2	9.023241E-8
adema	2	9.023241E-8
ademonstrates	3	1.3534861E-7
aden	16	7.218593E-7
adena	12	5.4139446E-7
adenauer	1	4.5116206E-8
adenine	32	1.4437186E-6
adenine-labeled	1	4.5116206E-8
adenine-like	1	4.5116206E-8
adenine-requiring	2	9.023241E-8
adenines	7	3.1581345E-7
adeno	19	8.572079E-7
adeno-?	2	9.023241E-8
adeno-?gal	5	2.2558103E-7
adeno-associated	1	4.5116206E-8
adenocarcinoma	45	2.0302293E-6
adenocarcinomas	26	1.1730214E-6
adenoidal	2	9.023241E-8
adenoids	1	4.5116206E-8
adenoma	29	1.30837E-6
adenomas	17	7.669755E-7
adenomatous	8	3.6092965E-7
adenosine	52	2.3460427E-6
adenosine-binding	1	4.5116206E-8
adenosines	12	5.4139446E-7
adenosinetriphosphatase	1	4.5116206E-8
adenosis	1	4.5116206E-8
adenosylhomocysteine	2	9.023241E-8
adenosylmethionine	3	1.3534861E-7
adenoviral	182	8.211149E-6
adenoviral-mediated	6	2.7069723E-7
adenoviral-resistant	1	4.5116206E-8
adenovirally	2	9.023241E-8
adenovirus	88	3.9702263E-6
adenovirus-based	1	4.5116206E-8
adenovirus-infected	1	4.5116206E-8
adenovirus-mediated	11	4.962783E-7
adenovirus-microbead	4	1.8046482E-7
adenoviruses	13	5.865107E-7
adenylate	16	7.218593E-7
adenylate-uridylate-rich	1	4.5116206E-8
adenylated	2	9.023241E-8
adenylates	2	9.023241E-8
adenylation	5	2.2558103E-7
adenyly	1	4.5116206E-8
adenylyl	36	1.6241835E-6
adenylylated	4	1.8046482E-7
adeo	1	4.5116206E-8
adepicts	7	3.1581345E-7
adept	77	3.473948E-6
adeptly	3	1.3534861E-7
adeptness	1	4.5116206E-8
adepts	1	4.5116206E-8
adequacy	45	2.0302293E-6
adequate	496	2.2377639E-5
adequate-to-great	1	4.5116206E-8
adequately	223	1.0060914E-5
adescription	1	4.5116206E-8
adeshem	1	4.5116206E-8
adesktop	1	4.5116206E-8
adeus	2	9.023241E-8
adf	2	9.023241E-8
adflugasdemo	1	4.5116206E-8
adge	63	2.842321E-6
adgemicroarray	1	4.5116206E-8
adger	2	9.023241E-8
adh	32	1.4437186E-6
adh-f	1	4.5116206E-8
adh-r	1	4.5116206E-8
adha	1	4.5116206E-8
adhd	114	5.1432476E-6
adhd-obesity	1	4.5116206E-8
adherants	1	4.5116206E-8
adhere	96	4.3311557E-6
adhered	29	1.30837E-6
adherence	127	5.7297584E-6
adherens	2	9.023241E-8
adherent	116	5.23348E-6
adherents	33	1.4888349E-6
adheres	13	5.865107E-7
adherin	1	4.5116206E-8
adhering	29	1.30837E-6
adhesin	3	1.3534861E-7
adhesins	2	9.023241E-8
adhesion	287	1.29483515E-5
adhesion-related	1	4.5116206E-8
adhesions	7	3.1581345E-7
adhesive	65	2.9325533E-6
adhesiveness	2	9.023241E-8
adhesives	2	9.023241E-8
adhoc	4	1.8046482E-7
adhoccery	2	9.023241E-8
adhocist	1	4.5116206E-8
adhr	1	4.5116206E-8
adhregion	1	4.5116206E-8
adhuc	1	4.5116206E-8
adhumbla	2	9.023241E-8
adi	68	3.067902E-6
adiabatic	2	9.023241E-8
adiabne	1	4.5116206E-8
adiantaceae	2	9.023241E-8
adiantum	2	9.023241E-8
adidas	15	6.767431E-7
adieu	19	8.572079E-7
adieus	1	4.5116206E-8
adieux	1	4.5116206E-8
adifferent	2	9.023241E-8
adige	6	2.7069723E-7
adiii	2	9.023241E-8
adil	5	2.2558103E-7
adin	3	1.3534861E-7
adina	3	1.3534861E-7
adinath	3	1.3534861E-7
adinspection	1	4.5116206E-8
adioh	1	4.5116206E-8
adios	10	4.5116207E-7
adipic	1	4.5116206E-8
adipocyte	11	4.962783E-7
adipocyte-derived	1	4.5116206E-8
adipocytes	26	1.1730214E-6
adipocytic	4	1.8046482E-7
adipogenesis	2	9.023241E-8
adipogenic	2	9.023241E-8
adiponectin	12	5.4139446E-7
adipose	27	1.2181375E-6
adiposity	19	8.572079E-7
adirondack	17	7.669755E-7
adirondacks	16	7.218593E-7
adis	9	4.0604587E-7
adisease-detection	1	4.5116206E-8
aditional	3	1.3534861E-7
adivinanzas	3	1.3534861E-7
adiyaman	1	4.5116206E-8
adiós	1	4.5116206E-8
adj	53	2.391159E-6
adjacencies	2	9.023241E-8
adjacency	1	4.5116206E-8
adjacent	667	3.009251E-5
adjacenting	1	4.5116206E-8
adjacently	1	4.5116206E-8
adjangba	1	4.5116206E-8
adjani	2	9.023241E-8
adjectival	12	5.4139446E-7
adjectivally	4	1.8046482E-7
adjective	128	5.7748744E-6
adjective-abuser	1	4.5116206E-8
adjective-names	1	4.5116206E-8
adjectives	93	4.1958074E-6
adjectivewise	1	4.5116206E-8
adjectivising	2	9.023241E-8
adjoin	2	9.023241E-8
adjoined	2	9.023241E-8
adjoining	104	4.6920854E-6
adjoins	12	5.4139446E-7
adjourn	14	6.316269E-7
adjourned	11	4.962783E-7
adjourning	3	1.3534861E-7
adjournment	5	2.2558103E-7
adjourns	7	3.1581345E-7
adjrun	1	4.5116206E-8
adjudged	3	1.3534861E-7
adjudges	1	4.5116206E-8
adjudicate	14	6.316269E-7
adjudicated	30	1.3534863E-6
adjudicates	3	1.3534861E-7
adjudicating	2	9.023241E-8
adjudication	31	1.3986024E-6
adjudicative	4	1.8046482E-7
adjudicator	4	1.8046482E-7
adjudicatory	4	1.8046482E-7
adjunct	38	1.7144158E-6
adjunctive	1	4.5116206E-8
adjuncts	5	2.2558103E-7
adjured	1	4.5116206E-8
adjurn	1	4.5116206E-8
adjust	283	1.2767887E-5
adjustability	2	9.023241E-8
adjustable	59	2.6618561E-6
adjusted	627	2.8287861E-5
adjusted-rates	1	4.5116206E-8
adjuster	9	4.0604587E-7
adjusters	5	2.2558103E-7
adjusting	178	8.0306845E-6
adjustment	334	1.5068813E-5
adjustments	187	8.43673E-6
adjustn	2	9.023241E-8
adjusts	40	1.8046483E-6
adjustvar	2	9.023241E-8
adjutant	3	1.3534861E-7
adjuvant	70	3.1581344E-6
adjuvant-induced	2	9.023241E-8
adjuvants	5	2.2558103E-7
adkins	34	1.533951E-6
adl	6	2.7069723E-7
adlai	15	6.767431E-7
adler	43	1.939997E-6
adlestrop	12	5.4139446E-7
adleta	1	4.5116206E-8
adlon	1	4.5116206E-8
adlum	2	9.023241E-8
adm	28	1.2632538E-6
admaker	1	4.5116206E-8
admakers	1	4.5116206E-8
adman	8	3.6092965E-7
adme	4	1.8046482E-7
admen	2	9.023241E-8
admin	27	1.2181375E-6
administaff	1	4.5116206E-8
administer	97	4.376272E-6
administered	336	1.5159046E-5
administering	69	3.1130182E-6
administers	38	1.7144158E-6
administrate	4	1.8046482E-7
administrated	2	9.023241E-8
administrating	3	1.3534861E-7
administration	3412	1.539365E-4
administration-sponsored	1	4.5116206E-8
administrationn	1	4.5116206E-8
administrations	84	3.7897614E-6
administrative	484	2.1836244E-5
administrative-type	1	4.5116206E-8
administratively	13	5.865107E-7
administrator	623	2.8107397E-5
administratorand	1	4.5116206E-8
administrators	182	8.211149E-6
administratorshall	4	1.8046482E-7
administrivia	2	9.023241E-8
administrtation	1	4.5116206E-8
admins	5	2.2558103E-7
adminster	1	4.5116206E-8
adminstration	2	9.023241E-8
adminstrator	1	4.5116206E-8
adminwise	1	4.5116206E-8
adminy	1	4.5116206E-8
admirable	116	5.23348E-6
admirably	44	1.9851132E-6
admiral	68	3.067902E-6
admirals	7	3.1581345E-7
admiralty	5	2.2558103E-7
admirans	1	4.5116206E-8
admirari	1	4.5116206E-8
admiration	107	4.827434E-6
admire	220	9.925566E-6
admired	155	6.993012E-6
admirer	20	9.0232413E-7
admirers	55	2.4813914E-6
admires	21	9.4744036E-7
admiring	65	2.9325533E-6
admiringly	10	4.5116207E-7
admir­able	1	4.5116206E-8
admissibility	13	5.865107E-7
admissible	13	5.865107E-7
admission	536	2.4182287E-5
admissions	331	1.4933465E-5
admissionsall	1	4.5116206E-8
admisssions	1	4.5116206E-8
admist	1	4.5116206E-8
admit	819	3.6950172E-5
admitedly	1	4.5116206E-8
admitprecisely	1	4.5116206E-8
admits	263	1.1865563E-5
admittance	6	2.7069723E-7
admitted	645	2.9099954E-5
admittedly	169	7.624639E-6
admittedpostoperatively	1	4.5116206E-8
admittedto	1	4.5116206E-8
admittees	1	4.5116206E-8
admitting	144	6.496734E-6
admixed	1	4.5116206E-8
admixture	12	5.4139446E-7
admixtures	2	9.023241E-8
admnistration	1	4.5116206E-8
admonish	6	2.7069723E-7
admonished	22	9.925566E-7
admonishes	8	3.6092965E-7
admonishing	4	1.8046482E-7
admonishment	2	9.023241E-8
admonition	23	1.0376727E-6
admonitione	1	4.5116206E-8
admonitions	8	3.6092965E-7
admonitor	1	4.5116206E-8
admonitory	4	1.8046482E-7
adn	11	4.962783E-7
adna	21	9.4744036E-7
adnan	9	4.0604587E-7
adnd	2	9.023241E-8
ado	15	6.767431E-7
adobe	100	4.511621E-6
adobepdf	1	4.5116206E-8
adoberas	1	4.5116206E-8
adobo	2	9.023241E-8
adoke	1	4.5116206E-8
adol	5	2.2558103E-7
adolesc	3	1.3534861E-7
adolescence	80	3.6092965E-6
adolescencia	1	4.5116206E-8
adolescent	141	6.361385E-6
adolescent-adventure	1	4.5116206E-8
adolescent-angsty	1	4.5116206E-8
adolescent-use	1	4.5116206E-8
adolescents	119	5.3688286E-6
adolescents-at-heart	1	4.5116206E-8
adolesence	1	4.5116206E-8
adolf	51	2.3009266E-6
adolfo	4	1.8046482E-7
adolph	12	5.4139446E-7
adolphe	3	1.3534861E-7
adolsecent	1	4.5116206E-8
adomet	5	2.2558103E-7
adonais	1	4.5116206E-8
adonay	1	4.5116206E-8
adone	2	9.023241E-8
adonis	5	2.2558103E-7
adonitol	1	4.5116206E-8
adopt	315	1.4211605E-5
adopt-a	1	4.5116206E-8
adoptable	1	4.5116206E-8
adopted	710	3.2032505E-5
adopted-to	1	4.5116206E-8
adoptee	1	4.5116206E-8
adoptees	3	1.3534861E-7
adopter	3	1.3534861E-7
adopters	8	3.6092965E-7
adopting	135	6.0906877E-6
adoption	199	8.978125E-6
adoption-related	2	9.023241E-8
adoptions	11	4.962783E-7
adoptive	52	2.3460427E-6
adoptively	7	3.1581345E-7
adoptively-transferred	1	4.5116206E-8
adopts	51	2.3009266E-6
adoquín	1	4.5116206E-8
adora	2	9.023241E-8
adorability	3	1.3534861E-7
adorable	169	7.624639E-6
adorableness	6	2.7069723E-7
adorably	4	1.8046482E-7
adoran	1	4.5116206E-8
adoration	28	1.2632538E-6
adorations	1	4.5116206E-8
adorble	1	4.5116206E-8
adore	137	6.1809205E-6
adored	68	3.067902E-6
adores	21	9.4744036E-7
adoring	32	1.4437186E-6
adoringly	2	9.023241E-8
adorn	38	1.7144158E-6
adorned	37	1.6692996E-6
adorning	7	3.1581345E-7
adornment	5	2.2558103E-7
adornments	6	2.7069723E-7
adorno	10	4.5116207E-7
adorns	13	5.865107E-7
adowe	1	4.5116206E-8
adp	49	2.2106942E-6
adp-glucose	1	4.5116206E-8
adp-ribose	1	4.5116206E-8
adp-ribosylates	1	4.5116206E-8
adp-ribosylation	14	6.316269E-7
adpase	4	1.8046482E-7
adpated	1	4.5116206E-8
adpativeh	4	1.8046482E-7
adpnp	9	4.0604587E-7
adprt	3	1.3534861E-7
adr	72	3.248367E-6
adr-res	2	9.023241E-8
adr-sensitive	1	4.5116206E-8
adra	2	9.023241E-8
adrelevance	3	1.3534861E-7
adrenal	62	2.7972048E-6
adrenalectomized	26	1.1730214E-6
adrenalectomized-streptozotocin-injected-ad	1	4.5116206E-8
adrenalectomized-streptozotocin-injected-fasted	1	4.5116206E-8
adrenalectomy	100	4.511621E-6
adrenalin	12	5.4139446E-7
adrenaline	28	1.2632538E-6
adrenaline-happy	1	4.5116206E-8
adrenaline-induced	1	4.5116206E-8
adrenaline-pumping	1	4.5116206E-8
adrenaline-rush	1	4.5116206E-8
adrenaline-soaked	1	4.5116206E-8
adrenaline-swamped	1	4.5116206E-8
adrenals	1	4.5116206E-8
adrenergic	57	2.5716238E-6
adrenergic-receptor	1	4.5116206E-8
adrenergic-renin-angiotensin	1	4.5116206E-8
adrenergicand	1	4.5116206E-8
adrenoceptor	2	9.023241E-8
adrenocortical	3	1.3534861E-7
adrenocorticotrophic	1	4.5116206E-8
adrenocorticotrophin	2	9.023241E-8
adrenocorticotropic	2	9.023241E-8
adrenoreceptor	1	4.5116206E-8
adressing	2	9.023241E-8
adriaen	3	1.3534861E-7
adriaensz	1	4.5116206E-8
adriamycin	5	2.2558103E-7
adrian	63	2.842321E-6
adriana	6	2.7069723E-7
adriane	1	4.5116206E-8
adrianne	3	1.3534861E-7
adriano	1	4.5116206E-8
adrianople	2	9.023241E-8
adrianou	6	2.7069723E-7
adrian­ople	1	4.5116206E-8
adriatic	20	9.0232413E-7
adrien	13	5.865107E-7
adrienne	8	3.6092965E-7
adrift	28	1.2632538E-6
adroit	8	3.6092965E-7
adroitly	14	6.316269E-7
ads	843	3.8032962E-5
ads-no	1	4.5116206E-8
adscendit	2	9.023241E-8
adsiduos	1	4.5116206E-8
adsl	4	1.8046482E-7
adsorb	2	9.023241E-8
adsorbed	15	6.767431E-7
adsorbent	1	4.5116206E-8
adsorption	27	1.2181375E-6
adsp	1	4.5116206E-8
adsubtract	2	9.023241E-8
adsurdity	1	4.5116206E-8
adsx	20	9.0232413E-7
adsx-nad	1	4.5116206E-8
adu	1	4.5116206E-8
aduana	3	1.3534861E-7
adubato	4	1.8046482E-7
adulation	14	6.316269E-7
adulatory	8	3.6092965E-7
adult	1482	6.6862216E-5
adult-acting	1	4.5116206E-8
adult-book	1	4.5116206E-8
adult-care	1	4.5116206E-8
adult-child	3	1.3534861E-7
adult-development	1	4.5116206E-8
adult-directed	1	4.5116206E-8
adult-emergence	1	4.5116206E-8
adult-film	1	4.5116206E-8
adult-flavored	1	4.5116206E-8
adult-free	1	4.5116206E-8
adult-imposed	1	4.5116206E-8
adult-incest	1	4.5116206E-8
adult-like	1	4.5116206E-8
adult-onset	3	1.3534861E-7
adult-organized	1	4.5116206E-8
adult-oriented	5	2.2558103E-7
adult-quality	1	4.5116206E-8
adult-relationship	1	4.5116206E-8
adult-specific	1	4.5116206E-8
adult-structured	1	4.5116206E-8
adult-supervised	1	4.5116206E-8
adult-supremacy	1	4.5116206E-8
adult-themed	1	4.5116206E-8
adulterant	1	4.5116206E-8
adulterated	1	4.5116206E-8
adulterating	2	9.023241E-8
adulteration	1	4.5116206E-8
adulterator	1	4.5116206E-8
adulterer	14	6.316269E-7
adulterers	9	4.0604587E-7
adulteress	2	9.023241E-8
adulterous	34	1.533951E-6
adultery	166	7.4892905E-6
adulthood	124	5.5944097E-6
adultiness	1	4.5116206E-8
adultless	1	4.5116206E-8
adults	1060	4.7823178E-5
adults-only	5	2.2558103E-7
adulty	2	9.023241E-8
adult–	4	1.8046482E-7
adult–child	30	1.3534863E-6
adulyadeh	1	4.5116206E-8
adumbrated	4	1.8046482E-7
adumbrations	3	1.3534861E-7
adumim	1	4.5116206E-8
aduncity	1	4.5116206E-8
adup	4	1.8046482E-7
adur	1	4.5116206E-8
adurt	1	4.5116206E-8
adustion	1	4.5116206E-8
aduuka	1	4.5116206E-8
adv	103	4.6469695E-6
adv-t	1	4.5116206E-8
advance	844	3.807808E-5
advance-purchase	3	1.3534861E-7
advance-royalty	1	4.5116206E-8
advanced	712	3.2122738E-5
advanced-country	1	4.5116206E-8
advanced-placement	1	4.5116206E-8
advanced-stage	1	4.5116206E-8
advancement	85	3.8348776E-6
advancements	21	9.4744036E-7
advancepcs	1	4.5116206E-8
advances	305	1.3760443E-5
advancing	119	5.3688286E-6
advanta	1	4.5116206E-8
advantage	1345	6.0681297E-5
advantage-we	1	4.5116206E-8
advantaged	9	4.0604587E-7
advantageous	69	3.1130182E-6
advantageously	4	1.8046482E-7
advantages	383	1.7279508E-5
advective	1	4.5116206E-8
advenissent	1	4.5116206E-8
advent	155	6.993012E-6
adventis	1	4.5116206E-8
adventist	4	1.8046482E-7
adventists	2	9.023241E-8
adventitia	11	4.962783E-7
adventitial	1	4.5116206E-8
adventitious	1	4.5116206E-8
advents	1	4.5116206E-8
adventure	285	1.2858119E-5
adventure-drama	1	4.5116206E-8
adventure-tourism	1	4.5116206E-8
adventured	1	4.5116206E-8
adventureland	3	1.3534861E-7
adventurer	19	8.572079E-7
adventurers	21	9.4744036E-7
adventures	181	8.166034E-6
adventuresome	8	3.6092965E-7
adventuring	3	1.3534861E-7
adventurism	6	2.7069723E-7
adventurous	81	3.6544127E-6
adventurously	1	4.5116206E-8
adver	1	4.5116206E-8
adverb	31	1.3986024E-6
adverb-adjective	1	4.5116206E-8
adverbial	5	2.2558103E-7
adverbially	1	4.5116206E-8
adverbs	27	1.2181375E-6
adversarial	20	9.0232413E-7
adversaries	43	1.939997E-6
adversary	35	1.5790672E-6
adverse	437	1.9715782E-5
adversely	55	2.4813914E-6
adversities	1	4.5116206E-8
adversity	40	1.8046483E-6
adversitycakes	1	4.5116206E-8
advert	1	4.5116206E-8
adverting	1	4.5116206E-8
advertise	112	5.0530152E-6
advertised	138	6.2260365E-6
advertisement	123	5.5492933E-6
advertisement-free	1	4.5116206E-8
advertisementb	1	4.5116206E-8
advertisements	131	5.910223E-6
advertiser	20	9.0232413E-7
advertisers	177	7.985569E-6
advertises	15	6.767431E-7
advertising	954	4.304086E-5
advertising-based	1	4.5116206E-8
advertising-copywriter-cum-pope	1	4.5116206E-8
advertising-driven	1	4.5116206E-8
advertising-supported	2	9.023241E-8
advertisser	1	4.5116206E-8
advertizing	1	4.5116206E-8
advertorial	5	2.2558103E-7
advertorials	4	1.8046482E-7
advertrise	1	4.5116206E-8
adverts	1	4.5116206E-8
advi	1	4.5116206E-8
advice	1119	5.0485036E-5
advice-giving	1	4.5116206E-8
advice-hounds	1	4.5116206E-8
advice-seeker	1	4.5116206E-8
advices	2	9.023241E-8
advil	10	4.5116207E-7
advino	1	4.5116206E-8
adviosed	1	4.5116206E-8
advis	1	4.5116206E-8
advisability	4	1.8046482E-7
advisable	55	2.4813914E-6
advise	185	8.346498E-6
advised	309	1.3940908E-5
advisedly	2	9.023241E-8
advisement	2	9.023241E-8
adviser	297	1.3399514E-5
advisers	268	1.2091144E-5
advises	107	4.827434E-6
advising	95	4.2860397E-6
advisings	1	4.5116206E-8
advisor	156	7.0381284E-6
advisories	31	1.3986024E-6
advisors	147	6.632082E-6
advisory	268	1.2091144E-5
advocacy	244	1.1008355E-5
advocate	314	1.4166489E-5
advocate-expressed	1	4.5116206E-8
advocated	93	4.1958074E-6
advocates	443	1.9986479E-5
advocating	85	3.8348776E-6
advoctaes	1	4.5116206E-8
advokaat	2	9.023241E-8
advt	1	4.5116206E-8
adwan	26	1.1730214E-6
adwatch	1	4.5116206E-8
adweek	2	9.023241E-8
adx-stz	3	1.3534861E-7
adx-stz-fast	4	1.8046482E-7
adygea	1	4.5116206E-8
adze	1	4.5116206E-8
adzuki	1	4.5116206E-8
ad­­vanced	1	4.5116206E-8
adán	1	4.5116206E-8
adèle	1	4.5116206E-8
adélie	3	1.3534861E-7
adélies	4	1.8046482E-7
ae	90	4.0604587E-6
aea	4	1.8046482E-7
aeaea	1	4.5116206E-8
aebersole	1	4.5116206E-8
aebi	1	4.5116206E-8
aebsf	1	4.5116206E-8
aec	15	6.767431E-7
aecer	1	4.5116206E-8
aecom	6	2.7069723E-7
aect	7	3.1581345E-7
aected	5	2.2558103E-7
aecting	5	2.2558103E-7
aection	5	2.2558103E-7
aectionate	2	9.023241E-8
aects	6	2.7069723E-7
aedes	3	1.3534861E-7
aedicule	1	4.5116206E-8
aeegintrs	1	4.5116206E-8
aeesome	1	4.5116206E-8
aeg	6	2.7069723E-7
aegean	109	4.9176665E-6
aegina	4	1.8046482E-7
aegis	7	3.1581345E-7
aegon	1	4.5116206E-8
aegypti	1	4.5116206E-8
aehy	1	4.5116206E-8
aei	7	3.1581345E-7
aek	1	4.5116206E-8
ael	1	4.5116206E-8
aelfric	4	1.8046482E-7
aelfwine	3	1.3534861E-7
aelia	3	1.3534861E-7
aeneid	4	1.8046482E-7
aeneus	1	4.5116206E-8
aenlle	1	4.5116206E-8
aeo	19	8.572079E-7
aeolians	1	4.5116206E-8
aeolicus	17	7.669755E-7
aeon	4	1.8046482E-7
aeons	2	9.023241E-8
aep	4	1.8046482E-7
aer	7	3.1581345E-7
aer-a	1	4.5116206E-8
aer-d	2	9.023241E-8
aerate	10	4.5116207E-7
aerated	16	7.218593E-7
aeration	34	1.533951E-6
aerial	69	3.1130182E-6
aerialist	1	4.5116206E-8
aerially	2	9.023241E-8
aerials	1	4.5116206E-8
aerie	5	2.2558103E-7
aeries	1	4.5116206E-8
aerio	1	4.5116206E-8
aero	12	5.4139446E-7
aero-engine	2	9.023241E-8
aerobatics	1	4.5116206E-8
aerobed	2	9.023241E-8
aerobes	1	4.5116206E-8
aerobic	89	4.0153423E-6
aerobic-type	1	4.5116206E-8
aerobically	4	1.8046482E-7
aerobicise	1	4.5116206E-8
aerobics	161	7.2637094E-6
aerodigestive	3	1.3534861E-7
aerodium	1	4.5116206E-8
aerodrome	3	1.3534861E-7
aerodynamic	12	5.4139446E-7
aerodynamics	7	3.1581345E-7
aerodyne	1	4.5116206E-8
aerogenes	2	9.023241E-8
aeromax	1	4.5116206E-8
aerometric	1	4.5116206E-8
aeromonas	9	4.0604587E-7
aeromousse	1	4.5116206E-8
aeronautic	4	1.8046482E-7
aeronautical	24	1.0827889E-6
aeronautics	20	9.0232413E-7
aeroperu	1	4.5116206E-8
aerophilum	3	1.3534861E-7
aeroplane	4	1.8046482E-7
aeroporto	1	4.5116206E-8
aeropyrum	9	4.0604587E-7
aeros	1	4.5116206E-8
aerosmith	28	1.2632538E-6
aerosol	59	2.6618561E-6
aerosoles	9	4.0604587E-7
aerosolization	7	3.1581345E-7
aerosolized	8	3.6092965E-7
aerosols	22	9.925566E-7
aerospace	66	2.9776697E-6
aerospatiale	1	4.5116206E-8
aerostar	1	4.5116206E-8
aerpe	1	4.5116206E-8
aertoercken	1	4.5116206E-8
aerts	14	6.316269E-7
aeruginos	1	4.5116206E-8
aeruginosa	145	6.54185E-6
aeruginosaand	1	4.5116206E-8
aeruginosaperiplasm	2	9.023241E-8
aerugionsa	1	4.5116206E-8
aeryn	7	3.1581345E-7
aeryn-oost	1	4.5116206E-8
aes	10	4.5116207E-7
aes-drafted	1	4.5116206E-8
aeschbacher	1	4.5116206E-8
aeschylus	3	1.3534861E-7
aesculap	1	4.5116206E-8
aeshma	7	3.1581345E-7
aesop	8	3.6092965E-7
aesopian	1	4.5116206E-8
aestheic	1	4.5116206E-8
aesthete	8	3.6092965E-7
aesthete-mystic	1	4.5116206E-8
aesthetes	1	4.5116206E-8
aesthetic	216	9.7451E-6
aesthetically	21	9.4744036E-7
aestheticienne	1	4.5116206E-8
aestheticism	3	1.3534861E-7
aestheticizing	4	1.8046482E-7
aesthetics	53	2.391159E-6
aestivum	2	9.023241E-8
aeterna	1	4.5116206E-8
aetheistic	1	4.5116206E-8
aether	1	4.5116206E-8
aethiopis	1	4.5116206E-8
aetiological	1	4.5116206E-8
aetiology	7	3.1581345E-7
aetna	37	1.6692996E-6
aev	5	2.2558103E-7
ae­gean	1	4.5116206E-8
af	266	1.2000911E-5
afa	40	1.8046483E-6
afac	1	4.5116206E-8
afacility	1	4.5116206E-8
afaic	3	1.3534861E-7
afaict	1	4.5116206E-8
afaik	31	1.3986024E-6
afar	39	1.7595321E-6
afarensis	1	4.5116206E-8
afatk	1	4.5116206E-8
afb	12	5.4139446E-7
afc	24	1.0827889E-6
afca	1	4.5116206E-8
afcs	1	4.5116206E-8
afdc	28	1.2632538E-6
afdc-unemployed	1	4.5116206E-8
afeared	6	2.7069723E-7
afer	1	4.5116206E-8
aferguson	1	4.5116206E-8
afew	3	1.3534861E-7
afewerki	1	4.5116206E-8
aff	2	9.023241E-8
affability	4	1.8046482E-7
affable	19	8.572079E-7
affably	3	1.3534861E-7
affair	682	3.0769253E-5
affaire	23	1.0376727E-6
affaires	3	1.3534861E-7
affairs	684	3.0859486E-5
affairspartnership	1	4.5116206E-8
affairsthe	1	4.5116206E-8
affarisc	1	4.5116206E-8
affc	1	4.5116206E-8
affeared	1	4.5116206E-8
affect	1359	6.131292E-5
affectation	8	3.6092965E-7
affectations	4	1.8046482E-7
affected	1363	6.149339E-5
affectedunits	1	4.5116206E-8
affecting	341	1.5384627E-5
affectingly	1	4.5116206E-8
affection	199	8.978125E-6
affectionat	1	4.5116206E-8
affectionate	53	2.391159E-6
affectionately	24	1.0827889E-6
affections	25	1.1279052E-6
affective	12	5.4139446E-7
affectivity	1	4.5116206E-8
affectless	9	4.0604587E-7
affectlessness	3	1.3534861E-7
affects	399	1.8001367E-5
affen	1	4.5116206E-8
afferent	44	1.9851132E-6
afferents	59	2.6618561E-6
afffection	1	4.5116206E-8
affi	2	9.023241E-8
affianced	1	4.5116206E-8
affiche	1	4.5116206E-8
afficionado	1	4.5116206E-8
affictions	1	4.5116206E-8
affidavit	102	4.601853E-6
affidavits	15	6.767431E-7
affigel	6	2.7069723E-7
affiliate	73	3.2934831E-6
affiliated	108	4.87255E-6
affiliateid	1	4.5116206E-8
affiliates	45	2.0302293E-6
affiliating	1	4.5116206E-8
affiliation	63	2.842321E-6
affiliations	13	5.865107E-7
affine	1	4.5116206E-8
affinities	62	2.7972048E-6
affinity	514	2.318973E-5
affinity-purification	1	4.5116206E-8
affinity-purified	22	9.925566E-7
affirm	39	1.7595321E-6
affirmation	40	1.8046483E-6
affirmations	3	1.3534861E-7
affirmative	314	1.4166489E-5
affirmative-action	20	9.0232413E-7
affirmative-action-friendly	1	4.5116206E-8
affirmatively	6	2.7069723E-7
affirmed	44	1.9851132E-6
affirming	29	1.30837E-6
affirms	12	5.4139446E-7
affix	17	7.669755E-7
affixations	3	1.3534861E-7
affixed	24	1.0827889E-6
affixes	5	2.2558103E-7
affixing	4	1.8046482E-7
afflatus	2	9.023241E-8
affleck	88	3.9702263E-6
afflecks	2	9.023241E-8
afflerbach	3	1.3534861E-7
affliate	1	4.5116206E-8
afflict	17	7.669755E-7
afflicted	76	3.4288316E-6
afflicting	15	6.767431E-7
affliction	31	1.3986024E-6
afflictions	9	4.0604587E-7
afflicts	19	8.572079E-7
affluence	20	9.0232413E-7
affluent	115	5.188364E-6
affluentials	1	4.5116206E-8
affluents	1	4.5116206E-8
affluenza	1	4.5116206E-8
afford	919	4.1461793E-5
affordability	16	7.218593E-7
affordabilty	1	4.5116206E-8
affordable	171	7.714872E-6
affordably	6	2.7069723E-7
afforded	74	3.3385993E-6
affording	24	1.0827889E-6
affords	51	2.3009266E-6
affricate	1	4.5116206E-8
affront	38	1.7144158E-6
affronted	2	9.023241E-8
affronts	1	4.5116206E-8
affusion	2	9.023241E-8
affusions	1	4.5116206E-8
affx	2	9.023241E-8
affy	1	4.5116206E-8
affymetirx	1	4.5116206E-8
affymetnx	1	4.5116206E-8
affymetrix	365	1.6467415E-5
affymetrx	1	4.5116206E-8
afg	3	1.3534861E-7
afganistan	2	9.023241E-8
afge	2	9.023241E-8
afghan	254	1.1459517E-5
afghan-army	2	9.023241E-8
afghan-austin	1	4.5116206E-8
afghan-based	2	9.023241E-8
afghan-bomb	3	1.3534861E-7
afghan-islam	1	4.5116206E-8
afghan-journal	2	9.023241E-8
afghan-military	1	4.5116206E-8
afghan-security	1	4.5116206E-8
afghan-u	1	4.5116206E-8
afghan-valley	1	4.5116206E-8
afghani	14	6.316269E-7
afghania	1	4.5116206E-8
afghanis	3	1.3534861E-7
afghanistan	902	4.069482E-5
afghanistan-a	1	4.5116206E-8
afghanistan-based	3	1.3534861E-7
afghanistan-in	1	4.5116206E-8
afghanistanis	1	4.5116206E-8
afghans	38	1.7144158E-6
afghans-meet	2	9.023241E-8
afgp	2	9.023241E-8
afi	32	1.4437186E-6
afia	1	4.5116206E-8
aficionado	12	5.4139446E-7
aficionados	42	1.8948807E-6
afield	25	1.1279052E-6
afif	1	4.5116206E-8
afilliate	1	4.5116206E-8
afire	5	2.2558103E-7
afits	1	4.5116206E-8
afix	1	4.5116206E-8
afl	8	3.6092965E-7
afl-cio	75	3.3837155E-6
afl-cio-organized	1	4.5116206E-8
afl-nfl	1	4.5116206E-8
aflac	2	9.023241E-8
aflame	4	1.8046482E-7
aflii	3	1.3534861E-7
aflitos	3	1.3534861E-7
afloat	52	2.3460427E-6
aflp	19	8.572079E-7
aflp-based	1	4.5116206E-8
aflps	1	4.5116206E-8
aflutter	3	1.3534861E-7
afm	2	9.023241E-8
afmb	1	4.5116206E-8
afmd	1	4.5116206E-8
afo	1	4.5116206E-8
afonsin	1	4.5116206E-8
afonso	15	6.767431E-7
afoot	35	1.5790672E-6
afor	5	2.2558103E-7
afore	2	9.023241E-8
afore-mentioned	1	4.5116206E-8
aforementioned	88	3.9702263E-6
aforesaid	5	2.2558103E-7
aforethought	5	2.2558103E-7
aform	1	4.5116206E-8
afoul	34	1.533951E-6
afp	2	9.023241E-8
afquarterly	1	4.5116206E-8
afr	1	4.5116206E-8
afraid	917	4.137156E-5
aframomum	5	2.2558103E-7
afresh	11	4.962783E-7
afri	3	1.3534861E-7
afriad	1	4.5116206E-8
africa	918	4.141668E-5
africa-wide	1	4.5116206E-8
africa-with-intention-of-getting-soul	1	4.5116206E-8
africaine	1	4.5116206E-8
african	1148	5.1793406E-5
african-american	2	9.023241E-8
african-artifacts	1	4.5116206E-8
african-descended	1	4.5116206E-8
african-grown	1	4.5116206E-8
african-style	1	4.5116206E-8
africana	39	1.7595321E-6
africanamericans	1	4.5116206E-8
africanism	1	4.5116206E-8
africanist	2	9.023241E-8
africanity	2	9.023241E-8
africanize	1	4.5116206E-8
africanoodian	1	4.5116206E-8
africans	86	3.879994E-6
africare	1	4.5116206E-8
africas	1	4.5116206E-8
africaworld	1	4.5116206E-8
afridi	1	4.5116206E-8
afriend	3	1.3534861E-7
afrika	1	4.5116206E-8
afrikaans	17	7.669755E-7
afrikan	1	4.5116206E-8
afrikaner	3	1.3534861E-7
afrikaners	3	1.3534861E-7
afrikas	1	4.5116206E-8
afriyachts	1	4.5116206E-8
afro	47	2.1204617E-6
afro-futurist	1	4.5116206E-8
afro-pop	2	9.023241E-8
afroamerican	1	4.5116206E-8
afrocentric	7	3.1581345E-7
afrocentrism	3	1.3534861E-7
afrocentrist	1	4.5116206E-8
afrocentrists	3	1.3534861E-7
afroed	1	4.5116206E-8
afront	1	4.5116206E-8
afrophile	2	9.023241E-8
afropick	1	4.5116206E-8
afros	1	4.5116206E-8
afs	2	9.023241E-8
afsa	3	1.3534861E-7
afsc	1	4.5116206E-8
afscme	1	4.5116206E-8
afshin	1	4.5116206E-8
afsluitdijk	2	9.023241E-8
aft	16	7.218593E-7
afta	2	9.023241E-8
after	24113	0.0010878871
after-action	5	2.2558103E-7
after-after-party	1	4.5116206E-8
after-birth	1	4.5116206E-8
after-care	1	4.5116206E-8
after-college	1	4.5116206E-8
after-dark	4	1.8046482E-7
after-days	1	4.5116206E-8
after-death	1	4.5116206E-8
after-dinner	10	4.5116207E-7
after-effect	1	4.5116206E-8
after-effects	2	9.023241E-8
after-hours	21	9.4744036E-7
after-life	2	9.023241E-8
after-market	2	9.023241E-8
after-movie	1	4.5116206E-8
after-office	1	4.5116206E-8
after-party	1	4.5116206E-8
after-purchase	6	2.7069723E-7
after-sales	3	1.3534861E-7
after-school	22	9.925566E-7
after-shave	1	4.5116206E-8
after-tax	13	5.865107E-7
after-the-fact	3	1.3534861E-7
after-the-rapture	1	4.5116206E-8
after-wit	1	4.5116206E-8
after-work	4	1.8046482E-7
afteraction	1	4.5116206E-8
afteraffects	1	4.5116206E-8
afterall	5	2.2558103E-7
afterbirth	1	4.5116206E-8
afterburn	1	4.5116206E-8
afterburner	3	1.3534861E-7
afterburners	2	9.023241E-8
aftercare	1	4.5116206E-8
aftercare-follow-up	1	4.5116206E-8
afterday	1	4.5116206E-8
aftereffect	2	9.023241E-8
aftereffects	6	2.7069723E-7
afterewards	1	4.5116206E-8
afterglow	16	7.218593E-7
afterimage	2	9.023241E-8
afterlife	41	1.8497644E-6
afterload	4	1.8046482E-7
aftermarket	3	1.3534861E-7
aftermarkof	1	4.5116206E-8
aftermath	174	7.85022E-6
aftermaths	1	4.5116206E-8
afternoon	1090	4.9176666E-5
afternoon-drive	1	4.5116206E-8
afternoons	75	3.3837155E-6
afternovember	1	4.5116206E-8
afteroon	1	4.5116206E-8
afterparties	1	4.5116206E-8
afterplay	1	4.5116206E-8
afters	1	4.5116206E-8
afterschool	5	2.2558103E-7
aftershave	1	4.5116206E-8
aftershock	5	2.2558103E-7
aftershocks	19	8.572079E-7
aftertaste	15	6.767431E-7
aftertax	2	9.023241E-8
afterthefact	1	4.5116206E-8
afterthought	24	1.0827889E-6
afterthoughts	4	1.8046482E-7
afterward	203	9.15859E-6
afterwards	228	1.0286495E-5
afterword	8	3.6092965E-7
afterwords	1	4.5116206E-8
afterwork	1	4.5116206E-8
afteryou	1	4.5116206E-8
aftra	1	4.5116206E-8
aftrer	1	4.5116206E-8
aftyr	1	4.5116206E-8
afu	2	9.023241E-8
afuer	1	4.5116206E-8
afuera	1	4.5116206E-8
aful	1	4.5116206E-8
afunny	1	4.5116206E-8
afw	1	4.5116206E-8
afx	1	4.5116206E-8
afyon	1	4.5116206E-8
ag	220	9.925566E-6
ag-gt	1	4.5116206E-8
ag-pandering	1	4.5116206E-8
ag-specific	1	4.5116206E-8
ag-stuff	1	4.5116206E-8
aga	51	2.3009266E-6
agaa	1	4.5116206E-8
agaaattgccgttgcagtgac	1	4.5116206E-8
agaacagcaagtgct	1	4.5116206E-8
agaaggagcaggacaccagc	1	4.5116206E-8
agac	3	1.3534861E-7
agacacaatcgactgaagg	1	4.5116206E-8
agacattgacttagctgtggat	1	4.5116206E-8
agacgfm	2	9.023241E-8
agacuugaggucggucaacguguac	1	4.5116206E-8
agaete	3	1.3534861E-7
agaetis	2	9.023241E-8
agaggaagacactgttgagtag	1	4.5116206E-8
agaggtgctggtgccaac	1	4.5116206E-8
agahi	8	3.6092965E-7
agahst	1	4.5116206E-8
again	8244	3.7193802E-4
again-it	1	4.5116206E-8
again-off	1	4.5116206E-8
againand	1	4.5116206E-8
againe	1	4.5116206E-8
against	9487	4.2801746E-4
against-the-odds	1	4.5116206E-8
agaion	1	4.5116206E-8
agambiae	1	4.5116206E-8
agame	1	4.5116206E-8
agamemnon	14	6.316269E-7
agamenmon	1	4.5116206E-8
agammaglobulinemia	3	1.3534861E-7
agammemnon	3	1.3534861E-7
aganda	1	4.5116206E-8
aganist	1	4.5116206E-8
agapanthus	4	1.8046482E-7
agape	13	5.865107E-7
agapemone	1	4.5116206E-8
agar	147	6.632082E-6
agarase	1	4.5116206E-8
agarcia	3	1.3534861E-7
agaricus	1	4.5116206E-8
agarose	230	1.0376728E-5
agarose-cast	1	4.5116206E-8
agarose-coated	1	4.5116206E-8
agarose-formaldehyde	3	1.3534861E-7
agarose-gel	1	4.5116206E-8
agarrar	1	4.5116206E-8
agarwal	8	3.6092965E-7
agarwals	1	4.5116206E-8
agas	2	9.023241E-8
agassi	74	3.3385993E-6
agassiz	1	4.5116206E-8
agastache	1	4.5116206E-8
agat	5	2.2558103E-7
agatcc	1	4.5116206E-8
agatcccaggggtctgtgaaaatggagtgt	1	4.5116206E-8
agatct	1	4.5116206E-8
agatctgattctaaccatatcgagtgg	1	4.5116206E-8
agate	6	2.7069723E-7
agate-type	1	4.5116206E-8
agatep	1	4.5116206E-8
agateware	1	4.5116206E-8
agatgcgggcacggctgttcaagga	1	4.5116206E-8
agatgctggccatcataggg	1	4.5116206E-8
agatha	11	4.962783E-7
agathe-des	1	4.5116206E-8
agathism	1	4.5116206E-8
agathistic	1	4.5116206E-8
agavachado	2	9.023241E-8
agave	8	3.6092965E-7
agaves	1	4.5116206E-8
agawan	1	4.5116206E-8
agayne	1	4.5116206E-8
agazine	1	4.5116206E-8
agbayani	2	9.023241E-8
agbout	1	4.5116206E-8
agc	21	9.4744036E-7
agc-related	1	4.5116206E-8
agcactgtgttggcgtacag	1	4.5116206E-8
agcagatgtaggtcctgcacttg	1	4.5116206E-8
agccac	1	4.5116206E-8
agccagcagccggaaaactccagt	2	9.023241E-8
agccatcaatgataggatcca	1	4.5116206E-8
agccccccagcgtaaagat	1	4.5116206E-8
agcccgtgcagccatcagcc	2	9.023241E-8
agcctggatggctacgtaca	1	4.5116206E-8
agcn	3	1.3534861E-7
agcop	2	9.023241E-8
agcp	5	2.2558103E-7
agct	2	9.023241E-8
agctcagggagtacttcaaga	1	4.5116206E-8
agctcatcatgcagctcat	1	4.5116206E-8
agctctgcagcacaaactttaataaatccgaaac	1	4.5116206E-8
agctg	1	4.5116206E-8
agctgaattccacaaactttaataaatccgaaac	1	4.5116206E-8
agctgcggccgccctgaaccggttgggtgccac	2	9.023241E-8
agctggccctggcactgctctgctct	1	4.5116206E-8
agde	6	2.7069723E-7
age	5186	2.3397265E-4
age-adjusted	35	1.5790672E-6
age-appropriate	7	3.1581345E-7
age-associated	3	1.3534861E-7
age-at-onset	2	9.023241E-8
age-based	6	2.7069723E-7
age-blip	1	4.5116206E-8
age-bsa	27	1.2181375E-6
age-bsa-induced	1	4.5116206E-8
age-conditional	8	3.6092965E-7
age-darkened	1	4.5116206E-8
age-dependent	5	2.2558103E-7
age-discrimination	1	4.5116206E-8
age-eligible	2	9.023241E-8
age-emphasizing	1	4.5116206E-8
age-gender-matched	1	4.5116206E-8
age-group	3	1.3534861E-7
age-groups	1	4.5116206E-8
age-inappropriate	1	4.5116206E-8
age-intensity	1	4.5116206E-8
age-matched	29	1.30837E-6
age-modified	8	3.6092965E-7
age-old	40	1.8046483E-6
age-peers	2	9.023241E-8
age-range	1	4.5116206E-8
age-ravaged	1	4.5116206E-8
age-related	52	2.3460427E-6
age-retardation	1	4.5116206E-8
age-smoking	2	9.023241E-8
age-specific	53	2.391159E-6
age-specificity	1	4.5116206E-8
age-squared	2	9.023241E-8
age-stratified	1	4.5116206E-8
age-structured	2	9.023241E-8
aged	397	1.7911134E-5
aged-based	1	4.5116206E-8
aged-matched	3	1.3534861E-7
agedly	1	4.5116206E-8
agee	3	1.3534861E-7
agei	3	1.3534861E-7
agei-nhei	1	4.5116206E-8
ageing	29	1.30837E-6
ageing-can-be-regulated	1	4.5116206E-8
ageism	2	9.023241E-8
ageist	7	3.1581345E-7
ageless	10	4.5116207E-7
agellon	3	1.3534861E-7
agemates	14	6.316269E-7
agemilestone	1	4.5116206E-8
agen	2	9.023241E-8
agenbite	1	4.5116206E-8
agenbroad	1	4.5116206E-8
agence	10	4.5116207E-7
agencies	2284	1.03045415E-4
agencies-and	1	4.5116206E-8
agencies-away	1	4.5116206E-8
agencies-missionary	1	4.5116206E-8
agencies-the	1	4.5116206E-8
agencies-unaccustomed	1	4.5116206E-8
agencies-while	1	4.5116206E-8
agenciesacquisition	1	4.5116206E-8
agenciesgsa	1	4.5116206E-8
agency	3057	1.3792024E-4
agency-are	1	4.5116206E-8
agency-based	2	9.023241E-8
agency-believed	1	4.5116206E-8
agency-designated	8	3.6092965E-7
agency-determined	1	4.5116206E-8
agency-specific	5	2.2558103E-7
agencydesignated	3	1.3534861E-7
agencyoffice	2	9.023241E-8
agencyprotocols	2	9.023241E-8
agencyspecific	2	9.023241E-8
agencyusers	1	4.5116206E-8
agencywide	17	7.669755E-7
agend	1	4.5116206E-8
agenda	549	2.4768797E-5
agenda-driven	1	4.5116206E-8
agenda-save	1	4.5116206E-8
agenda-setting	1	4.5116206E-8
agendas	49	2.2106942E-6
agendum	3	1.3534861E-7
agenerase	1	4.5116206E-8
ageneration	1	4.5116206E-8
agenes	1	4.5116206E-8
agenesis	4	1.8046482E-7
agenseeing	2	9.023241E-8
agent	1202	5.422968E-5
agent-based	1	4.5116206E-8
agent-noun	1	4.5116206E-8
agent-provocateur	1	4.5116206E-8
agent-speak	1	4.5116206E-8
agent-y	1	4.5116206E-8
agentdom	1	4.5116206E-8
agentries	1	4.5116206E-8
agentry	2	9.023241E-8
agents	1417	6.392966E-5
agents-even	1	4.5116206E-8
agentur	1	4.5116206E-8
agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle	1	4.5116206E-8
ager	5	2.2558103E-7
agere	2	9.023241E-8
agers	9	4.0604587E-7
ages	769	3.4694363E-5
ages-old	1	4.5116206E-8
agettin	1	4.5116206E-8
agewise	1	4.5116206E-8
agey	10	4.5116207E-7
age–bovine	1	4.5116206E-8
agfa	1	4.5116206E-8
agg	36	1.6241835E-6
aggaccaaagaagaagtagga	1	4.5116206E-8
aggaccctcatggccttg	1	4.5116206E-8
aggactttgatggaacacgg	1	4.5116206E-8
aggaggcggttagccctg	1	4.5116206E-8
aggcacacaagcccaaaaagac	1	4.5116206E-8
aggcactccgaggctagaccag	1	4.5116206E-8
aggccca	1	4.5116206E-8
agggaccggg	1	4.5116206E-8
agggagctctgacatcggg	1	4.5116206E-8
agggah	1	4.5116206E-8
agggataacaatatcgccaa	1	4.5116206E-8
agggcagt	3	1.3534861E-7
agggctgctaattgctggta	1	4.5116206E-8
agggghhhh	1	4.5116206E-8
agggh	1	4.5116206E-8
aggie	3	1.3534861E-7
aggies	11	4.962783E-7
agglomerans	2	9.023241E-8
agglomerate	2	9.023241E-8
agglomeration	4	1.8046482E-7
agglomerations	1	4.5116206E-8
agglomerative	14	6.316269E-7
agglutination	2	9.023241E-8
agglutinative	1	4.5116206E-8
agglutinin	1	4.5116206E-8
agglutinins	4	1.8046482E-7
aggrandize	1	4.5116206E-8
aggrandized	1	4.5116206E-8
aggrandizement	5	2.2558103E-7
aggrandizements	3	1.3534861E-7
aggrandizing	1	4.5116206E-8
aggrastat	2	9.023241E-8
aggravate	11	4.962783E-7
aggravated	42	1.8948807E-6
aggravates	8	3.6092965E-7
aggravating	43	1.939997E-6
aggravatingly	1	4.5116206E-8
aggravation	13	5.865107E-7
aggravations	3	1.3534861E-7
aggravator	1	4.5116206E-8
aggrecan	12	5.4139446E-7
aggrecanase	1	4.5116206E-8
aggregata	2	9.023241E-8
aggregate	247	1.1143703E-5
aggregated	46	2.0753455E-6
aggregates	262	1.1820446E-5
aggregating	27	1.2181375E-6
aggregation	171	7.714872E-6
aggregation-compatible	1	4.5116206E-8
aggregation-competent	1	4.5116206E-8
aggregation-prone	1	4.5116206E-8
aggregations	7	3.1581345E-7
aggregator	2	9.023241E-8
aggregrate	1	4.5116206E-8
aggresive	1	4.5116206E-8
aggresome	1	4.5116206E-8
aggresome-like	4	1.8046482E-7
aggresomes	1	4.5116206E-8
aggress	1	4.5116206E-8
aggression	149	6.722315E-6
aggression-burner	1	4.5116206E-8
aggression-inducing	1	4.5116206E-8
aggressions	3	1.3534861E-7
aggressive	569	2.5671121E-5
aggressively	165	7.444174E-6
aggressiveness	15	6.767431E-7
aggressor	11	4.962783E-7
aggressors	11	4.962783E-7
aggressosexual	1	4.5116206E-8
aggrievance	1	4.5116206E-8
aggrieved	29	1.30837E-6
aggrievement	2	9.023241E-8
aggrievor	1	4.5116206E-8
aggrivate	2	9.023241E-8
aggrivates	1	4.5116206E-8
aggrivating	1	4.5116206E-8
aggro	2	9.023241E-8
aggtca	1	4.5116206E-8
aggtcacattgccgaacct	1	4.5116206E-8
aggtcgccggctccctaatatttaggg-tamra	1	4.5116206E-8
agh	1	4.5116206E-8
agha	1	4.5116206E-8
aghajari	1	4.5116206E-8
aghanistan	1	4.5116206E-8
aghast	32	1.4437186E-6
aghiasos	2	9.023241E-8
aghion	1	4.5116206E-8
aghlaghlaghlaghlaghl	1	4.5116206E-8
aghlghlghlghhgll	1	4.5116206E-8
aghía	1	4.5116206E-8
agi	6	2.7069723E-7
agia	5	2.2558103E-7
agian	2	9.023241E-8
agie-bp	1	4.5116206E-8
agiero	1	4.5116206E-8
agii	1	4.5116206E-8
agikuyu	1	4.5116206E-8
agile	19	8.572079E-7
agilent	11	4.962783E-7
agilis	1	4.5116206E-8
agility	22	9.925566E-7
agin	2	9.023241E-8
agina	1	4.5116206E-8
agincourt	8	3.6092965E-7
aging	427	1.926462E-5
aging-at	1	4.5116206E-8
aging-boomer	1	4.5116206E-8
aging-friendly	1	4.5116206E-8
aging-in	1	4.5116206E-8
aging-related	1	4.5116206E-8
agins	7	3.1581345E-7
agios	2	9.023241E-8
agiou	1	4.5116206E-8
agita	1	4.5116206E-8
agitans	1	4.5116206E-8
agitate	5	2.2558103E-7
agitated	46	2.0753455E-6
agitatedly	1	4.5116206E-8
agitates	2	9.023241E-8
agitating	11	4.962783E-7
agitation	63	2.842321E-6
agitator	7	3.1581345E-7
agitators	5	2.2558103E-7
agitoxin	1	4.5116206E-8
agitpop	1	4.5116206E-8
agitprop	8	3.6092965E-7
agkistrodon	1	4.5116206E-8
agkpqetfld	1	4.5116206E-8
aglint	1	4.5116206E-8
aglitter	1	4.5116206E-8
aglow	7	3.1581345E-7
aglozenge	1	4.5116206E-8
aglt	1	4.5116206E-8
aglycone	1	4.5116206E-8
agmon	6	2.7069723E-7
agne	1	4.5116206E-8
agnelli	33	1.4888349E-6
agnellis	5	2.2558103E-7
agnes	29	1.30837E-6
agnese	1	4.5116206E-8
agnew	5	2.2558103E-7
agnieszka	2	9.023241E-8
agnodice	1	4.5116206E-8
agnolo	1	4.5116206E-8
agnondas	1	4.5116206E-8
agnos	1	4.5116206E-8
agnostic	18	8.1209174E-7
agnosticism	6	2.7069723E-7
agnostics	7	3.1581345E-7
agnst	1	4.5116206E-8
agnsty	2	9.023241E-8
agnus	3	1.3534861E-7
agnv	1	4.5116206E-8
ago	6509	2.936614E-4
ago-are	1	4.5116206E-8
ago-before	1	4.5116206E-8
ago-what	1	4.5116206E-8
agodoa	1	4.5116206E-8
agog	9	4.0604587E-7
agoggle	1	4.5116206E-8
agon	1	4.5116206E-8
agona	1	4.5116206E-8
agonale	1	4.5116206E-8
agonalis	1	4.5116206E-8
agone	3	1.3534861E-7
agonia	1	4.5116206E-8
agonies	3	1.3534861E-7
agonism	11	4.962783E-7
agonist	287	1.29483515E-5
agonist-activated	1	4.5116206E-8
agonist-antagonist	2	9.023241E-8
agonist-antagonists	1	4.5116206E-8
agonist-bound	5	2.2558103E-7
agonist-dependent	6	2.7069723E-7
agonist-derivative	1	4.5116206E-8
agonist-induced	16	7.218593E-7
agonist-mediated	3	1.3534861E-7
agonist-regulated	1	4.5116206E-8
agonist-selective	2	9.023241E-8
agonist-specific	1	4.5116206E-8
agonist-stimulated	1	4.5116206E-8
agonist-stimulation	1	4.5116206E-8
agonist-treated	1	4.5116206E-8
agonistic	10	4.5116207E-7
agonists	175	7.895336E-6
agonize	10	4.5116207E-7
agonized	19	8.572079E-7
agonizer	1	4.5116206E-8
agonizers	1	4.5116206E-8
agonizes	1	4.5116206E-8
agonizing	44	1.9851132E-6
agonizingly	4	1.8046482E-7
agony	66	2.9776697E-6
agony-making	1	4.5116206E-8
agood	1	4.5116206E-8
agora	31	1.3986024E-6
agora-like	1	4.5116206E-8
agoraphobia	2	9.023241E-8
agoraphobics	1	4.5116206E-8
agoras	2	9.023241E-8
agordon	24	1.0827889E-6
agostino	2	9.023241E-8
agotataki	1	4.5116206E-8
agoura	4	1.8046482E-7
agouti	16	7.218593E-7
agouti-related	3	1.3534861E-7
agoutis	1	4.5116206E-8
agp	1	4.5116206E-8
agpr	1	4.5116206E-8
agr	2	9.023241E-8
agra	25	1.1279052E-6
agramonte	3	1.3534861E-7
agranulocytosis	5	2.2558103E-7
agrarian	15	6.767431E-7
agrarians	1	4.5116206E-8
agrawal	2	9.023241E-8
agre	1	4.5116206E-8
agreda	4	1.8046482E-7
agredo	1	4.5116206E-8
agree	2879	1.2988957E-4
agree-imo	1	4.5116206E-8
agreeable	44	1.9851132E-6
agreeably	12	5.4139446E-7
agreeance	2	9.023241E-8
agreed	1468	6.623059E-5
agreed-on	2	9.023241E-8
agreed-to	1	4.5116206E-8
agreed-upon	32	1.4437186E-6
agreeement	1	4.5116206E-8
agreein	1	4.5116206E-8
agreeing	149	6.722315E-6
agreement	1580	7.1283604E-5
agreement-to-disagree	1	4.5116206E-8
agreements	319	1.439207E-5
agreementto	1	4.5116206E-8
agrees	311	1.403114E-5
agression	1	4.5116206E-8
agressive	3	1.3534861E-7
agressively	2	9.023241E-8
agrestis	1	4.5116206E-8
agrevo	1	4.5116206E-8
agribiz	2	9.023241E-8
agribusiness	18	8.1209174E-7
agriceutical	1	4.5116206E-8
agriceuticals	1	4.5116206E-8
agricola	1	4.5116206E-8
agricole	6	2.7069723E-7
agricultural	322	1.4527419E-5
agriculturalist	1	4.5116206E-8
agriculturalists	1	4.5116206E-8
agriculturally	4	1.8046482E-7
agriculture	376	1.6963693E-5
agriculture-dependent	1	4.5116206E-8
agriculturists	2	9.023241E-8
agrigento	3	1.3534861E-7
agrin	74	3.3385993E-6
agrinatura	1	4.5116206E-8
agringado	17	7.669755E-7
agringados	1	4.5116206E-8
agrippa	5	2.2558103E-7
agrippas	1	4.5116206E-8
agrippina	1	4.5116206E-8
agris	14	6.316269E-7
agritainment	1	4.5116206E-8
agri­culture	1	4.5116206E-8
agro	2	9.023241E-8
agro-drug	3	1.3534861E-7
agro-mediated	1	4.5116206E-8
agrobacteria	2	9.023241E-8
agrobacterium	44	1.9851132E-6
agrobacterium-based	2	9.023241E-8
agrobacterium-mediated	1	4.5116206E-8
agrobacteriumbinary	1	4.5116206E-8
agrocin	2	9.023241E-8
agrocin-encoding	1	4.5116206E-8
agrocin-like	1	4.5116206E-8
agrocinopine	1	4.5116206E-8
agrocins	1	4.5116206E-8
agron	2	9.023241E-8
agronomic	5	2.2558103E-7
agronomist	1	4.5116206E-8
agronomy	1	4.5116206E-8
agross	1	4.5116206E-8
agrotourism	1	4.5116206E-8
aground	15	6.767431E-7
agrp	40	1.8046483E-6
agrregate	1	4.5116206E-8
agrument	1	4.5116206E-8
agrunt	2	9.023241E-8
agréable	1	4.5116206E-8
agržable	1	4.5116206E-8
ags	30	1.3534863E-6
agsim	3	1.3534861E-7
agt	30	1.3534863E-6
agtacg	1	4.5116206E-8
agtactagggtagctcctcc	1	4.5116206E-8
agtcaaggctcacagagctaa	1	4.5116206E-8
agtcaggaatggctgcacc	1	4.5116206E-8
agtgactgtccttcctctgt	1	4.5116206E-8
agtgaggttcatgtaccag	1	4.5116206E-8
agtgct	1	4.5116206E-8
agtggcctatgcggccgcgg	1	4.5116206E-8
agtgtaatggaacagatgccaagg	1	4.5116206E-8
agtii	4	1.8046482E-7
agttgaggggactttcccaggc	1	4.5116206E-8
agttggttttcctttggctgtgtg	1	4.5116206E-8
agttgtgtttgtgtccgacg	1	4.5116206E-8
agtx	1	4.5116206E-8
agu	1	4.5116206E-8
agua	11	4.962783E-7
agua-cate	1	4.5116206E-8
aguacate	3	1.3534861E-7
aguada	1	4.5116206E-8
aguadilla	3	1.3534861E-7
aguadulce	1	4.5116206E-8
aguardando	1	4.5116206E-8
aguardente	3	1.3534861E-7
aguardiente	2	9.023241E-8
aguas	1	4.5116206E-8
aguayo	1	4.5116206E-8
agudo	1	4.5116206E-8
ague	2	9.023241E-8
aguecheek	2	9.023241E-8
agueface	1	4.5116206E-8
aguelo	1	4.5116206E-8
aguideforevaluatingagencies	1	4.5116206E-8
aguideforfederalagenciesin	1	4.5116206E-8
aguilar	9	4.0604587E-7
aguilas	1	4.5116206E-8
aguilera	30	1.3534863E-6
aguinaga	1	4.5116206E-8
aguinaldo	1	4.5116206E-8
aguinaldos	10	4.5116207E-7
aguinis	1	4.5116206E-8
aguirre	11	4.962783E-7
agular	1	4.5116206E-8
agulo	1	4.5116206E-8
agung	18	8.1209174E-7
agustain	4	1.8046482E-7
agustin	1	4.5116206E-8
agustinillo	1	4.5116206E-8
agustín	5	2.2558103E-7
aguárdenlas	1	4.5116206E-8
agva	1	4.5116206E-8
agwale	1	4.5116206E-8
agworks	4	1.8046482E-7
agía	21	9.4744036E-7
agías	1	4.5116206E-8
ah	1436	6.478687E-5
ah-ah-ah	2	9.023241E-8
ah-choo	1	4.5116206E-8
ah-doh-nees	1	4.5116206E-8
ah-gwa	1	4.5116206E-8
ah-ha	6	2.7069723E-7
ah-ha-ha	17	7.669755E-7
ah-ha-ha-ha	4	1.8046482E-7
ah-ha-ha-ha-ha	1	4.5116206E-8
ah-hem	1	4.5116206E-8
ah-kai-nah	1	4.5116206E-8
ah-lone	1	4.5116206E-8
ah-mtv-um	1	4.5116206E-8
ah-oo-gah	1	4.5116206E-8
ah-to-nym	1	4.5116206E-8
ah-yup	1	4.5116206E-8
aha	106	4.782318E-6
aha-wa	5	2.2558103E-7
ahab	53	2.391159E-6
ahab-like	1	4.5116206E-8
ahabs	1	4.5116206E-8
ahad	2	9.023241E-8
ahaetulla	1	4.5116206E-8
ahah	1	4.5116206E-8
ahahahaha	1	4.5116206E-8
ahahahahahahah	1	4.5116206E-8
ahahahahahahaha	1	4.5116206E-8
aharanot	14	6.316269E-7
aharon	4	1.8046482E-7
aharonisky	1	4.5116206E-8
aharonot	3	1.3534861E-7
ahau	2	9.023241E-8
ahazueras	1	4.5116206E-8
ahb	1	4.5116206E-8
ahbez	1	4.5116206E-8
ahc	4	1.8046482E-7
ahcd	2	9.023241E-8
ahco	3	1.3534861E-7
ahcompetition	1	4.5116206E-8
ahcpr	3	1.3534861E-7
ahd	8	3.6092965E-7
ahd-a	1	4.5116206E-8
ahdggr	1	4.5116206E-8
ahdi	1	4.5116206E-8
ahe	2	9.023241E-8
ahead	1755	7.917894E-5
ahearn	5	2.2558103E-7
ahed	1	4.5116206E-8
ahem	82	3.6995289E-6
ahern	8	3.6092965E-7
ahfs	1	4.5116206E-8
ahh	35	1.5790672E-6
ahha	1	4.5116206E-8
ahhed	1	4.5116206E-8
ahhh	33	1.4888349E-6
ahhhh	8	3.6092965E-7
ahhhhh	4	1.8046482E-7
ahhhhhh	1	4.5116206E-8
ahhhhhhhhh	3	1.3534861E-7
ahhhhhhhhhhh	1	4.5116206E-8
ahhhhhhhhhhhhh	1	4.5116206E-8
ahhhhhhhhhhhhhh	1	4.5116206E-8
ahhhhhhhhhhhhhhhhhhhhhhhhh	1	4.5116206E-8
ahhing	1	4.5116206E-8
ahi	8	3.6092965E-7
ahidi	1	4.5116206E-8
ahigh	1	4.5116206E-8
ahimsa	1	4.5116206E-8
ahing	1	4.5116206E-8
ahint	1	4.5116206E-8
ahistorical	8	3.6092965E-7
ahistorically	1	4.5116206E-8
ahistoricity	3	1.3534861E-7
ahistory	2	9.023241E-8
ahitw	1	4.5116206E-8
ahkenaten	2	9.023241E-8
ahktar	2	9.023241E-8
ahl	1	4.5116206E-8
ahlberg	1	4.5116206E-8
ahlborn	1	4.5116206E-8
ahlers	1	4.5116206E-8
ahlstrand	1	4.5116206E-8
ahluwalia	3	1.3534861E-7
ahmad	44	1.9851132E-6
ahmadicized	1	4.5116206E-8
ahmadicizing	1	4.5116206E-8
ahmadzai	2	9.023241E-8
ahmak	1	4.5116206E-8
ahmanson	4	1.8046482E-7
ahmed	102	4.601853E-6
ahmedabad	5	2.2558103E-7
ahmet	9	4.0604587E-7
ahmose	1	4.5116206E-8
ahn	20	9.0232413E-7
ahnee	1	4.5116206E-8
ahold	26	1.1730214E-6
aholic	1	4.5116206E-8
aholy	1	4.5116206E-8
ahouse	1	4.5116206E-8
ahoy	12	5.4139446E-7
ahp	7	3.1581345E-7
ahp-warner	1	4.5116206E-8
ahr	5	2.2558103E-7
ahram	13	5.865107E-7
ahrens	3	1.3534861E-7
ahronot	2	9.023241E-8
ahrq	1	4.5116206E-8
ahrs	1	4.5116206E-8
ahs	3	1.3534861E-7
ahsanullah	9	4.0604587E-7
ahsen	1	4.5116206E-8
ahtapod	1	4.5116206E-8
ahtisaari	1	4.5116206E-8
ahuacatl	2	9.023241E-8
ahuja	1	4.5116206E-8
ahulph	1	4.5116206E-8
ahumada	1	4.5116206E-8
ahv	1	4.5116206E-8
ahve	5	2.2558103E-7
ahwahnee	1	4.5116206E-8
ahwatukee	1	4.5116206E-8
ahzar	1	4.5116206E-8
ai	481	2.1700895E-5
ai-ish	2	9.023241E-8
ai-knockout	1	4.5116206E-8
ai-ko	1	4.5116206E-8
ai-lead	1	4.5116206E-8
ai-mi-tii	1	4.5116206E-8
ai-yi-yi	1	4.5116206E-8
aia	18	8.1209174E-7
aib	9	4.0604587E-7
aibe	1	4.5116206E-8
aic	18	8.1209174E-7
aicd	7	3.1581345E-7
aicha	2	9.023241E-8
aichi	1	4.5116206E-8
aicn	4	1.8046482E-7
aicpa	131	5.910223E-6
aid	1688	7.615616E-5
aid-recipients	1	4.5116206E-8
aid-wearing	1	4.5116206E-8
aida	9	4.0604587E-7
aidan	24	1.0827889E-6
aide	267	1.2046027E-5
aide-de-camp	4	1.8046482E-7
aided	121	5.459061E-6
aiden	2	9.023241E-8
aidentifies	1	4.5116206E-8
aider	1	4.5116206E-8
aides	304	1.37153265E-5
aidid	1	4.5116206E-8
aidil	1	4.5116206E-8
aiding	41	1.8497644E-6
aids	1187	5.3552936E-5
aids-associated	3	1.3534861E-7
aids-conference	1	4.5116206E-8
aids-conscious	2	9.023241E-8
aids-defining	2	9.023241E-8
aids-fighting	1	4.5116206E-8
aids-infected	3	1.3534861E-7
aids-like	2	9.023241E-8
aids-related	7	3.1581345E-7
aids-research	2	9.023241E-8
aids-ridden	1	4.5116206E-8
aids-vaccine	1	4.5116206E-8
aidss	20	9.0232413E-7
aidsvax	1	4.5116206E-8
aiee	6	2.7069723E-7
aieee	6	2.7069723E-7
aieeee	1	4.5116206E-8
aieeeeee	1	4.5116206E-8
aieeeeeeeeee	1	4.5116206E-8
aiello	11	4.962783E-7
aif	1	4.5116206E-8
aifg	55	2.4813914E-6
aig	18	8.1209174E-7
aig-earnings	1	4.5116206E-8
aigle	1	4.5116206E-8
aigu	1	4.5116206E-8
aiguas	1	4.5116206E-8
aiguille	5	2.2558103E-7
aigus	1	4.5116206E-8
aihy	1	4.5116206E-8
aii	1	4.5116206E-8
aiib	1	4.5116206E-8
aiieeee	1	4.5116206E-8
aiieeeeee	1	4.5116206E-8
aiii	2	9.023241E-8
aiiieeee	1	4.5116206E-8
aiiieeeeeeeeee	2	9.023241E-8
aiiiieeeee	1	4.5116206E-8
aiiiiiieeeee	1	4.5116206E-8
aiiiiiiiiiieeeeeeeeee	1	4.5116206E-8
aiims	1	4.5116206E-8
aijaz	1	4.5116206E-8
aik	1	4.5116206E-8
aiken	7	3.1581345E-7
aikido	11	4.962783E-7
aikman	23	1.0376727E-6
ail	31	1.3986024E-6
aila	3	1.3534861E-7
ailecia	1	4.5116206E-8
ailed	1	4.5116206E-8
aileen	3	1.3534861E-7
ailerons	1	4.5116206E-8
ailes	1	4.5116206E-8
ailey	6	2.7069723E-7
ailing	60	2.7069725E-6
aillustrates	9	4.0604587E-7
ailment	26	1.1730214E-6
ailment-free	1	4.5116206E-8
ailments	54	2.436275E-6
ails	13	5.865107E-7
ailsa	3	1.3534861E-7
aim	514	2.318973E-5
aim-v	1	4.5116206E-8
aima	1	4.5116206E-8
aimable	1	4.5116206E-8
aimcl	1	4.5116206E-8
aimd	230	1.0376728E-5
aime	10	4.5116207E-7
aimeconat	1	4.5116206E-8
aimed	392	1.7685554E-5
aimee	455	2.0527874E-5
aimee-i	1	4.5116206E-8
aimee-what	1	4.5116206E-8
aimee-you	1	4.5116206E-8
aimeeeeeee	2	9.023241E-8
aimeeward	1	4.5116206E-8
aimer	2	9.023241E-8
aimfully	2	9.023241E-8
aiming	65	2.9325533E-6
aimless	14	6.316269E-7
aimlessly	13	5.865107E-7
aimlessness	2	9.023241E-8
aimon	1	4.5116206E-8
aims	166	7.4892905E-6
aimé	3	1.3534861E-7
ain	26	1.1730214E-6
aina	1	4.5116206E-8
aincome	1	4.5116206E-8
aindicate	1	4.5116206E-8
aindicated	1	4.5116206E-8
aindicates	3	1.3534861E-7
aine	14	6.316269E-7
aines	1	4.5116206E-8
ainge	7	3.1581345E-7
ainsley	2	9.023241E-8
aint	9	4.0604587E-7
ainu	13	5.865107E-7
aioli	4	1.8046482E-7
aip	2	9.023241E-8
air	4501	2.0306805E-4
air-and-spit	1	4.5116206E-8
air-as	1	4.5116206E-8
air-bag	4	1.8046482E-7
air-bag-equipped	3	1.3534861E-7
air-base	1	4.5116206E-8
air-bending	1	4.5116206E-8
air-borne	3	1.3534861E-7
air-commas	1	4.5116206E-8
air-conditioned	72	3.248367E-6
air-conditioner	7	3.1581345E-7
air-conditioners	2	9.023241E-8
air-conditioning	53	2.391159E-6
air-cushion	2	9.023241E-8
air-defense	2	9.023241E-8
air-dispersion	2	9.023241E-8
air-dried	21	9.4744036E-7
air-dropped	1	4.5116206E-8
air-dry	2	9.023241E-8
air-drying	2	9.023241E-8
air-fare	1	4.5116206E-8
air-fares	1	4.5116206E-8
air-filled	1	4.5116206E-8
air-flow	1	4.5116206E-8
air-freight	2	9.023241E-8
air-freighted	1	4.5116206E-8
air-ground	1	4.5116206E-8
air-inflated	1	4.5116206E-8
air-laws	3	1.3534861E-7
air-liquid	1	4.5116206E-8
air-locked	1	4.5116206E-8
air-media	1	4.5116206E-8
air-only	1	4.5116206E-8
air-operating	3	1.3534861E-7
air-ports	1	4.5116206E-8
air-power	1	4.5116206E-8
air-pressure	1	4.5116206E-8
air-purifying	1	4.5116206E-8
air-quality	1	4.5116206E-8
air-quotes	4	1.8046482E-7
air-raid	6	2.7069723E-7
air-refueling	1	4.5116206E-8
air-sac	1	4.5116206E-8
air-sea	1	4.5116206E-8
air-security	4	1.8046482E-7
air-semi-colons	1	4.5116206E-8
air-sickness	1	4.5116206E-8
air-tight	1	4.5116206E-8
air-time	1	4.5116206E-8
air-to-air	5	2.2558103E-7
air-to-ground	1	4.5116206E-8
air-traffic	8	3.6092965E-7
air-traffic-control	1	4.5116206E-8
air-transport	1	4.5116206E-8
air-trapping	1	4.5116206E-8
aira	1	4.5116206E-8
airbag	3	1.3534861E-7
airbags	6	2.7069723E-7
airbase	1	4.5116206E-8
airbeds	1	4.5116206E-8
airborne	88	3.9702263E-6
airbrush	6	2.7069723E-7
airbrushed	9	4.0604587E-7
airbrushes	2	9.023241E-8
airbrushing	3	1.3534861E-7
airbus	73	3.2934831E-6
aircomes	1	4.5116206E-8
airconditioner	1	4.5116206E-8
aircraft	763	3.4423665E-5
aircraft-and	1	4.5116206E-8
aircraft-based	1	4.5116206E-8
aircraft-carrier	1	4.5116206E-8
aircraft-presumably	1	4.5116206E-8
aircraft-that	1	4.5116206E-8
aircraft-the	1	4.5116206E-8
aircrew	1	4.5116206E-8
aircrewmen	1	4.5116206E-8
aircrews	3	1.3534861E-7
airdate	3	1.3534861E-7
airdates	1	4.5116206E-8
airdrop	1	4.5116206E-8
airdrops	1	4.5116206E-8
airdrying	1	4.5116206E-8
aire	3	1.3534861E-7
aired	245	1.1053471E-5
airedale	7	3.1581345E-7
aires	61	2.7520887E-6
airfare	20	9.0232413E-7
airfares	4	1.8046482E-7
airfield	35	1.5790672E-6
airfields	10	4.5116207E-7
airflow	12	5.4139446E-7
airflow-wise	1	4.5116206E-8
airfoil	1	4.5116206E-8
airfone	1	4.5116206E-8
airfones	1	4.5116206E-8
airforce	2	9.023241E-8
airframe	3	1.3534861E-7
airhead	15	6.767431E-7
airheaded	2	9.023241E-8
airheads	5	2.2558103E-7
airholes	1	4.5116206E-8
airily	1	4.5116206E-8
airing	107	4.827434E-6
airlangga	1	4.5116206E-8
airless	10	4.5116207E-7
airlift	2	9.023241E-8
airlifted	4	1.8046482E-7
airlifting	1	4.5116206E-8
airline	416	1.8768342E-5
airline-installed	1	4.5116206E-8
airline-security	5	2.2558103E-7
airline-speak	1	4.5116206E-8
airliner	33	1.4888349E-6
airliners	33	1.4888349E-6
airlines	660	2.9776696E-5
airlock	6	2.7069723E-7
airmail	3	1.3534861E-7
airman	7	3.1581345E-7
airmarkets	2	9.023241E-8
airmarkt	1	4.5116206E-8
airmen	22	9.925566E-7
airness	2	9.023241E-8
airobid	3	1.3534861E-7
airpanel	3	1.3534861E-7
airphone	10	4.5116207E-7
airphones	2	9.023241E-8
airplane	271	1.2226492E-5
airplanes	125	5.6395256E-6
airplane–half	1	4.5116206E-8
airplay	7	3.1581345E-7
airpopper	1	4.5116206E-8
airport	976	4.403342E-5
airport-bookstore	1	4.5116206E-8
airport-security	1	4.5116206E-8
airport-style	1	4.5116206E-8
airports	213	9.609752E-6
airquote	2	9.023241E-8
airquotes	1	4.5116206E-8
airs	57	2.5716238E-6
airship	2	9.023241E-8
airships	4	1.8046482E-7
airshow	3	1.3534861E-7
airshow-notes	1	4.5116206E-8
airsome	1	4.5116206E-8
airspace	76	3.4288316E-6
airspaces	1	4.5116206E-8
airspeed	1	4.5116206E-8
airspeeds	1	4.5116206E-8
airstone	7	3.1581345E-7
airstream	2	9.023241E-8
airstrike	27	1.2181375E-6
airstrikes	89	4.0153423E-6
airstrip	14	6.316269E-7
airstrips	1	4.5116206E-8
airsupply	1	4.5116206E-8
airthreat	1	4.5116206E-8
airtight	18	8.1209174E-7
airtime	21	9.4744036E-7
airton	1	4.5116206E-8
airtouch	2	9.023241E-8
airtours	1	4.5116206E-8
airtraffic	5	2.2558103E-7
airtrain	3	1.3534861E-7
airtran	4	1.8046482E-7
airvantage	3	1.3534861E-7
airwaves	43	1.939997E-6
airway	85	3.8348776E-6
airways	125	5.6395256E-6
airwhomped	1	4.5116206E-8
airworthiness	1	4.5116206E-8
airworthy	1	4.5116206E-8
airy	59	2.6618561E-6
airy-fairy	1	4.5116206E-8
ais	40	1.8046483E-6
ais-affected	8	3.6092965E-7
ais-derived	11	4.962783E-7
ais-fibroblasts	1	4.5116206E-8
aisam	7	3.1581345E-7
aisance	1	4.5116206E-8
aisheh	1	4.5116206E-8
aisi	1	4.5116206E-8
aisle	118	5.3237122E-6
aisles	39	1.7595321E-6
aisne	1	4.5116206E-8
aisner	2	9.023241E-8
ait	9	4.0604587E-7
aitakute	2	9.023241E-8
aitana	1	4.5116206E-8
aitarak	2	9.023241E-8
aitch	3	1.3534861E-7
aitemad	1	4.5116206E-8
aitering	1	4.5116206E-8
aith	1	4.5116206E-8
aithal	1	4.5116206E-8
aitii	1	4.5116206E-8
aitken	3	1.3534861E-7
aiv	1	4.5116206E-8
aiwasfg	1	4.5116206E-8
aiwfg	1	4.5116206E-8
aix	5	2.2558103E-7
aix-en	8	3.6092965E-7
aix-les	2	9.023241E-8
aiyee	1	4.5116206E-8
aiyeee	1	4.5116206E-8
aiyu	1	4.5116206E-8
aj	27	1.2181375E-6
aja	1	4.5116206E-8
ajaccio	6	2.7069723E-7
ajaj	8	3.6092965E-7
ajami	21	9.4744036E-7
ajania	5	2.2558103E-7
ajaniopsis	1	4.5116206E-8
ajanta	13	5.865107E-7
ajar	11	4.962783E-7
ajara	1	4.5116206E-8
ajax	6	2.7069723E-7
ajay	1	4.5116206E-8
ajayi	4	1.8046482E-7
ajb	1	4.5116206E-8
ajc	189	8.526963E-6
ajcc	4	1.8046482E-7
ajd	1	4.5116206E-8
ajeerinmob	1	4.5116206E-8
ajeno	3	1.3534861E-7
ajl	1	4.5116206E-8
ajo	3	1.3534861E-7
ajones	1	4.5116206E-8
ajor	1	4.5116206E-8
ajoupa	1	4.5116206E-8
ajouri	4	1.8046482E-7
ajpheart	1	4.5116206E-8
ajr	1	4.5116206E-8
ajs	3	1.3534861E-7
ajskrym	1	4.5116206E-8
ajt	1	4.5116206E-8
ajuntament	8	3.6092965E-7
ak	43	1.939997E-6
ak-sar-ben	1	4.5116206E-8
ak-ses	1	4.5116206E-8
aka	132	5.9553395E-6
akab	1	4.5116206E-8
akabas	1	4.5116206E-8
akademie	3	1.3534861E-7
akadimias	1	4.5116206E-8
akaike	5	2.2558103E-7
akaishi	1	4.5116206E-8
akaji	2	9.023241E-8
akaka	3	1.3534861E-7
akakce	1	4.5116206E-8
akal	1	4.5116206E-8
akalaitis	1	4.5116206E-8
akalin	1	4.5116206E-8
akaline	3	1.3534861E-7
akals	1	4.5116206E-8
akamai	2	9.023241E-8
akap	18	8.1209174E-7
akap-directed	1	4.5116206E-8
akap-kinase	1	4.5116206E-8
akaps	15	6.767431E-7
akasaka	1	4.5116206E-8
akash	2	9.023241E-8
akashic	2	9.023241E-8
akata	1	4.5116206E-8
akawie	2	9.023241E-8
akbar	40	1.8046483E-6
akbar-and	1	4.5116206E-8
akc	10	4.5116207E-7
akd	1	4.5116206E-8
ake	4	1.8046482E-7
akebono	3	1.3534861E-7
akechi-daira	1	4.5116206E-8
akeem	4	1.8046482E-7
akenside	1	4.5116206E-8
akers	4	1.8046482E-7
akes	1	4.5116206E-8
akev	1	4.5116206E-8
akewood	1	4.5116206E-8
akhbar	4	1.8046482E-7
akhenaten	4	1.8046482E-7
akhenaton	2	9.023241E-8
akhentaten	1	4.5116206E-8
akhil	8	3.6092965E-7
akhmad	1	4.5116206E-8
akhmedkhanov	1	4.5116206E-8
akhnaten	2	9.023241E-8
akhnenaten	1	4.5116206E-8
akhras	1	4.5116206E-8
akhundzada	1	4.5116206E-8
aki	1	4.5116206E-8
akihabara	3	1.3534861E-7
akihito	7	3.1581345E-7
akil	1	4.5116206E-8
akili	2	9.023241E-8
akim	2	9.023241E-8
akimbo	4	1.8046482E-7
akin	132	5.9553395E-6
akinesia	1	4.5116206E-8
akinetes	1	4.5116206E-8
aking	2	9.023241E-8
akinyele	1	4.5116206E-8
akio	2	9.023241E-8
akira	11	4.962783E-7
akistan	1	4.5116206E-8
akita	5	2.2558103E-7
akitas	2	9.023241E-8
akiva	6	2.7069723E-7
akiyoshi	3	1.3534861E-7
akj	1	4.5116206E-8
akkadian	5	2.2558103E-7
akkadians	2	9.023241E-8
akko	12	5.4139446E-7
akkum	1	4.5116206E-8
aklins	1	4.5116206E-8
akman	1	4.5116206E-8
akmolith	1	4.5116206E-8
akn	1	4.5116206E-8
aknow-nothing	1	4.5116206E-8
aknowledgement	1	4.5116206E-8
akomé	1	4.5116206E-8
akoosherke	1	4.5116206E-8
akording	1	4.5116206E-8
akornblut	1	4.5116206E-8
akr	12	5.4139446E-7
akron	14	6.316269E-7
akronafplia	1	4.5116206E-8
akrotiri	6	2.7069723E-7
akrotirianí	2	9.023241E-8
akrotíri	3	1.3534861E-7
akroyd	2	9.023241E-8
aksa	30	1.3534863E-6
aksairt	1	4.5116206E-8
aksaray	2	9.023241E-8
aksoy	1	4.5116206E-8
akst	11	4.962783E-7
aksyonov	1	4.5116206E-8
akt	47	2.1204617E-6
akta-fplc	1	4.5116206E-8
akti	2	9.023241E-8
aktion	6	2.7069723E-7
aktivist	1	4.5116206E-8
akumal	1	4.5116206E-8
akxd	93	4.1958074E-6
al	5995	2.7047165E-4
al-ghala	1	4.5116206E-8
al-harem	4	1.8046482E-7
al-high	1	4.5116206E-8
al-hobb	1	4.5116206E-8
al-jaar	1	4.5116206E-8
al-kalaam	1	4.5116206E-8
al-qaida	2	9.023241E-8
al-shura	1	4.5116206E-8
ala	189	8.526963E-6
ala-american	1	4.5116206E-8
ala-bados	1	4.5116206E-8
ala-ud-din	2	9.023241E-8
alaa	1	4.5116206E-8
alabado	2	9.023241E-8
alabados	7	3.1581345E-7
alabama	351	1.5835789E-5
alabama-based	1	4.5116206E-8
alabama-coushatta	2	9.023241E-8
alabamians	6	2.7069723E-7
alabar	1	4.5116206E-8
alabastard	1	4.5116206E-8
alabaster	30	1.3534863E-6
alabárdos	1	4.5116206E-8
alacahöyük	1	4.5116206E-8
alack	1	4.5116206E-8
alacranes	1	4.5116206E-8
alacrity	8	3.6092965E-7
alactoside	1	4.5116206E-8
aladdin	7	3.1581345E-7
alade	3	1.3534861E-7
aladin	1	4.5116206E-8
alagille	3	1.3534861E-7
alagna	11	4.962783E-7
alaia	3	1.3534861E-7
alain	20	9.0232413E-7
alaior	6	2.7069723E-7
alaior–	1	4.5116206E-8
alais	1	4.5116206E-8
alam	2	9.023241E-8
alamanii	1	4.5116206E-8
alamans	2	9.023241E-8
alambre	2	9.023241E-8
alambrista	5	2.2558103E-7
alambristas	1	4.5116206E-8
alameda	15	6.767431E-7
alameda-based	1	4.5116206E-8
alamein	1	4.5116206E-8
alamgir	1	4.5116206E-8
alamilla	1	4.5116206E-8
alamillos	1	4.5116206E-8
alamitos	2	9.023241E-8
alamo	45	2.0302293E-6
alamo-movie	1	4.5116206E-8
alamo-town	1	4.5116206E-8
alamode	3	1.3534861E-7
alamodome	4	1.8046482E-7
alamogordo	1	4.5116206E-8
alamos	67	3.022786E-6
alamosa	1	4.5116206E-8
alan	669	3.0182742E-5
alana	1	4.5116206E-8
alane	1	4.5116206E-8
alanes	2	9.023241E-8
alania	1	4.5116206E-8
alanin	1	4.5116206E-8
alaninaminotransferase	1	4.5116206E-8
alanine	103	4.6469695E-6
alanine-free	2	9.023241E-8
alanine-rich	1	4.5116206E-8
alanine-scanning	6	2.7069723E-7
alanines	7	3.1581345E-7
alanis	21	9.4744036E-7
alaniz	1	4.5116206E-8
alanna	1	4.5116206E-8
alannis	2	9.023241E-8
alanui	3	1.3534861E-7
alanyl	23	1.0376727E-6
alanyl-carrier	1	4.5116206E-8
alap	1	4.5116206E-8
alapage	1	4.5116206E-8
alaph	1	4.5116206E-8
alar	1	4.5116206E-8
alarcon	2	9.023241E-8
alarcón	3	1.3534861E-7
alaris	1	4.5116206E-8
alarm	271	1.2226492E-5
alarm-like	1	4.5116206E-8
alarm-system	3	1.3534861E-7
alarmed	77	3.473948E-6
alarmedly	2	9.023241E-8
alarming	115	5.188364E-6
alarmingbeak	1	4.5116206E-8
alarmingly	29	1.30837E-6
alarmism	8	3.6092965E-7
alarmist	21	9.4744036E-7
alarmist-seeming	1	4.5116206E-8
alarmists	5	2.2558103E-7
alarms	64	2.8874372E-6
alarnaot	1	4.5116206E-8
alarums	2	9.023241E-8
alaró	3	1.3534861E-7
alas	257	1.1594865E-5
alasdair	1	4.5116206E-8
alaska	254	1.1459517E-5
alaska-bound	1	4.5116206E-8
alaska-fireworks	1	4.5116206E-8
alaska-logging	2	9.023241E-8
alaska-starwars	4	1.8046482E-7
alaska-support	4	1.8046482E-7
alaska-veggies-cox	1	4.5116206E-8
alaskacoalition	2	9.023241E-8
alaskan	38	1.7144158E-6
alaskans	11	4.962783E-7
alassio	3	1.3534861E-7
alastair	9	4.0604587E-7
alat	1	4.5116206E-8
alator	1	4.5116206E-8
alawite	1	4.5116206E-8
alawites	1	4.5116206E-8
alawyer	2	9.023241E-8
alayne	7	3.1581345E-7
alb	2	9.023241E-8
alba	20	9.0232413E-7
albach	3	1.3534861E-7
albaicín	4	1.8046482E-7
albaida	1	4.5116206E-8
albama	1	4.5116206E-8
alban	7	3.1581345E-7
albanesi	1	4.5116206E-8
albania	71	3.2032506E-6
albania-pollute	3	1.3534861E-7
albanian	123	5.5492933E-6
albanian-language	2	9.023241E-8
albanian-only	1	4.5116206E-8
albanians	149	6.722315E-6
albano	4	1.8046482E-7
albans	5	2.2558103E-7
albany	162	7.3088254E-6
albany-based	1	4.5116206E-8
albanyriverrats	1	4.5116206E-8
albar	2	9.023241E-8
albaron	1	4.5116206E-8
albas	2	9.023241E-8
albatenius	1	4.5116206E-8
albatross	16	7.218593E-7
albd	1	4.5116206E-8
albecht	1	4.5116206E-8
albedo	1	4.5116206E-8
albee	6	2.7069723E-7
albeit	265	1.1955794E-5
albemarle	6	2.7069723E-7
albemuth	2	9.023241E-8
alben	2	9.023241E-8
albenda	1	4.5116206E-8
albendazole	3	1.3534861E-7
albenga	1	4.5116206E-8
albequerque	2	9.023241E-8
albergo	1	4.5116206E-8
alberica	1	4.5116206E-8
alberini	1	4.5116206E-8
alberni	1	4.5116206E-8
alberobello	3	1.3534861E-7
alberoni	1	4.5116206E-8
albers	1	4.5116206E-8
albert	224	1.01060305E-5
alberta	38	1.7144158E-6
albertaaaaa	1	4.5116206E-8
albertas	1	4.5116206E-8
alberti	3	1.3534861E-7
albertina	1	4.5116206E-8
albertini	1	4.5116206E-8
alberto	33	1.4888349E-6
alberton	2	9.023241E-8
albertosaurus	1	4.5116206E-8
alberts	2	9.023241E-8
albertson	9	4.0604587E-7
albertsons	2	9.023241E-8
albertville	2	9.023241E-8
albi	6	2.7069723E-7
albicans	34	1.533951E-6
albiet	1	4.5116206E-8
albigenses	1	4.5116206E-8
albigeois	1	4.5116206E-8
albin	2	9.023241E-8
albini	5	2.2558103E-7
albinism	8	3.6092965E-7
albino	30	1.3534863E-6
albinos	1	4.5116206E-8
albion	3	1.3534861E-7
albir	1	4.5116206E-8
albizu	1	4.5116206E-8
albizzia	1	4.5116206E-8
albores	1	4.5116206E-8
alborg	1	4.5116206E-8
albornoz	2	9.023241E-8
alborosella	2	9.023241E-8
albrecht	20	9.0232413E-7
albrechts	1	4.5116206E-8
albridge	1	4.5116206E-8
albright	354	1.5971138E-5
albrightness	1	4.5116206E-8
albritton	1	4.5116206E-8
albrough	1	4.5116206E-8
albufeira	21	9.4744036E-7
albufera	6	2.7069723E-7
album	718	3.2393436E-5
album-by-album	1	4.5116206E-8
album-like	1	4.5116206E-8
albumaxi	1	4.5116206E-8
albume	1	4.5116206E-8
albumen	1	4.5116206E-8
albumin	162	7.3088254E-6
albumin-bound	1	4.5116206E-8
albumin-dextrose-catalase	1	4.5116206E-8
albumin-to-creatinine	3	1.3534861E-7
albumine	3	1.3534861E-7
albumins	1	4.5116206E-8
albuminuria	9	4.0604587E-7
albuminwas	1	4.5116206E-8
albums	236	1.06474245E-5
albuquerque	46	2.0753455E-6
albuquerque-based	1	4.5116206E-8
alburger	1	4.5116206E-8
alburtis	1	4.5116206E-8
albus	2	9.023241E-8
albuterol	21	9.4744036E-7
albóndigasmeat	1	4.5116206E-8
albóndigasmeatballslenguadosole	1	4.5116206E-8
alc	1	4.5116206E-8
alcacer	1	4.5116206E-8
alcaeus	1	4.5116206E-8
alcahest	2	9.023241E-8
alcaicería	1	4.5116206E-8
alcala	1	4.5116206E-8
alcalay	2	9.023241E-8
alcaldía	3	1.3534861E-7
alcaligenes	1	4.5116206E-8
alcalá	6	2.7069723E-7
alcam	2	9.023241E-8
alcan	11	4.962783E-7
alcantarilha	1	4.5116206E-8
alcantarilla	1	4.5116206E-8
alcatel	20	9.0232413E-7
alcatraces	1	4.5116206E-8
alcatraz	17	7.669755E-7
alcaufar	1	4.5116206E-8
alcazaba	6	2.7069723E-7
alcazar	1	4.5116206E-8
alcaçovas	1	4.5116206E-8
alcedo	2	9.023241E-8
alces	2	9.023241E-8
alcheh	4	1.8046482E-7
alchemia	1	4.5116206E-8
alchemic	1	4.5116206E-8
alchemical	4	1.8046482E-7
alchemist	6	2.7069723E-7
alchemists	5	2.2558103E-7
alchemize	1	4.5116206E-8
alchemized	1	4.5116206E-8
alchemy	23	1.0376727E-6
alcheringa	1	4.5116206E-8
alchohol	5	2.2558103E-7
alchoholic	1	4.5116206E-8
alcian	11	4.962783E-7
alcibiades	1	4.5116206E-8
alcoa	18	8.1209174E-7
alcobaça	2	9.023241E-8
alcochete	1	4.5116206E-8
alcohol	1385	6.2485946E-5
alcohol-based	1	4.5116206E-8
alcohol-buzzed	2	9.023241E-8
alcohol-dependent	4	1.8046482E-7
alcohol-drinking	1	4.5116206E-8
alcohol-focused	2	9.023241E-8
alcohol-free	5	2.2558103E-7
alcohol-impaired	6	2.7069723E-7
alcohol-induced	1	4.5116206E-8
alcohol-involved	1	4.5116206E-8
alcohol-ism	1	4.5116206E-8
alcohol-positive	2	9.023241E-8
alcohol-related	61	2.7520887E-6
alcohol-screening	1	4.5116206E-8
alcohol-specific	1	4.5116206E-8
alcohol-use	2	9.023241E-8
alcoholic	155	6.993012E-6
alcoholics	44	1.9851132E-6
alcoholism	123	5.5492933E-6
alcohols	7	3.1581345E-7
alcoholsanonymous	1	4.5116206E-8
alcon	3	1.3534861E-7
alcools	1	4.5116206E-8
alcor	72	3.248367E-6
alcothon	1	4.5116206E-8
alcott	8	3.6092965E-7
alcotts	2	9.023241E-8
alcouffe	4	1.8046482E-7
alcove	6	2.7069723E-7
alcoves	3	1.3534861E-7
alcoy	3	1.3534861E-7
alcs	1	4.5116206E-8
alcudia	1	4.5116206E-8
alcuin	1	4.5116206E-8
alcyonarians	1	4.5116206E-8
alcácer	1	4.5116206E-8
alcántara	5	2.2558103E-7
alcázar	18	8.1209174E-7
alcázares	2	9.023241E-8
alcáçova	1	4.5116206E-8
alcúdia	11	4.962783E-7
alda	8	3.6092965E-7
aldam	2	9.023241E-8
aldar	1	4.5116206E-8
aldase	1	4.5116206E-8
aldea	1	4.5116206E-8
aldeanismo	1	4.5116206E-8
aldebaran	4	1.8046482E-7
aldehyde	19	8.572079E-7
aldehyde-containing	1	4.5116206E-8
aldehyde-forming	1	4.5116206E-8
aldehydes	6	2.7069723E-7
aldehydic	1	4.5116206E-8
aldeia	1	4.5116206E-8
alden	4	1.8046482E-7
alder	4	1.8046482E-7
alderman	12	5.4139446E-7
aldermen	3	1.3534861E-7
alders	2	9.023241E-8
alderson	4	1.8046482E-7
alderwood	1	4.5116206E-8
aldevron	2	9.023241E-8
aldh	74	3.3385993E-6
aldhous	1	4.5116206E-8
aldiger	1	4.5116206E-8
aldine	1	4.5116206E-8
aldo	4	1.8046482E-7
aldo-keto	2	9.023241E-8
aldolase	10	4.5116207E-7
aldona	1	4.5116206E-8
aldophosphamide	1	4.5116206E-8
aldose	2	9.023241E-8
aldous	13	5.865107E-7
aldrich	56	2.5265076E-6
aldridge	7	3.1581345E-7
aldrin	12	5.4139446E-7
aldroid	1	4.5116206E-8
aldus	1	4.5116206E-8
ale	51	2.3009266E-6
ale-fueled	1	4.5116206E-8
ale-ya	1	4.5116206E-8
aleatory	1	4.5116206E-8
alebriges	1	4.5116206E-8
alec	44	1.9851132E-6
aleck	2	9.023241E-8
alecks	1	4.5116206E-8
alecto	1	4.5116206E-8
alectorocephalic	1	4.5116206E-8
aledo	1	4.5116206E-8
aledort	2	9.023241E-8
alef	1	4.5116206E-8
alefkandra	1	4.5116206E-8
alegal	1	4.5116206E-8
alegranza	1	4.5116206E-8
alegre	6	2.7069723E-7
alegria	1	4.5116206E-8
aleh	1	4.5116206E-8
alehouse	1	4.5116206E-8
alei	1	4.5116206E-8
aleichem	5	2.2558103E-7
aleinikoff	6	2.7069723E-7
alejandra	1	4.5116206E-8
alejandrina	1	4.5116206E-8
alejandro	19	8.572079E-7
alejo	1	4.5116206E-8
aleksa	1	4.5116206E-8
aleksandar	1	4.5116206E-8
aleksander	7	3.1581345E-7
aleksandr	10	4.5116207E-7
aleksandra	7	3.1581345E-7
aleksei	1	4.5116206E-8
aleksi	1	4.5116206E-8
aleksius	1	4.5116206E-8
alektorophobia	1	4.5116206E-8
alem	2	9.023241E-8
alema	14	6.316269E-7
alemain	1	4.5116206E-8
aleman	1	4.5116206E-8
alemana	1	4.5116206E-8
alemany	2	9.023241E-8
alemberte	2	9.023241E-8
alembic	1	4.5116206E-8
alemán	3	1.3534861E-7
alen	8	3.6092965E-7
alencon	2	9.023241E-8
alendronate	1	4.5116206E-8
alene	1	4.5116206E-8
alenes	2	9.023241E-8
alenia	1	4.5116206E-8
alentejano	1	4.5116206E-8
alentejo	23	1.0376727E-6
aleph	2	9.023241E-8
aleph-beth	1	4.5116206E-8
aleppo	1	4.5116206E-8
alerding	1	4.5116206E-8
alergies	1	4.5116206E-8
alert	319	1.439207E-5
alerted	56	2.5265076E-6
alerting	57	2.5716238E-6
alertness	20	9.0232413E-7
alerts	44	1.9851132E-6
ales	12	5.4139446E-7
alessandra	9	4.0604587E-7
alessandro	11	4.962783E-7
alesser	1	4.5116206E-8
alessi	2	9.023241E-8
alessio	2	9.023241E-8
aleta	1	4.5116206E-8
alethea	1	4.5116206E-8
aleurone	1	4.5116206E-8
aleut	1	4.5116206E-8
aleutian	3	1.3534861E-7
aleutians	1	4.5116206E-8
aleuts	1	4.5116206E-8
aleve	4	1.8046482E-7
alevine	1	4.5116206E-8
alewife	1	4.5116206E-8
alex	287	1.29483515E-5
alexa	70	3.1581344E-6
alexa-calmodulin	52	2.3460427E-6
alexa-dye	1	4.5116206E-8
alexafluor	12	5.4139446E-7
alexander	423	1.9084155E-5
alexanderplatz	4	1.8046482E-7
alexanders	3	1.3534861E-7
alexandra	17	7.669755E-7
alexandras	1	4.5116206E-8
alexandre	12	5.4139446E-7
alexandria	114	5.1432476E-6
alexandrians	2	9.023241E-8
alexandrina	1	4.5116206E-8
alexandrinum	1	4.5116206E-8
alexandros	5	2.2558103E-7
alexei	14	6.316269E-7
alexey	1	4.5116206E-8
alexi	4	1.8046482E-7
alexia	1	4.5116206E-8
alexie	4	1.8046482E-7
alexis	90	4.0604587E-6
alexius	1	4.5116206E-8
alexiy	1	4.5116206E-8
alexj	1	4.5116206E-8
alex­ander	1	4.5116206E-8
aleyes	2	9.023241E-8
alf	14	6.316269E-7
alf-express	1	4.5116206E-8
alf-f	1	4.5116206E-8
alf-r	1	4.5116206E-8
alf-voice	1	4.5116206E-8
alfa	100	4.511621E-6
alfabet	1	4.5116206E-8
alfabetikli	1	4.5116206E-8
alfabia	1	4.5116206E-8
alfalfa	16	7.218593E-7
alfama	10	4.5116207E-7
alfaro	3	1.3534861E-7
alfie	5	2.2558103E-7
alfisols	3	1.3534861E-7
alfoldi	1	4.5116206E-8
alfons	1	4.5116206E-8
alfonse	24	1.0827889E-6
alfonseca	3	1.3534861E-7
alfonso	51	2.3009266E-6
alfonsín	2	9.023241E-8
alfonzo	3	1.3534861E-7
alford	1	4.5116206E-8
alfre	3	1.3534861E-7
alfred	139	6.271153E-6
alfredo	17	7.669755E-7
alfresco	4	1.8046482E-7
alfuckingmighty	1	4.5116206E-8
alfândaga	1	4.5116206E-8
alfândega	1	4.5116206E-8
alga	21	9.4744036E-7
algae	29	1.30837E-6
algaiarens	1	4.5116206E-8
algaida	2	9.023241E-8
algal	16	7.218593E-7
algar	4	1.8046482E-7
algardi	1	4.5116206E-8
algarve	169	7.624639E-6
algarvensis	1	4.5116206E-8
algarvian	13	5.865107E-7
algebra	72	3.248367E-6
algebra-mapping	1	4.5116206E-8
algebra-wizard	1	4.5116206E-8
algebraic	11	4.962783E-7
algebraically	6	2.7069723E-7
algebras	1	4.5116206E-8
algeciras	4	1.8046482E-7
algeo	2	9.023241E-8
alger	16	7.218593E-7
alger-type	1	4.5116206E-8
algeria	50	2.2558104E-6
algerian	46	2.0753455E-6
algerians	4	1.8046482E-7
algernon	4	1.8046482E-7
alghero	2	9.023241E-8
algiers	9	4.0604587E-7
alginate	6	2.7069723E-7
algo	51	2.3009266E-6
algoa	1	4.5116206E-8
algometry	1	4.5116206E-8
algonkian	2	9.023241E-8
algonquian	6	2.7069723E-7
algonquin	19	8.572079E-7
algonquins	1	4.5116206E-8
algore	1	4.5116206E-8
algorhythms	1	4.5116206E-8
algorithim	1	4.5116206E-8
algorithm	565	2.5490657E-5
algorithm-driven	1	4.5116206E-8
algorithmic	43	1.939997E-6
algorithmically	6	2.7069723E-7
algorithmparameters	1	4.5116206E-8
algorithms	298	1.344463E-5
algren	1	4.5116206E-8
algun	1	4.5116206E-8
algárvio	2	9.023241E-8
algériens	1	4.5116206E-8
alhaji	1	4.5116206E-8
alhamar	1	4.5116206E-8
alhambra	21	9.4744036E-7
alhami	1	4.5116206E-8
alhamilla	1	4.5116206E-8
alhazmi	3	1.3534861E-7
ali	304	1.37153265E-5
ali-a	1	4.5116206E-8
alia	17	7.669755E-7
aliados	1	4.5116206E-8
alianza	3	1.3534861E-7
aliança	1	4.5116206E-8
alias	218	9.835333E-6
aliases	18	8.1209174E-7
aliated	1	4.5116206E-8
alibay	1	4.5116206E-8
alibell	1	4.5116206E-8
alibelle	231	1.0421843E-5
alibelle-n	1	4.5116206E-8
alibi	26	1.1730214E-6
alibis	4	1.8046482E-7
alibot	1	4.5116206E-8
alibrandi	1	4.5116206E-8
alibris	2	9.023241E-8
alicante	34	1.533951E-6
alicante–	1	4.5116206E-8
alicantina	1	4.5116206E-8
alice	192	8.662311E-6
alicea	2	9.023241E-8
alicel	1	4.5116206E-8
aliceliz	1	4.5116206E-8
alicelizard	4	1.8046482E-7
alicenna	1	4.5116206E-8
alicia	47	2.1204617E-6
aliciakeys	1	4.5116206E-8
aliciapatterson	1	4.5116206E-8
alien	442	1.9941363E-5
alien-conspiracy	1	4.5116206E-8
alien-created	1	4.5116206E-8
alien-encounter	1	4.5116206E-8
alien-government	1	4.5116206E-8
alien-induced	1	4.5116206E-8
alien-infected	1	4.5116206E-8
alien-inhabited	1	4.5116206E-8
alien-looking	1	4.5116206E-8
alien-representation	1	4.5116206E-8
alien-type	1	4.5116206E-8
alienable	1	4.5116206E-8
alienate	40	1.8046483E-6
alienated	63	2.842321E-6
alienates	2	9.023241E-8
alienating	34	1.533951E-6
alienation	49	2.2106942E-6
alienhood	1	4.5116206E-8
alienist	1	4.5116206E-8
alienmiracleslowgrobaby	1	4.5116206E-8
alienness	1	4.5116206E-8
aliens	354	1.5971138E-5
aliens-only	2	9.023241E-8
alif	67	3.022786E-6
alig	1	4.5116206E-8
alighieri	4	1.8046482E-7
alight	12	5.4139446E-7
alighted	1	4.5116206E-8
alighting	2	9.023241E-8
alights	2	9.023241E-8
aligment	1	4.5116206E-8
align	127	5.7297584E-6
alignable	2	9.023241E-8
aligned	307	1.3850676E-5
aligner	1	4.5116206E-8
aligning	48	2.1655778E-6
alignment	863	3.8935286E-5
alignment-based	6	2.7069723E-7
alignments	420	1.8948807E-5
aligns	12	5.4139446E-7
alignx	2	9.023241E-8
alii	2	9.023241E-8
alijó	1	4.5116206E-8
alike	310	1.3986024E-5
alike-about	1	4.5116206E-8
alikum	2	9.023241E-8
alim	2	9.023241E-8
alimentary	2	9.023241E-8
alimentary-eliminative	1	4.5116206E-8
alimentum	1	4.5116206E-8
alimi	1	4.5116206E-8
alimony	17	7.669755E-7
alimpi	2	9.023241E-8
alimzan	1	4.5116206E-8
alimzhan	5	2.2558103E-7
alina	2	9.023241E-8
aline	2	9.023241E-8
alinea	1	4.5116206E-8
alinksy	3	1.3534861E-7
alinsky	3	1.3534861E-7
alioli	1	4.5116206E-8
aliphatic	11	4.962783E-7
aliq	4	1.8046482E-7
aliquo	2	9.023241E-8
aliquot	49	2.2106942E-6
aliquoted	12	5.4139446E-7
aliquoting	1	4.5116206E-8
aliquots	126	5.684642E-6
alireza	1	4.5116206E-8
alis	3	1.3534861E-7
alisa	2	9.023241E-8
alisdair	1	4.5116206E-8
alise	1	4.5116206E-8
alison	75	3.3837155E-6
alisoun	1	4.5116206E-8
alistair	5	2.2558103E-7
alistapart	2	9.023241E-8
alister	1	4.5116206E-8
alit	1	4.5116206E-8
aliter	2	9.023241E-8
aliteracy	1	4.5116206E-8
alittle	1	4.5116206E-8
alive	963	4.3446908E-5
aliveness	1	4.5116206E-8
aliviada	2	9.023241E-8
alix	7	3.1581345E-7
alixpartners	6	2.7069723E-7
aliya	6	2.7069723E-7
aliyah	1	4.5116206E-8
aliyiah	1	4.5116206E-8
aliyu	2	9.023241E-8
aliza	6	2.7069723E-7
alizadeh	9	4.0604587E-7
alizarin	4	1.8046482E-7
alizé	2	9.023241E-8
aljer	2	9.023241E-8
aljezur	1	4.5116206E-8
aljubarrota	3	1.3534861E-7
aljube	1	4.5116206E-8
alk	29	1.30837E-6
alka	3	1.3534861E-7
alka-seltzer	1	4.5116206E-8
alkahest	2	9.023241E-8
alkali	4	1.8046482E-7
alkali-sensitive	1	4.5116206E-8
alkali-stable	1	4.5116206E-8
alkaline	109	4.9176665E-6
alkaline-phosphatase	2	9.023241E-8
alkaline-phosphatase-conjugated	1	4.5116206E-8
alkalinity	18	8.1209174E-7
alkalinization	2	9.023241E-8
alkalization	1	4.5116206E-8
alkaloid	7	3.1581345E-7
alkaloid-resistant	2	9.023241E-8
alkaloids	14	6.316269E-7
alkalosis	1	4.5116206E-8
alkamystre	1	4.5116206E-8
alkane	3	1.3534861E-7
alkanes	1	4.5116206E-8
alkanethiol	1	4.5116206E-8
alkb	22	9.925566E-7
alkb-dependent	1	4.5116206E-8
alkb-like	2	9.023241E-8
alkb-related	1	4.5116206E-8
alkermes	7	3.1581345E-7
alkie	1	4.5116206E-8
alkies	3	1.3534861E-7
alkin	1	4.5116206E-8
alkinase	1	4.5116206E-8
alkinise	1	4.5116206E-8
alkistis	1	4.5116206E-8
alkmaar	2	9.023241E-8
alkoxide	2	9.023241E-8
alkyl	8	3.6092965E-7
alkylated	1	4.5116206E-8
alkylates	1	4.5116206E-8
alkylating	11	4.962783E-7
alkylating-based	1	4.5116206E-8
alkylation	1	4.5116206E-8
alkylhydroperoxide	1	4.5116206E-8
all	62687	0.0028281996
all-?	4	1.8046482E-7
all-?-fold	1	4.5116206E-8
all-?-sheet	1	4.5116206E-8
all-about	1	4.5116206E-8
all-about-fabric	1	4.5116206E-8
all-about-me	2	9.023241E-8
all-absorbing	1	4.5116206E-8
all-accordion	1	4.5116206E-8
all-acoustic	1	4.5116206E-8
all-against-all	5	2.2558103E-7
all-agency	1	4.5116206E-8
all-alpha	2	9.023241E-8
all-aluminum	2	9.023241E-8
all-american	2	9.023241E-8
all-animal	1	4.5116206E-8
all-around	20	9.0232413E-7
all-atom	29	1.30837E-6
all-attentive	2	9.023241E-8
all-black	13	5.865107E-7
all-body	2	9.023241E-8
all-but-anonymous	1	4.5116206E-8
all-but-declared-candidate	1	4.5116206E-8
all-but-excluded	1	4.5116206E-8
all-but-marbled	1	4.5116206E-8
all-but-official	1	4.5116206E-8
all-but-tame	1	4.5116206E-8
all-but-unknown	1	4.5116206E-8
all-but-useless	1	4.5116206E-8
all-campus	2	9.023241E-8
all-caps	3	1.3534861E-7
all-cash	1	4.5116206E-8
all-cause	19	8.572079E-7
all-ceramic	3	1.3534861E-7
all-clear	1	4.5116206E-8
all-clothed	1	4.5116206E-8
all-computer	1	4.5116206E-8
all-conference	2	9.023241E-8
all-conquering	1	4.5116206E-8
all-consuming	9	4.0604587E-7
all-consuming-week-after-week	1	4.5116206E-8
all-corsets	1	4.5116206E-8
all-court	1	4.5116206E-8
all-dancing	1	4.5116206E-8
all-data	3	1.3534861E-7
all-day	16	7.218593E-7
all-deaf	1	4.5116206E-8
all-department	1	4.5116206E-8
all-dessert	1	4.5116206E-8
all-digit	1	4.5116206E-8
all-dolled	1	4.5116206E-8
all-elbows	1	4.5116206E-8
all-electric	1	4.5116206E-8
all-embracing	2	9.023241E-8
all-employees	1	4.5116206E-8
all-encompassing	15	6.767431E-7
all-engaging	1	4.5116206E-8
all-engulfing	1	4.5116206E-8
all-enveloping	1	4.5116206E-8
all-expense-paid	1	4.5116206E-8
all-expenses-paid	3	1.3534861E-7
all-federal	1	4.5116206E-8
all-female	9	4.0604587E-7
all-filched-from-horror-movies	1	4.5116206E-8
all-flag	1	4.5116206E-8
all-for-one	1	4.5116206E-8
all-fresh	1	4.5116206E-8
all-gay	1	4.5116206E-8
all-genomes	4	1.8046482E-7
all-girl	8	3.6092965E-7
all-girls	2	9.023241E-8
all-hands	1	4.5116206E-8
all-hazard	1	4.5116206E-8
all-heavy	1	4.5116206E-8
all-helix-bundle	1	4.5116206E-8
all-hours	2	9.023241E-8
all-human	3	1.3534861E-7
all-importance	1	4.5116206E-8
all-important	24	1.0827889E-6
all-in	4	1.8046482E-7
all-in-one	1	4.5116206E-8
all-inclusive	23	1.0376727E-6
all-jam-bands-all-the-time	1	4.5116206E-8
all-knowing	8	3.6092965E-7
all-laughs	1	4.5116206E-8
all-leather	2	9.023241E-8
all-levels	1	4.5116206E-8
all-local	1	4.5116206E-8
all-lower-case	1	4.5116206E-8
all-lowercase	3	1.3534861E-7
all-mail	2	9.023241E-8
all-male	14	6.316269E-7
all-means	1	4.5116206E-8
all-media	1	4.5116206E-8
all-members	2	9.023241E-8
all-men	1	4.5116206E-8
all-merciful	1	4.5116206E-8
all-metal	1	4.5116206E-8
all-mighty	1	4.5116206E-8
all-mond	1	4.5116206E-8
all-naked	1	4.5116206E-8
all-natural	5	2.2558103E-7
all-network	1	4.5116206E-8
all-new	22	9.925566E-7
all-news	6	2.7069723E-7
all-news-all-the-time	1	4.5116206E-8
all-night	23	1.0376727E-6
all-nighter	7	3.1581345E-7
all-nighter-company-keeping	1	4.5116206E-8
all-nighters	3	1.3534861E-7
all-nighters-pulling	1	4.5116206E-8
all-nude	7	3.1581345E-7
all-nude-debate	1	4.5116206E-8
all-one	2	9.023241E-8
all-or-none	2	9.023241E-8
all-or-nothing	9	4.0604587E-7
all-out	41	1.8497644E-6
all-over	5	2.2558103E-7
all-pay	1	4.5116206E-8
all-payer	1	4.5116206E-8
all-pervading	1	4.5116206E-8
all-pervasive	6	2.7069723E-7
all-points	3	1.3534861E-7
all-powerful	21	9.4744036E-7
all-pro	1	4.5116206E-8
all-pupil	1	4.5116206E-8
all-purpose	34	1.533951E-6
all-rac	1	4.5116206E-8
all-rac-?-tocopherol	1	4.5116206E-8
all-race	1	4.5116206E-8
all-risk	1	4.5116206E-8
all-rock	1	4.5116206E-8
all-round	4	1.8046482E-7
all-school	1	4.5116206E-8
all-season	2	9.023241E-8
all-seeing	7	3.1581345E-7
all-ship	1	4.5116206E-8
all-singing	1	4.5116206E-8
all-sister	1	4.5116206E-8
all-source	9	4.0604587E-7
all-sports	3	1.3534861E-7
all-staff	1	4.5116206E-8
all-stakes	1	4.5116206E-8
all-star	49	2.2106942E-6
all-stars	3	1.3534861E-7
all-state	1	4.5116206E-8
all-stock	9	4.0604587E-7
all-student	1	4.5116206E-8
all-survivors	16	7.218593E-7
all-talk	2	9.023241E-8
all-temperature	1	4.5116206E-8
all-terrain	2	9.023241E-8
all-text	3	1.3534861E-7
all-the	2	9.023241E-8
all-the-president	1	4.5116206E-8
all-the-time	4	1.8046482E-7
all-the-way-to-the-edge	1	4.5116206E-8
all-there	1	4.5116206E-8
all-things-to-all-people	1	4.5116206E-8
all-time	122	5.5041774E-6
all-time-high	1	4.5116206E-8
all-timers	1	4.5116206E-8
all-to	1	4.5116206E-8
all-together	1	4.5116206E-8
all-together-now	1	4.5116206E-8
all-too-common	3	1.3534861E-7
all-too-credulous	1	4.5116206E-8
all-too-familiar	5	2.2558103E-7
all-too-frequent	1	4.5116206E-8
all-too-human	2	9.023241E-8
all-too-pervasive	1	4.5116206E-8
all-too-rare	1	4.5116206E-8
all-too-real	1	4.5116206E-8
all-too-scarce	1	4.5116206E-8
all-too-sexy	1	4.5116206E-8
all-too-sudden	1	4.5116206E-8
all-too-typical	1	4.5116206E-8
all-trans	29	1.30837E-6
all-trans-retinal	1	4.5116206E-8
all-try	1	4.5116206E-8
all-versus-all	1	4.5116206E-8
all-volunteer	2	9.023241E-8
all-weather	7	3.1581345E-7
all-week	1	4.5116206E-8
all-wheel-drive	2	9.023241E-8
all-white	17	7.669755E-7
all-wise	1	4.5116206E-8
all-women	2	9.023241E-8
all-world	1	4.5116206E-8
all-you-can	1	4.5116206E-8
all-you-can-eat	2	9.023241E-8
alla	18	8.1209174E-7
allada	1	4.5116206E-8
alladvantage	1	4.5116206E-8
allagash	3	1.3534861E-7
allah	50	2.2558104E-6
allah-prevail	1	4.5116206E-8
allahabad	1	4.5116206E-8
allahu	1	4.5116206E-8
allaire	2	9.023241E-8
allais	3	1.3534861E-7
allakhverdov	1	4.5116206E-8
allan	61	2.7520887E-6
allanheld	1	4.5116206E-8
allante	2	9.023241E-8
allantoin	1	4.5116206E-8
allapplicable	1	4.5116206E-8
allard	2	9.023241E-8
allat	1	4.5116206E-8
allay	26	1.1730214E-6
allayed	5	2.2558103E-7
allaying	2	9.023241E-8
allbaugh	11	4.962783E-7
allbecause	1	4.5116206E-8
allcaps	1	4.5116206E-8
allcontract	1	4.5116206E-8
alle	1	4.5116206E-8
alledged	1	4.5116206E-8
alledgedly	1	4.5116206E-8
allee	6	2.7069723E-7
alleeeelic	1	4.5116206E-8
allegation	68	3.067902E-6
allegations	376	1.6963693E-5
allege	30	1.3534863E-6
alleged	573	2.5851587E-5
alleged-abuse	1	4.5116206E-8
allegedly	289	1.3038583E-5
allegedy	1	4.5116206E-8
alleges	76	3.4288316E-6
alleghenies	1	4.5116206E-8
allegheny	4	1.8046482E-7
allegiance	128	5.7748744E-6
allegiances	13	5.865107E-7
allegiant	2	9.023241E-8
alleging	72	3.248367E-6
allegis	9	4.0604587E-7
allegorical	15	6.767431E-7
allegorically	3	1.3534861E-7
allegories	4	1.8046482E-7
allegorizing	1	4.5116206E-8
allegory	29	1.30837E-6
allegra	15	6.767431E-7
allegre	1	4.5116206E-8
allegria	1	4.5116206E-8
allegro	3	1.3534861E-7
allegèd	1	4.5116206E-8
allehulia	1	4.5116206E-8
allele	583	2.6302749E-5
allele-sharing	2	9.023241E-8
allele-specific	51	2.3009266E-6
allelefrequencies	1	4.5116206E-8
alleleic	1	4.5116206E-8
alleles	512	2.3099497E-5
allelic	94	4.2409233E-6
allelic-interactions	1	4.5116206E-8
allelically	1	4.5116206E-8
allelism	2	9.023241E-8
allelotyping	2	9.023241E-8
alleluia	1	4.5116206E-8
allemagne	1	4.5116206E-8
alleman	1	4.5116206E-8
allemands	1	4.5116206E-8
allen	476	2.1475314E-5
allen-like	1	4.5116206E-8
allenberg	1	4.5116206E-8
allenbrand	5	2.2558103E-7
allenby	5	2.2558103E-7
allendal	1	4.5116206E-8
allendale	3	1.3534861E-7
allende	12	5.4139446E-7
allenstown	1	4.5116206E-8
allenswood	1	4.5116206E-8
allentown	3	1.3534861E-7
aller	1	4.5116206E-8
allergan	1	4.5116206E-8
allergen	39	1.7595321E-6
allergen-induced	3	1.3534861E-7
allergen-reactive	1	4.5116206E-8
allergen-specific	3	1.3534861E-7
allergenic	3	1.3534861E-7
allergenicity	1	4.5116206E-8
allergens	22	9.925566E-7
allergic	136	6.135804E-6
allergically	2	9.023241E-8
allergies	76	3.4288316E-6
allergist	2	9.023241E-8
allergists	2	9.023241E-8
allergy	97	4.376272E-6
allergy-inducing	1	4.5116206E-8
allergy-plant	1	4.5116206E-8
allergy-prone	1	4.5116206E-8
allergy-provoking	1	4.5116206E-8
allergy-ridden	1	4.5116206E-8
allergy-suffering	1	4.5116206E-8
allers	1	4.5116206E-8
allerton	3	1.3534861E-7
alles	4	1.8046482E-7
allesandro	1	4.5116206E-8
alleve	1	4.5116206E-8
alleviate	84	3.7897614E-6
alleviated	13	5.865107E-7
alleviates	2	9.023241E-8
alleviating	15	6.767431E-7
alleviation	5	2.2558103E-7
allex	2	9.023241E-8
allexperimental	1	4.5116206E-8
alley	194	8.752544E-6
alleymen	1	4.5116206E-8
alleyoop	1	4.5116206E-8
alleys	84	3.7897614E-6
alleyway	17	7.669755E-7
alleyways	38	1.7144158E-6
allez	2	9.023241E-8
allgemeine	39	1.7595321E-6
allgenes	1	4.5116206E-8
allgolf	1	4.5116206E-8
allh	3	1.3534861E-7
allha	2	9.023241E-8
allhands	1	4.5116206E-8
allhat	35	1.5790672E-6
alliacea	2	9.023241E-8
alliance	415	1.8723225E-5
alliance-and	1	4.5116206E-8
alliances	64	2.8874372E-6
alliant	1	4.5116206E-8
allibelle	6	2.7069723E-7
allie	4	1.8046482E-7
allied	167	7.5344064E-6
allied-led	1	4.5116206E-8
allies	391	1.7640437E-5
alligateur	1	4.5116206E-8
alligator	45	2.0302293E-6
alligator-infested	1	4.5116206E-8
alligator-like	1	4.5116206E-8
alligatored	1	4.5116206E-8
alligators	17	7.669755E-7
allin	4	1.8046482E-7
allina	1	4.5116206E-8
allinger	1	4.5116206E-8
allinputs	1	4.5116206E-8
allis	2	9.023241E-8
allise	1	4.5116206E-8
allisforgivencakes	2	9.023241E-8
allision	1	4.5116206E-8
allison	93	4.1958074E-6
allison-gratitude	1	4.5116206E-8
allistaire	2	9.023241E-8
alliston	1	4.5116206E-8
alliterate	1	4.5116206E-8
alliterates	1	4.5116206E-8
alliterating	1	4.5116206E-8
alliteration	9	4.0604587E-7
alliterations	1	4.5116206E-8
alliterative	12	5.4139446E-7
alliteratively	1	4.5116206E-8
alliternative	1	4.5116206E-8
allium	3	1.3534861E-7
alliums	1	4.5116206E-8
alliès	1	4.5116206E-8
alljessewants	1	4.5116206E-8
allkind	1	4.5116206E-8
alll	4	1.8046482E-7
allll	2	9.023241E-8
alllll	1	4.5116206E-8
allllll	1	4.5116206E-8
alllllllll	2	9.023241E-8
allllllllll	1	4.5116206E-8
alllyson	1	4.5116206E-8
allman	3	1.3534861E-7
allmon	11	4.962783E-7
allmusic	21	9.4744036E-7
alln	21	9.4744036E-7
alln-induced	2	9.023241E-8
allo	10	4.5116207E-7
allo-immune	2	9.023241E-8
allo-tetraploid	1	4.5116206E-8
allocate	125	5.6395256E-6
allocateallowances	1	4.5116206E-8
allocated	210	9.474404E-6
allocatedunder	1	4.5116206E-8
allocates	13	5.865107E-7
allocating	44	1.9851132E-6
allocation	270	1.21813755E-5
allocationamount	1	4.5116206E-8
allocationfor	1	4.5116206E-8
allocations	123	5.5492933E-6
allocations-levels	1	4.5116206E-8
allochrome	1	4.5116206E-8
allochthonous	1	4.5116206E-8
allodynia	3	1.3534861E-7
allogeneic	12	5.4139446E-7
allograft	13	5.865107E-7
allografts	4	1.8046482E-7
allogrooming	2	9.023241E-8
allolactose	3	1.3534861E-7
allometry	1	4.5116206E-8
allomorphs	2	9.023241E-8
allonissos	1	4.5116206E-8
allons	4	1.8046482E-7
alloo	1	4.5116206E-8
allopathic	3	1.3534861E-7
allopatric	18	8.1209174E-7
allopatry	5	2.2558103E-7
allophone	1	4.5116206E-8
allophonic	1	4.5116206E-8
allophycocyanin	4	1.8046482E-7
alloplo	1	4.5116206E-8
alloploi	1	4.5116206E-8
alloploidy	1	4.5116206E-8
allopolyploid	2	9.023241E-8
allopolyploidy	14	6.316269E-7
allopregnanolone	2	9.023241E-8
allopurinol	2	9.023241E-8
allose	1	4.5116206E-8
allosteric	36	1.6241835E-6
allosterically	2	9.023241E-8
allostery	2	9.023241E-8
allot	14	6.316269E-7
allother	1	4.5116206E-8
allotment	14	6.316269E-7
allotments	7	3.1581345E-7
allots	2	9.023241E-8
allott	2	9.023241E-8
allotted	34	1.533951E-6
allottees	1	4.5116206E-8
allotting	1	4.5116206E-8
allout	1	4.5116206E-8
allover	4	1.8046482E-7
allow	2139	9.6503565E-5
allowability	1	4.5116206E-8
allowable	61	2.7520887E-6
allowance	230	1.0376728E-5
allowance-to-emission-reduction	4	1.8046482E-7
allowanceallocations	2	9.023241E-8
allowanceprogram	1	4.5116206E-8
allowances	657	2.9641347E-5
allowancesallocated	1	4.5116206E-8
allowancesavailable	2	9.023241E-8
allowancescomprising	1	4.5116206E-8
allowancesunder	3	1.3534861E-7
allowed	2244	1.0124077E-4
allowing	842	3.7987847E-5
allows	1068	4.818411E-5
allowsoptimal	1	4.5116206E-8
alloxan	1	4.5116206E-8
alloy	11	4.962783E-7
alloyed	1	4.5116206E-8
alloys	11	4.962783E-7
allozyme	1	4.5116206E-8
allozymes	1	4.5116206E-8
allpolitics	8	3.6092965E-7
allport	3	1.3534861E-7
allpostoperative	1	4.5116206E-8
allpurpose	1	4.5116206E-8
allraitnik	1	4.5116206E-8
allready	1	4.5116206E-8
allreasonable	1	4.5116206E-8
allrecipes	1	4.5116206E-8
allred	3	1.3534861E-7
allright	5	2.2558103E-7
allrightnik	1	4.5116206E-8
allrighty	1	4.5116206E-8
allroad	1	4.5116206E-8
alls	4	1.8046482E-7
allsource	1	4.5116206E-8
allspice	2	9.023241E-8
allstarfanprotest	1	4.5116206E-8
allstars	1	4.5116206E-8
allstate	4	1.8046482E-7
allston	10	4.5116207E-7
allt	1	4.5116206E-8
alltell	1	4.5116206E-8
allterrain	1	4.5116206E-8
allthat	1	4.5116206E-8
alltime	1	4.5116206E-8
alltogether	2	9.023241E-8
allude	16	7.218593E-7
alluded	31	1.3986024E-6
alludes	24	1.0827889E-6
alluding	35	1.5790672E-6
allure	61	2.7520887E-6
allures	1	4.5116206E-8
alluring	38	1.7144158E-6
alluringly	3	1.3534861E-7
allusion	44	1.9851132E-6
allusion-dropping	1	4.5116206E-8
allusions	41	1.8497644E-6
allusive	9	4.0604587E-7
allusively	1	4.5116206E-8
allusiveness	1	4.5116206E-8
alluvial	7	3.1581345E-7
alluvials	1	4.5116206E-8
alluvium	5	2.2558103E-7
allwang	1	4.5116206E-8
ally	225	1.0151147E-5
allying	5	2.2558103E-7
allyl-d	2	9.023241E-8
allyn	1	4.5116206E-8
allyourbase	1	4.5116206E-8
allysa	2	9.023241E-8
allyshun	1	4.5116206E-8
allyson	617	2.7836699E-5
allyson-it	1	4.5116206E-8
allysonian	1	4.5116206E-8
allègre	2	9.023241E-8
allée	2	9.023241E-8
allées	2	9.023241E-8
alm	81	3.6544127E-6
alma	66	2.9776697E-6
almaden	1	4.5116206E-8
almagor	2	9.023241E-8
almah	22	9.925566E-7
almahide	1	4.5116206E-8
almanac	23	1.0376727E-6
almanacs	2	9.023241E-8
almancil	6	2.7069723E-7
almanzo	1	4.5116206E-8
almanzor	1	4.5116206E-8
almanzora	1	4.5116206E-8
almare	5	2.2558103E-7
almaty	1	4.5116206E-8
almedina	1	4.5116206E-8
almeida	17	7.669755E-7
almei­da	1	4.5116206E-8
almejasbaby	2	9.023241E-8
almendro	1	4.5116206E-8
almereyda	2	9.023241E-8
almería	15	6.767431E-7
almighty	38	1.7144158E-6
almirante	2	9.023241E-8
almishkat	1	4.5116206E-8
alml	1	4.5116206E-8
almo	4	1.8046482E-7
almodis	1	4.5116206E-8
almodovar	7	3.1581345E-7
almodóvar	11	4.962783E-7
almogim	1	4.5116206E-8
almohada	1	4.5116206E-8
almohades	1	4.5116206E-8
almohads	1	4.5116206E-8
almond	58	2.61674E-6
almond-crusted	1	4.5116206E-8
almond-lemon	1	4.5116206E-8
almond-shaped	3	1.3534861E-7
almonds	27	1.2181375E-6
almonry	1	4.5116206E-8
almonte	1	4.5116206E-8
almoravid	1	4.5116206E-8
almoravids	1	4.5116206E-8
almost	6235	2.8129955E-4
almost-a-campaign	1	4.5116206E-8
almost-animal	1	4.5116206E-8
almost-beautiful	1	4.5116206E-8
almost-birthday-twin	1	4.5116206E-8
almost-black	2	9.023241E-8
almost-but-not-entirely	1	4.5116206E-8
almost-but-not-quite-redoubtable	1	4.5116206E-8
almost-cherubic	1	4.5116206E-8
almost-comedy	1	4.5116206E-8
almost-completed	1	4.5116206E-8
almost-completely	1	4.5116206E-8
almost-declaration	1	4.5116206E-8
almost-delivered	1	4.5116206E-8
almost-dusty	1	4.5116206E-8
almost-empty	2	9.023241E-8
almost-endless	1	4.5116206E-8
almost-forgotten	1	4.5116206E-8
almost-half	1	4.5116206E-8
almost-lost	1	4.5116206E-8
almost-mythological	1	4.5116206E-8
almost-not-red-at-all	1	4.5116206E-8
almost-painful	1	4.5116206E-8
almost-polite	1	4.5116206E-8
almost-president	1	4.5116206E-8
almost-real	1	4.5116206E-8
almost-straight	1	4.5116206E-8
almosts	1	4.5116206E-8
almostsane	2	9.023241E-8
almourol	1	4.5116206E-8
almr	1	4.5116206E-8
alms	46	2.0753455E-6
almsbasket	1	4.5116206E-8
almshouse	1	4.5116206E-8
almsot	3	1.3534861E-7
almsround	1	4.5116206E-8
almudaina	5	2.2558103E-7
almuñécar	5	2.2558103E-7
almy	5	2.2558103E-7
almyerda	1	4.5116206E-8
aln	3	1.3534861E-7
alnifolium	1	4.5116206E-8
alnorum	1	4.5116206E-8
alnus	1	4.5116206E-8
alnylam	3	1.3534861E-7
alo	1	4.5116206E-8
alocal	1	4.5116206E-8
aloe	7	3.1581345E-7
aloed	1	4.5116206E-8
alof	1	4.5116206E-8
aloft	18	8.1209174E-7
alogencim	1	4.5116206E-8
aloha	11	4.962783E-7
alohnna	1	4.5116206E-8
alois	2	9.023241E-8
alok	2	9.023241E-8
aloka	2	9.023241E-8
alol	1	4.5116206E-8
alom	1	4.5116206E-8
alomar	30	1.3534863E-6
alomari	1	4.5116206E-8
alon	3	1.3534861E-7
alona	1	4.5116206E-8
alone	2799	1.2628027E-4
alone-ness	1	4.5116206E-8
alone-to	1	4.5116206E-8
aloneness	7	3.1581345E-7
along	5502	2.4822936E-4
along-getting	1	4.5116206E-8
alonger	1	4.5116206E-8
alongside	272	1.2271608E-5
alonissos	5	2.2558103E-7
alonso	15	6.767431E-7
alonzo	18	8.1209174E-7
alonzo-dunsmoor	1	4.5116206E-8
aloo	1	4.5116206E-8
aloof	35	1.5790672E-6
aloofness	13	5.865107E-7
alope	1	4.5116206E-8
alopecia	1	4.5116206E-8
alor	1	4.5116206E-8
alora	1	4.5116206E-8
alors	6	2.7069723E-7
alosetron	1	4.5116206E-8
alot	18	8.1209174E-7
alotamus	1	4.5116206E-8
alotta	1	4.5116206E-8
alou	15	6.767431E-7
alouatte	1	4.5116206E-8
aloud	72	3.248367E-6
alouicious	1	4.5116206E-8
aloul	5	2.2558103E-7
alove	4	1.8046482E-7
aloy	2	9.023241E-8
aloyisia	2	9.023241E-8
aloysia	1	4.5116206E-8
aloysius	6	2.7069723E-7
alp	1	4.5116206E-8
alp-like	1	4.5116206E-8
alpa	1	4.5116206E-8
alpaca	6	2.7069723E-7
alpacas	3	1.3534861E-7
alpar	3	1.3534861E-7
alpargatas	1	4.5116206E-8
alpaugh	10	4.5116207E-7
alpco	1	4.5116206E-8
alpe	3	1.3534861E-7
alpena	2	9.023241E-8
alpenglow	1	4.5116206E-8
alper	1	4.5116206E-8
alperin	2	9.023241E-8
alpern	1	4.5116206E-8
alpert	9	4.0604587E-7
alpes	14	6.316269E-7
alpha	475	2.1430198E-5
alpha-adrenergic	6	2.7069723E-7
alpha-alpha	1	4.5116206E-8
alpha-amino	1	4.5116206E-8
alpha-amino-caprylic	1	4.5116206E-8
alpha-amylase	8	3.6092965E-7
alpha-amylases	2	9.023241E-8
alpha-antagonists	1	4.5116206E-8
alpha-carbon	2	9.023241E-8
alpha-chain	1	4.5116206E-8
alpha-crystallin	37	1.6692996E-6
alpha-factor	1	4.5116206E-8
alpha-ferret	1	4.5116206E-8
alpha-fibrin	2	9.023241E-8
alpha-globin	1	4.5116206E-8
alpha-glucosidase	1	4.5116206E-8
alpha-ground-squirrel	1	4.5116206E-8
alpha-gustducin	2	9.023241E-8
alpha-helical	4	1.8046482E-7
alpha-helix	1	4.5116206E-8
alpha-helix-initiation	1	4.5116206E-8
alpha-helix-termination	1	4.5116206E-8
alpha-hydroxy	1	4.5116206E-8
alpha-hydroxylase	1	4.5116206E-8
alpha-interferon	1	4.5116206E-8
alpha-keto	1	4.5116206E-8
alpha-keto-dehydrogenase	1	4.5116206E-8
alpha-keto-glu	1	4.5116206E-8
alpha-keto-gluterate	4	1.8046482E-7
alpha-male	3	1.3534861E-7
alpha-malevolent	1	4.5116206E-8
alpha-myosin	1	4.5116206E-8
alpha-numeric	1	4.5116206E-8
alpha-proteobacteria	10	4.5116207E-7
alpha-proteobacterial	12	5.4139446E-7
alpha-proteobacterium	2	9.023241E-8
alpha-satellite	1	4.5116206E-8
alpha-secretases	1	4.5116206E-8
alpha-to-enter	2	9.023241E-8
alpha-to-remove	2	9.023241E-8
alpha-tocopherol	63	2.842321E-6
alpha-tocopheryl	26	1.1730214E-6
alpha-tropo-miacine	1	4.5116206E-8
alpha-tubulin	1	4.5116206E-8
alpha-wave-overdosed	1	4.5116206E-8
alphaa	66	2.9776697E-6
alphaa-crystallin	1	4.5116206E-8
alphaako	2	9.023241E-8
alphab	29	1.30837E-6
alphab-crystallin	1	4.5116206E-8
alphabet	128	5.7748744E-6
alphabet-lace	1	4.5116206E-8
alphabeta	1	4.5116206E-8
alphabetic	15	6.767431E-7
alphabetical	42	1.8948807E-6
alphabetically	26	1.1730214E-6
alphabetization	4	1.8046482E-7
alphabetize	2	9.023241E-8
alphabetized	6	2.7069723E-7
alphabetizes	1	4.5116206E-8
alphabetizing	3	1.3534861E-7
alphabets	19	8.572079E-7
alphabko	2	9.023241E-8
alphacel	2	9.023241E-8
alphaeasefc	1	4.5116206E-8
alphagene	1	4.5116206E-8
alphanumeric	6	2.7069723E-7
alpharabius	1	4.5116206E-8
alpharetta	7	3.1581345E-7
alphas	5	2.2558103E-7
alphaville	5	2.2558103E-7
alphoid	25	1.1279052E-6
alphonse	1	4.5116206E-8
alphonsus	1	4.5116206E-8
alpilles	2	9.023241E-8
alpin	1	4.5116206E-8
alpine	57	2.5716238E-6
alpine-backed	1	4.5116206E-8
alpinia	10	4.5116207E-7
alpinus	1	4.5116206E-8
alpirez	1	4.5116206E-8
alpo	2	9.023241E-8
alportel	2	9.023241E-8
alpro	2	9.023241E-8
alps	103	4.6469695E-6
alpujarra	4	1.8046482E-7
alpujarras	3	1.3534861E-7
alq	1	4.5116206E-8
alqueda	1	4.5116206E-8
alr	4	1.8046482E-7
alre	1	4.5116206E-8
alreadhy	2	9.023241E-8
already	5769	2.602754E-4
already-called	3	1.3534861E-7
already-crowded	1	4.5116206E-8
already-dead-scene	1	4.5116206E-8
already-delivered	1	4.5116206E-8
already-established	1	4.5116206E-8
already-existing	1	4.5116206E-8
already-finished	1	4.5116206E-8
already-impressive	1	4.5116206E-8
already-limited	1	4.5116206E-8
already-low	1	4.5116206E-8
already-myelinated	1	4.5116206E-8
already-occupied	1	4.5116206E-8
already-once-convicted	1	4.5116206E-8
already-ongoing	1	4.5116206E-8
already-outdated	1	4.5116206E-8
already-overburdened	1	4.5116206E-8
already-processed	1	4.5116206E-8
already-reported	1	4.5116206E-8
already-scheduled	1	4.5116206E-8
already-seen	1	4.5116206E-8
already-snarled	1	4.5116206E-8
already-strong	1	4.5116206E-8
already-waiting	1	4.5116206E-8
already-weak	1	4.5116206E-8
alreadydrowned	1	4.5116206E-8
alrededor	1	4.5116206E-8
alri	2	9.023241E-8
alright	712	3.2122738E-5
alrighty	35	1.5790672E-6
alrm	1	4.5116206E-8
alroomi	1	4.5116206E-8
als	27	1.2181375E-6
alsace	17	7.669755E-7
alsacien	1	4.5116206E-8
alsafar	1	4.5116206E-8
alsamoud	2	9.023241E-8
alsamouds	3	1.3534861E-7
alsancak	1	4.5116206E-8
alsatian	14	6.316269E-7
alsdorf	1	4.5116206E-8
alsmadi	1	4.5116206E-8
also	32936	0.0014859474
also-ran	7	3.1581345E-7
also-rans	5	2.2558103E-7
also-where	1	4.5116206E-8
alsoashes	1	4.5116206E-8
alsofrom	1	4.5116206E-8
alsomeasured	1	4.5116206E-8
alson	1	4.5116206E-8
alsop	3	1.3534861E-7
alstom	3	1.3534861E-7
alston	2	9.023241E-8
alstott	1	4.5116206E-8
alt	69	3.1130182E-6
alt-control-delete	1	4.5116206E-8
alt-countriers	1	4.5116206E-8
alt-country	3	1.3534861E-7
alt-countrypolitan	1	4.5116206E-8
alt-folk	2	9.023241E-8
alt-med	2	9.023241E-8
alt-pop	2	9.023241E-8
alt-press	1	4.5116206E-8
alt-rock	2	9.023241E-8
alt?nkap?	1	4.5116206E-8
alta	19	8.572079E-7
altaaf	3	1.3534861E-7
altadena	2	9.023241E-8
altaic	2	9.023241E-8
altair	2	9.023241E-8
altamira	3	1.3534861E-7
altamirano	1	4.5116206E-8
altamont	2	9.023241E-8
altamonte	1	4.5116206E-8
altana	9	4.0604587E-7
altar	200	9.023242E-6
altar-like	1	4.5116206E-8
altarcito	2	9.023241E-8
altarcitos	1	4.5116206E-8
altare	1	4.5116206E-8
altarpiece	17	7.669755E-7
altarpieces	3	1.3534861E-7
altars	40	1.8046483E-6
altar­piece	1	4.5116206E-8
altas	2	9.023241E-8
altavista	12	5.4139446E-7
altaya	1	4.5116206E-8
alte	8	3.6092965E-7
altea	7	3.1581345E-7
altea-la	1	4.5116206E-8
altenberg	2	9.023241E-8
altendorfs	1	4.5116206E-8
alter	448	2.0212061E-5
alter-ego	2	9.023241E-8
alteration	149	6.722315E-6
alterations	259	1.1685098E-5
altercation	5	2.2558103E-7
altercations	3	1.3534861E-7
altered	630	2.842321E-5
alterers	1	4.5116206E-8
altering	131	5.910223E-6
alterman	24	1.0827889E-6
alternate	238	1.0737657E-5
alternate-dimensional	1	4.5116206E-8
alternate-history	3	1.3534861E-7
alternate-side-of-the-street	1	4.5116206E-8
alternated	12	5.4139446E-7
alternatehistory	1	4.5116206E-8
alternately	68	3.067902E-6
alternatepersonality	1	4.5116206E-8
alternates	14	6.316269E-7
alternating	56	2.5265076E-6
alternation	4	1.8046482E-7
alternations	1	4.5116206E-8
alternative	1770	7.985569E-5
alternative-country	2	9.023241E-8
alternative-free-response	1	4.5116206E-8
alternative-fuels	1	4.5116206E-8
alternative-medicine	2	9.023241E-8
alternative-news	1	4.5116206E-8
alternative-program	1	4.5116206E-8
alternative-rock	3	1.3534861E-7
alternative-universe	1	4.5116206E-8
alternativebalancing	1	4.5116206E-8
alternativecompliance	1	4.5116206E-8
alternatively	341	1.5384627E-5
alternatives	353	1.5926022E-5
alternativesconsidered	1	4.5116206E-8
alternator	14	6.316269E-7
alters	73	3.2934831E-6
altersstil	1	4.5116206E-8
alterthe	1	4.5116206E-8
altes	6	2.7069723E-7
altfest	2	9.023241E-8
althea	15	6.767431E-7
alther	1	4.5116206E-8
althert	1	4.5116206E-8
altho	3	1.3534861E-7
althoff	2	9.023241E-8
althogh	1	4.5116206E-8
althorp	3	1.3534861E-7
althoug	1	4.5116206E-8
although	7817	3.5267338E-4
althoughj	1	4.5116206E-8
althought	1	4.5116206E-8
althoughthere	1	4.5116206E-8
althoughto	3	1.3534861E-7
althugh	1	4.5116206E-8
althumairy	6	2.7069723E-7
althusser	1	4.5116206E-8
alticor	2	9.023241E-8
altie-hip-hop	1	4.5116206E-8
alties	1	4.5116206E-8
altima	6	2.7069723E-7
altimas	1	4.5116206E-8
altimeter	3	1.3534861E-7
altinkum	1	4.5116206E-8
altiplano	1	4.5116206E-8
altissima	1	4.5116206E-8
altitude	138	6.2260365E-6
altitude-measuring	1	4.5116206E-8
altitudes	28	1.2632538E-6
altman	109	4.9176665E-6
altmans	1	4.5116206E-8
alto	130	5.8651067E-6
altogether	307	1.3850676E-5
altoids	3	1.3534861E-7
alton	34	1.533951E-6
alton-based	2	9.023241E-8
altonaer	2	9.023241E-8
altoona	2	9.023241E-8
altos	6	2.7069723E-7
altra	1	4.5116206E-8
altreuter	1	4.5116206E-8
altrincham	3	1.3534861E-7
altropine	1	4.5116206E-8
altrose	1	4.5116206E-8
altruism	35	1.5790672E-6
altruist	4	1.8046482E-7
altruistic	31	1.3986024E-6
altruistically	1	4.5116206E-8
altruists	3	1.3534861E-7
altrusa	2	9.023241E-8
altrusian	2	9.023241E-8
altrusitic	1	4.5116206E-8
altsanger	5	2.2558103E-7
altschul	1	4.5116206E-8
altstadt	2	9.023241E-8
altstätten	1	4.5116206E-8
altunisi	1	4.5116206E-8
alturas	1	4.5116206E-8
altus	3	1.3534861E-7
altísimo	1	4.5116206E-8
alu	69	3.1130182E-6
aluf	2	9.023241E-8
alui	1	4.5116206E-8
alum	22	9.925566E-7
alumah	1	4.5116206E-8
alumen	2	9.023241E-8
alumin	1	4.5116206E-8
alumina	3	1.3534861E-7
aluminium	19	8.572079E-7
aluminous	1	4.5116206E-8
aluminum	289	1.3038583E-5
aluminum-alloy	1	4.5116206E-8
aluminum-clad	1	4.5116206E-8
aluminum-wielding	1	4.5116206E-8
alumium	1	4.5116206E-8
alumna	8	3.6092965E-7
alumnae	7	3.1581345E-7
alumni	239	1.0782774E-5
alumnus	30	1.3534863E-6
alums	5	2.2558103E-7
alun-alun	1	4.5116206E-8
alured	1	4.5116206E-8
alurista	2	9.023241E-8
alus	1	4.5116206E-8
alusuisse	1	4.5116206E-8
alutaceus	1	4.5116206E-8
alv	4	1.8046482E-7
alva	4	1.8046482E-7
alvar	4	1.8046482E-7
alvarado	13	5.865107E-7
alvares	1	4.5116206E-8
alvarez	30	1.3534863E-6
alvaro	4	1.8046482E-7
alvent	6	2.7069723E-7
alveolar	75	3.3837155E-6
alveolar-capillary	4	1.8046482E-7
alveolar-interstitial	2	9.023241E-8
alveoli	12	5.4139446E-7
alveolitis	1	4.5116206E-8
alveolus	3	1.3534861E-7
alvernia	4	1.8046482E-7
alves	1	4.5116206E-8
alvin	25	1.1279052E-6
alvinium	3	1.3534861E-7
alvor	3	1.3534861E-7
alvy	1	4.5116206E-8
alvão	1	4.5116206E-8
alwa	2	9.023241E-8
alwaleed	1	4.5116206E-8
alwan	2	9.023241E-8
alwas	1	4.5116206E-8
alway	3	1.3534861E-7
always	9696	4.3744675E-4
always-important	1	4.5116206E-8
always-on	1	4.5116206E-8
always-present	1	4.5116206E-8
always-right	1	4.5116206E-8
always-rightness	1	4.5116206E-8
always-shrewd	1	4.5116206E-8
always-spectacular	1	4.5116206E-8
always-taker	1	4.5116206E-8
always-takers	1	4.5116206E-8
always-troubled	1	4.5116206E-8
alwaysattend	1	4.5116206E-8
alwin	1	4.5116206E-8
alwn	1	4.5116206E-8
alwni	1	4.5116206E-8
alwsy	1	4.5116206E-8
alwyn	1	4.5116206E-8
aly	19	8.572079E-7
alyamani	1	4.5116206E-8
alyce	1	4.5116206E-8
alydar	2	9.023241E-8
alyeska	3	1.3534861E-7
alynne	11	4.962783E-7
alyosha	1	4.5116206E-8
alyscamps	1	4.5116206E-8
alysheba	2	9.023241E-8
alysis	1	4.5116206E-8
alyson	44	1.9851132E-6
alysonhannigancorner	1	4.5116206E-8
alyssa	9	4.0604587E-7
alyzer	1	4.5116206E-8
alzet	1	4.5116206E-8
alzforum	1	4.5116206E-8
alzheimer	200	9.023242E-6
alzheimers	2	9.023241E-8
alzou	1	4.5116206E-8
al­ca­lá	1	4.5116206E-8
al­lowed	1	4.5116206E-8
aléxandros	1	4.5116206E-8
alêne	1	4.5116206E-8
am	8414	3.7960775E-4
am-add-nyt-budget	17	7.669755E-7
am-chau	2	9.023241E-8
am-early-frontpage-nyt	9	4.0604587E-7
am-frontpage-nyt	10	4.5116207E-7
am-ing	1	4.5116206E-8
am-not-a-princess	2	9.023241E-8
am-nyt-budget	15	6.767431E-7
am-or	1	4.5116206E-8
am-page	14	6.316269E-7
am-to-midnight	1	4.5116206E-8
am-type	1	4.5116206E-8
am?teátrum	1	4.5116206E-8
ama	67	3.022786E-6
ama-assn	2	9.023241E-8
amabelle	1	4.5116206E-8
amabilis	2	9.023241E-8
amaco	1	4.5116206E-8
amacrine	10	4.5116207E-7
amad	3	1.3534861E-7
amadei	5	2.2558103E-7
amadeus	10	4.5116207E-7
amado	1	4.5116206E-8
amador	6	2.7069723E-7
amadorio	2	9.023241E-8
amadou	9	4.0604587E-7
amadour	1	4.5116206E-8
amagansett	2	9.023241E-8
amah	1	4.5116206E-8
amahiganiak	1	4.5116206E-8
amahlia	1	4.5116206E-8
amainstream	1	4.5116206E-8
amajor	1	4.5116206E-8
amajority	1	4.5116206E-8
amakusa	3	1.3534861E-7
amal	6	2.7069723E-7
amalfi	12	5.4139446E-7
amalgam	36	1.6241835E-6
amalgamate	4	1.8046482E-7
amalgamated	12	5.4139446E-7
amalgamates	1	4.5116206E-8
amalgamation	12	5.4139446E-7
amalgamations	1	4.5116206E-8
amalgams	1	4.5116206E-8
amalgan	1	4.5116206E-8
amalgo	3	1.3534861E-7
amali	3	1.3534861E-7
amalia	6	2.7069723E-7
amalias	2	9.023241E-8
amalie	8	3.6092965E-7
amalla	1	4.5116206E-8
amalricus	2	9.023241E-8
amalthea	2	9.023241E-8
amama	1	4.5116206E-8
aman	8	3.6092965E-7
amanda	124	5.5944097E-6
amandaness	1	4.5116206E-8
amani	2	9.023241E-8
amanitas	1	4.5116206E-8
amanpour	3	1.3534861E-7
amantadine	4	1.8046482E-7
amante	1	4.5116206E-8
amanti	1	4.5116206E-8
amantidine-resistant	1	4.5116206E-8
amantis	2	9.023241E-8
amanuenses	1	4.5116206E-8
amanuensis	1	4.5116206E-8
amaqjuaq	1	4.5116206E-8
amar	30	1.3534863E-6
amara	4	1.8046482E-7
amaral	6	2.7069723E-7
amarante	1	4.5116206E-8
amaranth	2	9.023241E-8
amaretto	6	2.7069723E-7
amarga	1	4.5116206E-8
amari	2	9.023241E-8
amarilla	1	4.5116206E-8
amarillo	36	1.6241835E-6
amarillo-area	1	4.5116206E-8
amarillo-based	1	4.5116206E-8
amarillodiocese	1	4.5116206E-8
amarinic	1	4.5116206E-8
amarlai	1	4.5116206E-8
amarna	4	1.8046482E-7
amarnath	1	4.5116206E-8
amaro	1	4.5116206E-8
amaros	20	9.0232413E-7
amarra	3	1.3534861E-7
amartya	4	1.8046482E-7
amarus	1	4.5116206E-8
amaryllis	2	9.023241E-8
amas	1	4.5116206E-8
amasando	1	4.5116206E-8
amass	16	7.218593E-7
amassed	42	1.8948807E-6
amasses	2	9.023241E-8
amassing	15	6.767431E-7
amaterasu	4	1.8046482E-7
amateur	178	8.0306845E-6
amateur-astronomer	1	4.5116206E-8
amateur-theater	1	4.5116206E-8
amateurbitch	1	4.5116206E-8
amateurish	20	9.0232413E-7
amateurishness	1	4.5116206E-8
amateurs	42	1.8948807E-6
amatller	2	9.023241E-8
amato	97	4.376272E-6
amatoing	2	9.023241E-8
amatoism	1	4.5116206E-8
amatory	1	4.5116206E-8
amatter	1	4.5116206E-8
amature	1	4.5116206E-8
amauri	1	4.5116206E-8
amaurosis	1	4.5116206E-8
amaury	1	4.5116206E-8
amavit	1	4.5116206E-8
amaya	2	9.023241E-8
amaze	12	5.4139446E-7
amazed	218	9.835333E-6
amazeingfunmazes	1	4.5116206E-8
amazement	44	1.9851132E-6
amazes	34	1.533951E-6
amaziah	1	4.5116206E-8
amazigh	1	4.5116206E-8
amazin	1	4.5116206E-8
amazing	1037	4.6785506E-5
amazing-review	3	1.3534861E-7
amazingly	123	5.5492933E-6
amazon	440	1.9851132E-5
amazon-earnings	2	9.023241E-8
amazon-earns	1	4.5116206E-8
amazon-like	2	9.023241E-8
amazon-radar	1	4.5116206E-8
amazona	1	4.5116206E-8
amazoned	1	4.5116206E-8
amazonia	1	4.5116206E-8
amazonian	13	5.865107E-7
amazons	1	4.5116206E-8
amb	2	9.023241E-8
amba	1	4.5116206E-8
ambah	4	1.8046482E-7
ambani	11	4.962783E-7
ambash	6	2.7069723E-7
ambassador	237	1.0692541E-5
ambassador-at-large	1	4.5116206E-8
ambassador-level	1	4.5116206E-8
ambassador-nominee	1	4.5116206E-8
ambassadorial	6	2.7069723E-7
ambassadors	34	1.533951E-6
ambassadorship	7	3.1581345E-7
ambassadorships	4	1.8046482E-7
ambassy	1	4.5116206E-8
amber	122	5.5041774E-6
amber-coloured	1	4.5116206E-8
amber-lighted	1	4.5116206E-8
ambergris	1	4.5116206E-8
amberjack	3	1.3534861E-7
amberlyte	1	4.5116206E-8
ambersons	1	4.5116206E-8
amberstone	1	4.5116206E-8
ambev	2	9.023241E-8
ambi	2	9.023241E-8
ambiance	10	4.5116207E-7
ambidexterity	1	4.5116206E-8
ambidextrous	8	3.6092965E-7
ambien	3	1.3534861E-7
ambience	45	2.0302293E-6
ambient	104	4.6920854E-6
ambigious	2	9.023241E-8
ambigous	1	4.5116206E-8
ambiguities	35	1.5790672E-6
ambiguity	131	5.910223E-6
ambiguous	170	7.669755E-6
ambiguously	7	3.1581345E-7
ambiguus	2	9.023241E-8
ambion	62	2.7972048E-6
ambis	1	4.5116206E-8
ambisextrous	2	9.023241E-8
ambit	5	2.2558103E-7
ambiti	1	4.5116206E-8
ambition	148	6.6771986E-6
ambition-crazed	1	4.5116206E-8
ambitions	117	5.2785963E-6
ambitious	298	1.344463E-5
ambitiously	6	2.7069723E-7
ambivalence	69	3.1130182E-6
ambivalent	78	3.5190642E-6
ambivalently	1	4.5116206E-8
ambivialent	1	4.5116206E-8
amble	10	4.5116207E-7
ambled	4	1.8046482E-7
ambler	2	9.023241E-8
ambles	1	4.5116206E-8
ambleside	20	9.0232413E-7
ambling	8	3.6092965E-7
amboise	3	1.3534861E-7
ambon	1	4.5116206E-8
ambos	2	9.023241E-8
ambosa	1	4.5116206E-8
amboy	2	9.023241E-8
ambrex	1	4.5116206E-8
ambriz	2	9.023241E-8
ambroggio	2	9.023241E-8
ambrogio	5	2.2558103E-7
ambroise	1	4.5116206E-8
ambrose	99	4.4665044E-6
ambrosia	3	1.3534861E-7
ambrosiana	1	4.5116206E-8
ambrosio	14	6.316269E-7
ambroso	1	4.5116206E-8
ambrotype	1	4.5116206E-8
ambrotypes	1	4.5116206E-8
ambrous	2	9.023241E-8
ambrozic	3	1.3534861E-7
ambs	5	2.2558103E-7
ambulan	1	4.5116206E-8
ambulance	68	3.067902E-6
ambulance-chasing	1	4.5116206E-8
ambulances	15	6.767431E-7
ambulants	2	9.023241E-8
ambulate	1	4.5116206E-8
ambulatory	65	2.9325533E-6
ambulence	1	4.5116206E-8
ambush	59	2.6618561E-6
ambushed	18	8.1209174E-7
ambushers	3	1.3534861E-7
ambushes	1	4.5116206E-8
ambushing	4	1.8046482E-7
amby	2	9.023241E-8
ambystoma	1	4.5116206E-8
ambélou	1	4.5116206E-8
amc	17	7.669755E-7
amca	1	4.5116206E-8
amcarl	1	4.5116206E-8
amcat	1	4.5116206E-8
amchau	2	9.023241E-8
amcwamc	1	4.5116206E-8
amd	18	8.1209174E-7
amd-performance	4	1.8046482E-7
amda	1	4.5116206E-8
amdanda	1	4.5116206E-8
amdec	3	1.3534861E-7
amdt	1	4.5116206E-8
amduat	4	1.8046482E-7
ame	4	1.8046482E-7
ameboid	2	9.023241E-8
ameca	1	4.5116206E-8
amed	3	1.3534861E-7
amedeo	2	9.023241E-8
ameer	1	4.5116206E-8
ameet	2	9.023241E-8
ameijeiras	1	4.5116206E-8
amelia	25	1.1279052E-6
amelica	1	4.5116206E-8
amelie	41	1.8497644E-6
amelio	9	4.0604587E-7
ameliorate	19	8.572079E-7
ameliorated	12	5.4139446E-7
ameliorates	1	4.5116206E-8
ameliorating	9	4.0604587E-7
amelioration	12	5.4139446E-7
ameliorative	3	1.3534861E-7
amelistris	1	4.5116206E-8
amemiya	1	4.5116206E-8
amen	61	2.7520887E-6
amenable	41	1.8497644E-6
amend	47	2.1204617E-6
amendable	4	1.8046482E-7
amended	147	6.632082E-6
amendedreconstruction	1	4.5116206E-8
amendement	1	4.5116206E-8
amending	26	1.1730214E-6
amendment	707	3.1897158E-5
amendment-friendly	1	4.5116206E-8
amendment-given	1	4.5116206E-8
amendments	252	1.1369284E-5
amends	82	3.6995289E-6
amenemhet	1	4.5116206E-8
amenhotep	3	1.3534861E-7
amenities	71	3.2032506E-6
amenity	2	9.023241E-8
ameno	1	4.5116206E-8
amenophis	10	4.5116207E-7
amenorrhea	3	1.3534861E-7
amensiac	1	4.5116206E-8
amentia	1	4.5116206E-8
amer	5	2.2558103E-7
ameranda	1	4.5116206E-8
amerco	4	1.8046482E-7
amereican	1	4.5116206E-8
ameri	5	2.2558103E-7
america	4513	2.0360944E-4
america-bound	1	4.5116206E-8
america-first	1	4.5116206E-8
america-firsters	1	4.5116206E-8
america-hating	2	9.023241E-8
america-mura	1	4.5116206E-8
americaat	1	4.5116206E-8
americain	1	4.5116206E-8
americaland	1	4.5116206E-8
americaleave	1	4.5116206E-8
americamysis	1	4.5116206E-8
american	10314	4.6532854E-4
american-airlines	3	1.3534861E-7
american-approved	1	4.5116206E-8
american-backed	3	1.3534861E-7
american-based	3	1.3534861E-7
american-born	16	7.218593E-7
american-bred	2	9.023241E-8
american-culture	1	4.5116206E-8
american-dream	1	4.5116206E-8
american-educated	2	9.023241E-8
american-financed	2	9.023241E-8
american-flag-burning	1	4.5116206E-8
american-funded	1	4.5116206E-8
american-government	1	4.5116206E-8
american-hating	1	4.5116206E-8
american-league	1	4.5116206E-8
american-led	15	6.767431E-7
american-made	9	4.0604587E-7
american-ness	2	9.023241E-8
american-piloted	1	4.5116206E-8
american-produced	1	4.5116206E-8
american-sponsored	3	1.3534861E-7
american-style	24	1.0827889E-6
american-trained	1	4.5116206E-8
american-y	1	4.5116206E-8
americana	38	1.7144158E-6
americana-auction	1	4.5116206E-8
americaners	1	4.5116206E-8
americanese	1	4.5116206E-8
americaness	1	4.5116206E-8
americanettes	1	4.5116206E-8
americanew	1	4.5116206E-8
americangreetings	2	9.023241E-8
americanhistory	2	9.023241E-8
americanians	1	4.5116206E-8
americanisation	1	4.5116206E-8
americanism	30	1.3534863E-6
americanismos	1	4.5116206E-8
americanisms	13	5.865107E-7
americanizado	2	9.023241E-8
americanizados	1	4.5116206E-8
americanization	9	4.0604587E-7
americanized	16	7.218593E-7
americanizing	1	4.5116206E-8
americanlawyer	1	4.5116206E-8
americanleather	1	4.5116206E-8
americanlegacy	1	4.5116206E-8
americann	1	4.5116206E-8
americanness	3	1.3534861E-7
americano	2	9.023241E-8
americanos	1	4.5116206E-8
americanpolitics	1	4.5116206E-8
americans	3041	1.3719838E-4
americans-win	1	4.5116206E-8
americantrust	1	4.5116206E-8
americanum	4	1.8046482E-7
americanus	4	1.8046482E-7
americard	1	4.5116206E-8
americas	93	4.1958074E-6
americasarmy	1	4.5116206E-8
americastestkitchen	1	4.5116206E-8
americasunknownchild	1	4.5116206E-8
americentric	1	4.5116206E-8
americium	3	1.3534861E-7
americo	3	1.3534861E-7
americorps	15	6.767431E-7
americus	2	9.023241E-8
amerie	1	4.5116206E-8
amerigo	12	5.4139446E-7
amerika	1	4.5116206E-8
amerikani	1	4.5116206E-8
amerikanits	1	4.5116206E-8
amerikanka	1	4.5116206E-8
amerikans	1	4.5116206E-8
amerikanskij	1	4.5116206E-8
amerikanskije	1	4.5116206E-8
amerikantsi	1	4.5116206E-8
ameriker	1	4.5116206E-8
amerindia	1	4.5116206E-8
amerindian	17	7.669755E-7
amerindians	9	4.0604587E-7
amerinidian	1	4.5116206E-8
amerishima	1	4.5116206E-8
ameritech	10	4.5116207E-7
ameritrade	1	4.5116206E-8
amerlex	1	4.5116206E-8
amerrikeh	1	4.5116206E-8
amersfoort	1	4.5116206E-8
amersham	181	8.166034E-6
amerta	1	4.5116206E-8
amery	1	4.5116206E-8
amer­i­cans	1	4.5116206E-8
ames	72	3.248367E-6
ameslan	1	4.5116206E-8
amethodology	1	4.5116206E-8
amethyst	3	1.3534861E-7
amethysts	1	4.5116206E-8
ameti	1	4.5116206E-8
amevive	2	9.023241E-8
amex	8	3.6092965E-7
amf	3	1.3534861E-7
amfar	2	9.023241E-8
amfi	1	4.5116206E-8
amg	28	1.2632538E-6
amgen	38	1.7144158E-6
amguard	1	4.5116206E-8
amgydala	1	4.5116206E-8
amh	1	4.5116206E-8
amharic	1	4.5116206E-8
amherst	32	1.4437186E-6
amherst-based	2	9.023241E-8
ami	21	9.4744036E-7
amia	4	1.8046482E-7
amiability	2	9.023241E-8
amiable	39	1.7595321E-6
amiably	9	4.0604587E-7
amibiguous	1	4.5116206E-8
amicable	11	4.962783E-7
amicably	11	4.962783E-7
amice	1	4.5116206E-8
amichai	1	4.5116206E-8
amico	7	3.1581345E-7
amicon	12	5.4139446E-7
amics	1	4.5116206E-8
amicus	5	2.2558103E-7
amid	352	1.5880905E-5
amida	7	3.1581345E-7
amidala	7	3.1581345E-7
amidase	7	3.1581345E-7
amidated	1	4.5116206E-8
amide	13	5.865107E-7
amides	1	4.5116206E-8
amido	2	9.023241E-8
amidolytic	2	9.023241E-8
amidophosphoribosyi	1	4.5116206E-8
amidships	1	4.5116206E-8
amidst	32	1.4437186E-6
amiee	1	4.5116206E-8
amiel	4	1.8046482E-7
amiens	12	5.4139446E-7
amieva	1	4.5116206E-8
amiga	67	3.022786E-6
amigas	1	4.5116206E-8
amigo	10	4.5116207E-7
amigos	3	1.3534861E-7
amiguito	1	4.5116206E-8
amiiformes	1	4.5116206E-8
amikacin	3	1.3534861E-7
amiller	1	4.5116206E-8
amiloride	3	1.3534861E-7
amiloride-sensitive	1	4.5116206E-8
amin	18	8.1209174E-7
amina	121	5.459061E-6
aminafwd	1	4.5116206E-8
aminal	1	4.5116206E-8
aminated	8	3.6092965E-7
amination	1	4.5116206E-8
amine	5	2.2558103E-7
amine-coupling	1	4.5116206E-8
amine-modified	1	4.5116206E-8
amines	7	3.1581345E-7
aming	1	4.5116206E-8
amino	1455	6.564408E-5
amino-acid	275	1.2406957E-5
amino-acid-encoding	1	4.5116206E-8
amino-acid-long	1	4.5116206E-8
amino-acids	2	9.023241E-8
amino-adamantane	1	4.5116206E-8
amino-allyl	3	1.3534861E-7
amino-allyl-based	1	4.5116206E-8
amino-allyl-d	1	4.5116206E-8
amino-and	1	4.5116206E-8
amino-cyclopropane	1	4.5116206E-8
amino-cyclopropane-carboxylate	1	4.5116206E-8
amino-group	2	9.023241E-8
amino-labeled	1	4.5116206E-8
amino-modified	2	9.023241E-8
amino-oxidase	1	4.5116206E-8
amino-oxidase-type	2	9.023241E-8
amino-propargyl	1	4.5116206E-8
amino-terminal	117	5.2785963E-6
amino-terminus	11	4.962783E-7
amino-transferase	2	9.023241E-8
amino-transferases	1	4.5116206E-8
aminoacid	3	1.3534861E-7
aminoacids	2	9.023241E-8
aminoacyl	2	9.023241E-8
aminoacyl-adenylate	2	9.023241E-8
aminoacyl-t	12	5.4139446E-7
aminoacyle	2	9.023241E-8
aminoadenine	1	4.5116206E-8
aminoadenosine	3	1.3534861E-7
aminoallyl	4	1.8046482E-7
aminoallyl-d	7	3.1581345E-7
aminoallyl-modified	1	4.5116206E-8
aminoarabinose	3	1.3534861E-7
aminobenzoic	3	1.3534861E-7
aminocyclopropane	2	9.023241E-8
aminoethyl	2	9.023241E-8
aminoglutethimide	2	9.023241E-8
aminoglycoside	2	9.023241E-8
aminoglycosides	1	4.5116206E-8
aminogylcosides	1	4.5116206E-8
aminolink	1	4.5116206E-8
aminomethane	2	9.023241E-8
aminomethyl	1	4.5116206E-8
aminomethylcoumarin	1	4.5116206E-8
aminopenicillins	1	4.5116206E-8
aminopeptidase	7	3.1581345E-7
aminophenoxy	1	4.5116206E-8
aminopropyltriethoxysilane-coated	1	4.5116206E-8
aminopyridine	4	1.8046482E-7
aminosalicylic	3	1.3534861E-7
aminosilane	2	9.023241E-8
aminoterminal	3	1.3534861E-7
aminoterminus	5	2.2558103E-7
aminotetraacetic	1	4.5116206E-8
aminotranferase	2	9.023241E-8
aminotransferase	36	1.6241835E-6
aminotransferases	14	6.316269E-7
aminov	8	3.6092965E-7
amintore	1	4.5116206E-8
amio	1	4.5116206E-8
amiodarone	2	9.023241E-8
amipens	1	4.5116206E-8
amipro	3	1.3534861E-7
amir	13	5.865107E-7
amiral	1	4.5116206E-8
amirs	1	4.5116206E-8
amis	60	2.7069725E-6
amish	46	2.0753455E-6
amison	1	4.5116206E-8
amiss	20	9.0232413E-7
amistad	37	1.6692996E-6
amit	2	9.023241E-8
amitai	1	4.5116206E-8
amitav	1	4.5116206E-8
amitavo	1	4.5116206E-8
amitochondrial	1	4.5116206E-8
amitochondriate	6	2.7069723E-7
amitotically	1	4.5116206E-8
amitriptyline	2	9.023241E-8
amittit	1	4.5116206E-8
amity	12	5.4139446E-7
amityville	8	3.6092965E-7
amizade	1	4.5116206E-8
amjad	1	4.5116206E-8
aml	43	1.939997E-6
amla	1	4.5116206E-8
amlapura	4	1.8046482E-7
amlaw	6	2.7069723E-7
amlodipine	1	4.5116206E-8
amma	1	4.5116206E-8
amman	25	1.1279052E-6
ammanati	1	4.5116206E-8
ammar	1	4.5116206E-8
ammeen	6	2.7069723E-7
ammend	2	9.023241E-8
ammer	2	9.023241E-8
ammi	1	4.5116206E-8
ammiano	6	2.7069723E-7
ammiel	1	4.5116206E-8
ammo	23	1.0376727E-6
ammo-acid	2	9.023241E-8
ammon	4	1.8046482E-7
ammonia	85	3.8348776E-6
ammonite	1	4.5116206E-8
ammonium	60	2.7069725E-6
ammons	1	4.5116206E-8
ammunition	81	3.6544127E-6
ammunitions	1	4.5116206E-8
amn	1	4.5116206E-8
amnesia	42	1.8948807E-6
amnesiac	5	2.2558103E-7
amnesic	3	1.3534861E-7
amnestic	1	4.5116206E-8
amnestics	1	4.5116206E-8
amnesty	57	2.5716238E-6
amnio	4	1.8046482E-7
amniocentesis	2	9.023241E-8
amnion	5	2.2558103E-7
amnioserosa	2	9.023241E-8
amniota	2	9.023241E-8
amniote	1	4.5116206E-8
amniotic	26	1.1730214E-6
amnon	2	9.023241E-8
amo	2	9.023241E-8
amoco	8	3.6092965E-7
amodiaquine	16	7.218593E-7
amodt	2	9.023241E-8
amoeba	23	1.0376727E-6
amoebae	2	9.023241E-8
amoebas	1	4.5116206E-8
amoebic	1	4.5116206E-8
amoeboid	2	9.023241E-8
amoh	10	4.5116207E-7
amok	34	1.533951E-6
amon	7	3.1581345E-7
among	7253	3.2722784E-4
among-population	1	4.5116206E-8
among-site	1	4.5116206E-8
among-strain	1	4.5116206E-8
amongpatients	1	4.5116206E-8
amongst	139	6.271153E-6
amongthe	1	4.5116206E-8
amongttic	1	4.5116206E-8
amonia	1	4.5116206E-8
amonte	34	1.533951E-6
amontillado	2	9.023241E-8
amontillados	2	9.023241E-8
amonts	1	4.5116206E-8
amor	8	3.6092965E-7
amoral	23	1.0376727E-6
amorality	3	1.3534861E-7
amorbid	1	4.5116206E-8
amore	10	4.5116207E-7
amoreeffective	1	4.5116206E-8
amoreira	1	4.5116206E-8
amoreiras	1	4.5116206E-8
amores	1	4.5116206E-8
amori	1	4.5116206E-8
amorim	123	5.5492933E-6
amorites	2	9.023241E-8
amormino	1	4.5116206E-8
amoros	22	9.925566E-7
amoroso	1	4.5116206E-8
amorosos	1	4.5116206E-8
amorous	16	7.218593E-7
amorousness	1	4.5116206E-8
amorphous	20	9.0232413E-7
amorthropized	1	4.5116206E-8
amortization	16	7.218593E-7
amortize	4	1.8046482E-7
amortized	8	3.6092965E-7
amortizing	2	9.023241E-8
amory	2	9.023241E-8
amos	34	1.533951E-6
amoudia	1	4.5116206E-8
amoun	1	4.5116206E-8
amoung	5	2.2558103E-7
amount	3139	1.4161978E-4
amounted	71	3.2032506E-6
amounting	18	8.1209174E-7
amountof	5	2.2558103E-7
amounts	988	4.4574812E-5
amour	17	7.669755E-7
amoureux	2	9.023241E-8
amours	2	9.023241E-8
amouse	1	4.5116206E-8
amout	1	4.5116206E-8
amoxicillin	7	3.1581345E-7
amoy	3	1.3534861E-7
amp	72	3.248367E-6
amp-binding	1	4.5116206E-8
amp-lysine	1	4.5116206E-8
amp-nh	1	4.5116206E-8
amp-response	1	4.5116206E-8
amp-stimulated	1	4.5116206E-8
ampa	26	1.1730214E-6
ampa-gated	1	4.5116206E-8
ampa-receptor	1	4.5116206E-8
ampa-receptors	1	4.5116206E-8
ampang	3	1.3534861E-7
ampata	3	1.3534861E-7
ampcp	11	4.962783E-7
amped	6	2.7069723E-7
amped-up	2	9.023241E-8
ampenan	5	2.2558103E-7
amperage	5	2.2558103E-7
amperages	1	4.5116206E-8
amperase	4	1.8046482E-7
ampere	1	4.5116206E-8
amperometric	3	1.3534861E-7
ampersand	6	2.7069723E-7
ampezzo	3	1.3534861E-7
amphetamine	5	2.2558103E-7
amphetamine-addled	1	4.5116206E-8
amphetamine-crazed	1	4.5116206E-8
amphetamine-jag	1	4.5116206E-8
amphetamine-like	1	4.5116206E-8
amphetamine-soaked	3	1.3534861E-7
amphetamines	18	8.1209174E-7
amphibia	1	4.5116206E-8
amphibian	10	4.5116207E-7
amphibians	14	6.316269E-7
amphibious	6	2.7069723E-7
amphicoma	1	4.5116206E-8
amphigory	1	4.5116206E-8
amphioxus	1	4.5116206E-8
amphipathic	9	4.0604587E-7
amphiphilic	3	1.3534861E-7
amphiphilicity	1	4.5116206E-8
amphiregulin	2	9.023241E-8
amphisa	1	4.5116206E-8
amphitheater	31	1.3986024E-6
amphitheater-shaped	1	4.5116206E-8
amphitheaters	2	9.023241E-8
amphitheatre	10	4.5116207E-7
amphitheatre-type	1	4.5116206E-8
amphitheatres	1	4.5116206E-8
amphitrite	2	9.023241E-8
amphi­theater	2	9.023241E-8
amphi­theaters	1	4.5116206E-8
ampholines	2	9.023241E-8
ampholytes	1	4.5116206E-8
amphony	2	9.023241E-8
amphora	1	4.5116206E-8
amphoras	2	9.023241E-8
amphotericin	14	6.316269E-7
amphotropic	9	4.0604587E-7
ampici	1	4.5116206E-8
ampicill	2	9.023241E-8
ampicillin	50	2.2558104E-6
ampicillin-resistant	1	4.5116206E-8
ampification	1	4.5116206E-8
amping	1	4.5116206E-8
ampirevay	1	4.5116206E-8
ampitheater	1	4.5116206E-8
ampitheatre	1	4.5116206E-8
ampk	1	4.5116206E-8
ample	121	5.459061E-6
ampleness	1	4.5116206E-8
amplex	2	9.023241E-8
ampli	2	9.023241E-8
amplicon	58	2.61674E-6
amplicon-derived	1	4.5116206E-8
amplicons	44	1.9851132E-6
amplicor	1	4.5116206E-8
amplifed	1	4.5116206E-8
amplifiable	1	4.5116206E-8
amplification	733	3.307018E-5
amplification-based	1	4.5116206E-8
amplifications	55	2.4813914E-6
amplificaton	1	4.5116206E-8
amplified	552	2.4904146E-5
amplifier	26	1.1730214E-6
amplifiers	4	1.8046482E-7
amplifies	17	7.669755E-7
ampliflour	1	4.5116206E-8
amplifluor	13	5.865107E-7
amplifluors	3	1.3534861E-7
amplify	126	5.684642E-6
amplifying	30	1.3534863E-6
ampligase	16	7.218593E-7
amplimer	1	4.5116206E-8
amplimers	4	1.8046482E-7
ampliscribe	5	2.2558103E-7
amplitaq	25	1.1279052E-6
amplitron	1	4.5116206E-8
amplitude	163	7.353942E-6
amplitudes	54	2.436275E-6
amply	34	1.533951E-6
ampod	1	4.5116206E-8
ampollas	1	4.5116206E-8
ampoule	1	4.5116206E-8
amppnp	4	1.8046482E-7
amprenavir	1	4.5116206E-8
amps	6	2.7069723E-7
ampul	2	9.023241E-8
ampules	1	4.5116206E-8
ampus	1	4.5116206E-8
amputate	2	9.023241E-8
amputated	27	1.2181375E-6
amputates	1	4.5116206E-8
amputating	2	9.023241E-8
amputation	27	1.2181375E-6
amputations	10	4.5116207E-7
amputee	3	1.3534861E-7
amputees	5	2.2558103E-7
amr	11	4.962783E-7
amr-earnings	2	9.023241E-8
amra	1	4.5116206E-8
amrad	1	4.5116206E-8
amrak	1	4.5116206E-8
amrant	4	1.8046482E-7
amref	1	4.5116206E-8
amrein	3	1.3534861E-7
amresco	1	4.5116206E-8
amri	1	4.5116206E-8
amrich	3	1.3534861E-7
amritraj	3	1.3534861E-7
amritrajes	2	9.023241E-8
amritsar	6	2.7069723E-7
amro	3	1.3534861E-7
amrs	8	3.6092965E-7
ams	56	2.5265076E-6
amsa	3	1.3534861E-7
amsacta	2	9.023241E-8
amsel	1	4.5116206E-8
amsequestered	1	4.5116206E-8
amsol	2	9.023241E-8
amstel	13	5.865107E-7
amstelredamme	7	3.1581345E-7
amsterdam	215	9.699985E-6
amsterdam-based	2	9.023241E-8
amsterdam-born	1	4.5116206E-8
amsterdammers	23	1.0376727E-6
amsterdamse	2	9.023241E-8
amstrelkring	1	4.5116206E-8
amsuvarna	1	4.5116206E-8
amt	2	9.023241E-8
amtave	2	9.023241E-8
amthology	1	4.5116206E-8
amtion	2	9.023241E-8
amtrack	1	4.5116206E-8
amtrak	122	5.5041774E-6
amtrak-derail	5	2.2558103E-7
amuck	1	4.5116206E-8
amud	1	4.5116206E-8
amuk	1	4.5116206E-8
amulet	13	5.865107E-7
amulets	5	2.2558103E-7
amun	9	4.0604587E-7
amundadottir	1	4.5116206E-8
amundsen	3	1.3534861E-7
amunophis	1	4.5116206E-8
amurricans	1	4.5116206E-8
amuse	49	2.2106942E-6
amuse-bouches	1	4.5116206E-8
amused	149	6.722315E-6
amusedsydney	1	4.5116206E-8
amusement	126	5.684642E-6
amusement-park	4	1.8046482E-7
amusements	13	5.865107E-7
amuses	17	7.669755E-7
amusez-vous	1	4.5116206E-8
amusing	299	1.34897455E-5
amusingly	28	1.2632538E-6
amusingness	1	4.5116206E-8
amusment	1	4.5116206E-8
amutant	1	4.5116206E-8
amv	18	8.1209174E-7
amv-reverse	1	4.5116206E-8
amv-rt	1	4.5116206E-8
amw	1	4.5116206E-8
amway	15	6.767431E-7
amway-style	1	4.5116206E-8
amwest	1	4.5116206E-8
amy	355	1.6016253E-5
amy-the-evil-boxing-coach	1	4.5116206E-8
amych	179	8.075801E-6
amych-style	5	2.2558103E-7
amych-ubercrunch	1	4.5116206E-8
amycolatopsis	1	4.5116206E-8
amyest	1	4.5116206E-8
amyeth	1	4.5116206E-8
amygdala	30	1.3534863E-6
amygdala-decreased	1	4.5116206E-8
amygdala-specific	2	9.023241E-8
amyl	1	4.5116206E-8
amyland	1	4.5116206E-8
amylase	1	4.5116206E-8
amylases	1	4.5116206E-8
amyliz	1	4.5116206E-8
amyloid	15	6.767431E-7
amyloid-?	1	4.5116206E-8
amyloid-beta	1	4.5116206E-8
amyloid-ß	1	4.5116206E-8
amyloidogenic	2	9.023241E-8
amyloidosis	5	2.2558103E-7
amyloiodgenic	1	4.5116206E-8
amyloliqufaciens	1	4.5116206E-8
amylose-free	4	1.8046482E-7
amylovora	2	9.023241E-8
amyotrophic	4	1.8046482E-7
amyp	15	6.767431E-7
amyparker	16	7.218593E-7
amyparker-wards	1	4.5116206E-8
amyre	1	4.5116206E-8
amys	2	9.023241E-8
amyt	1	4.5116206E-8
amyth	30	1.3534863E-6
amythests	1	4.5116206E-8
amytus	1	4.5116206E-8
amyvi	1	4.5116206E-8
am­ong	1	4.5116206E-8
amália	1	4.5116206E-8
amári	4	1.8046482E-7
amélia	4	1.8046482E-7
amélie	1	4.5116206E-8
américa	2	9.023241E-8
américas	14	6.316269E-7
américo	11	4.962783E-7
amérique	1	4.5116206E-8
amœba	1	4.5116206E-8
am–	127	5.7297584E-6
am–midnight	2	9.023241E-8
am–noon	1	4.5116206E-8
am–sunset	1	4.5116206E-8
an	74086	0.0033424792
an-end-of-myth	1	4.5116206E-8
an-gel-us	4	1.8046482E-7
an-hour	7	3.1581345E-7
an-hour-plus	1	4.5116206E-8
an-nhar	3	1.3534861E-7
an-swer	2	9.023241E-8
ana	57	2.5716238E-6
ana-n	1	4.5116206E-8
anabaena	63	2.842321E-6
anabaptists	1	4.5116206E-8
anable	1	4.5116206E-8
anabolic	20	9.0232413E-7
anabolis	1	4.5116206E-8
anabranch	2	9.023241E-8
anacapa	1	4.5116206E-8
anacapri	2	9.023241E-8
anachro	1	4.5116206E-8
anachronism	23	1.0376727E-6
anachronisms	10	4.5116207E-7
anachronistic	30	1.3534863E-6
anachronistically	5	2.2558103E-7
anacin	1	4.5116206E-8
anacoluthic	1	4.5116206E-8
anaconda	9	4.0604587E-7
anacor	1	4.5116206E-8
anacostia	5	2.2558103E-7
anacreon	1	4.5116206E-8
anad	2	9.023241E-8
anadama	1	4.5116206E-8
anadia	2	9.023241E-8
anadolu	3	1.3534861E-7
anadromous	1	4.5116206E-8
anaemia	6	2.7069723E-7
anaerobes	2	9.023241E-8
anaerobic	48	2.1655778E-6
anaerobically	7	3.1581345E-7
anaerobiosis	1	4.5116206E-8
anaesthesia	15	6.767431E-7
anaesthesiological	2	9.023241E-8
anaesthesiologist	1	4.5116206E-8
anaesthesiologists	1	4.5116206E-8
anaesthetic	9	4.0604587E-7
anaesthetised	4	1.8046482E-7
anaesthetises	1	4.5116206E-8
anaesthetist	1	4.5116206E-8
anaesthetists	1	4.5116206E-8
anaesthetized	8	3.6092965E-7
anaffected	2	9.023241E-8
anafi	1	4.5116206E-8
anafiotika	3	1.3534861E-7
anaglyph	3	1.3534861E-7
anaglyph-encoded	2	9.023241E-8
anagoddess	2	9.023241E-8
anagram	25	1.1279052E-6
anagramgenius	1	4.5116206E-8
anagrammatical	1	4.5116206E-8
anagrams	15	6.767431E-7
anahad	1	4.5116206E-8
anaheim	118	5.3237122E-6
anais	3	1.3534861E-7
anaka	1	4.5116206E-8
anake	1	4.5116206E-8
anakin	21	9.4744036E-7
anakinra	2	9.023241E-8
anal	41	1.8497644E-6
anal-retentive	6	2.7069723E-7
anal-retentiveness	3	1.3534861E-7
analagous	2	9.023241E-8
analaysis	1	4.5116206E-8
analco	2	9.023241E-8
analects	1	4.5116206E-8
analgesia	29	1.30837E-6
analgesic	60	2.7069725E-6
analgesics	53	2.391159E-6
analisa	1	4.5116206E-8
anality	1	4.5116206E-8
analize	1	4.5116206E-8
anally	1	4.5116206E-8
analog	193	8.707428E-6
analogical	1	4.5116206E-8
analogies	53	2.391159E-6
analogists	2	9.023241E-8
analogizes	1	4.5116206E-8
analogous	185	8.346498E-6
analogously	9	4.0604587E-7
analogs	88	3.9702263E-6
analogue	45	2.0302293E-6
analogues	18	8.1209174E-7
analogx	3	1.3534861E-7
analogy	243	1.0963238E-5
analsysis	1	4.5116206E-8
analysand	3	1.3534861E-7
analyse	18	8.1209174E-7
analyse-it	1	4.5116206E-8
analysed	72	3.248367E-6
analyser	7	3.1581345E-7
analyses	1589	7.1689654E-5
analyses-client	1	4.5116206E-8
analysing	7	3.1581345E-7
analysis	8458	3.8159286E-4
analysis-derived	1	4.5116206E-8
analysis-heavy	1	4.5116206E-8
analysis-relevant	1	4.5116206E-8
analysis-that	1	4.5116206E-8
analysis-to	1	4.5116206E-8
analysisdemonstrated	1	4.5116206E-8
analysisprovides	1	4.5116206E-8
analysisstudiesa	1	4.5116206E-8
analyst	520	2.3460427E-5
analyst-related	1	4.5116206E-8
analysts	946	4.267993E-5
analyte	16	7.218593E-7
analytes	17	7.669755E-7
analytic	197	8.887892E-6
analytica	4	1.8046482E-7
analytical	224	1.01060305E-5
analytically	15	6.767431E-7
analytics	2	9.023241E-8
analyzable	5	2.2558103E-7
analyze	431	1.9445086E-5
analyzed	1455	6.564408E-5
analyzer	45	2.0302293E-6
analyzers	3	1.3534861E-7
analyzes	58	2.61674E-6
analyzing	265	1.1955794E-5
anamnesis	1	4.5116206E-8
anamniote	1	4.5116206E-8
anamorphic	1	4.5116206E-8
anamount	1	4.5116206E-8
anan	3	1.3534861E-7
ananas	2	9.023241E-8
ananase	2	9.023241E-8
anand	6	2.7069723E-7
ananda	18	8.1209174E-7
anandalakshmi	1	4.5116206E-8
anania	1	4.5116206E-8
ananias	2	9.023241E-8
ananim	3	1.3534861E-7
ananimous	1	4.5116206E-8
ananka	1	4.5116206E-8
ananna	1	4.5116206E-8
ananova	1	4.5116206E-8
ananse	1	4.5116206E-8
ananson	1	4.5116206E-8
ananta	1	4.5116206E-8
anao	3	1.3534861E-7
anapana	2	9.023241E-8
anapanna	1	4.5116206E-8
anaparticular	1	4.5116206E-8
anaphase	71	3.2032506E-6
anaphase-inhibitor	1	4.5116206E-8
anaphase-promoting	3	1.3534861E-7
anaphora	1	4.5116206E-8
anaphylactic	36	1.6241835E-6
anaphylactoid	3	1.3534861E-7
anaphylatoxin	3	1.3534861E-7
anaphylaxis	33	1.4888349E-6
anaplastic	1	4.5116206E-8
anaplastologist	1	4.5116206E-8
anaplerotic	15	6.767431E-7
anapplication	2	9.023241E-8
anaptychia	1	4.5116206E-8
anarachy	1	4.5116206E-8
anarchic	18	8.1209174E-7
anarchically	1	4.5116206E-8
anarchism	5	2.2558103E-7
anarchist	25	1.1279052E-6
anarchista	1	4.5116206E-8
anarchistic	2	9.023241E-8
anarchists	20	9.0232413E-7
anarcho	1	4.5116206E-8
anarchy	48	2.1655778E-6
anas	1	4.5116206E-8
anasazi	5	2.2558103E-7
anaspec	1	4.5116206E-8
anastacio	1	4.5116206E-8
anastamosis	2	9.023241E-8
anastasia	10	4.5116207E-7
anastasio	1	4.5116206E-8
anastasios	1	4.5116206E-8
anastasis	1	4.5116206E-8
anastellin	1	4.5116206E-8
anastomising	1	4.5116206E-8
anat	1	4.5116206E-8
anathema	49	2.2106942E-6
anathemas	1	4.5116206E-8
anathematize	1	4.5116206E-8
anathematized	2	9.023241E-8
anathematizing	1	4.5116206E-8
anatinas	3	1.3534861E-7
anatinus	1	4.5116206E-8
anatole	3	1.3534861E-7
anatolia	26	1.1730214E-6
anatolian	4	1.8046482E-7
anatoly	10	4.5116207E-7
anatomic	19	8.572079E-7
anatomic-therapeutic-chemical	1	4.5116206E-8
anatomica	1	4.5116206E-8
anatomical	66	2.9776697E-6
anatomically	21	9.4744036E-7
anatomically-based	1	4.5116206E-8
anatomies	1	4.5116206E-8
anatomist	1	4.5116206E-8
anatomists	1	4.5116206E-8
anatomized	1	4.5116206E-8
anatomizes	1	4.5116206E-8
anatomy	97	4.376272E-6
anatomy-based	1	4.5116206E-8
anatrace	1	4.5116206E-8
anatrepsis	4	1.8046482E-7
anatural	1	4.5116206E-8
anavatos	2	9.023241E-8
anavim	1	4.5116206E-8
anaxagoras	2	9.023241E-8
anay	1	4.5116206E-8
anaya	8	3.6092965E-7
anaylses	1	4.5116206E-8
anaïs	2	9.023241E-8
anba	3	1.3534861E-7
anc	55	2.4813914E-6
anc-led	1	4.5116206E-8
anca	1	4.5116206E-8
ance	1	4.5116206E-8
ancel	5	2.2558103E-7
ancell	1	4.5116206E-8
ancestor	193	8.707428E-6
ancestor-worshipping	1	4.5116206E-8
ancestors	164	7.3990577E-6
ancestory	1	4.5116206E-8
ancestral	174	7.85022E-6
ancestrally	1	4.5116206E-8
ancestress	1	4.5116206E-8
ancestries	2	9.023241E-8
ancestry	82	3.6995289E-6
ancho	3	1.3534861E-7
ancho-chile	1	4.5116206E-8
anchoasanchoviesmariscosshellfish	1	4.5116206E-8
anchor	178	8.0306845E-6
anchor-blondes	1	4.5116206E-8
anchorage	42	1.8948807E-6
anchorage-dependent	12	5.4139446E-7
anchorage-independent	10	4.5116207E-7
anchorage-independently	1	4.5116206E-8
anchorages	5	2.2558103E-7
anchored	97	4.376272E-6
anchoring	43	1.939997E-6
anchorman	8	3.6092965E-7
anchormen	3	1.3534861E-7
anchors	43	1.939997E-6
anchorwoman	1	4.5116206E-8
anchorwomen	1	4.5116206E-8
anchoveta	3	1.3534861E-7
anchovies	12	5.4139446E-7
anchoviesmerluzahake	1	4.5116206E-8
anchoviespez	1	4.5116206E-8
anchovy	3	1.3534861E-7
ancien	14	6.316269E-7
ancienne	1	4.5116206E-8
ancient	1230	5.5492936E-5
ancient-looking	1	4.5116206E-8
ancient-sounding	1	4.5116206E-8
ancient-world	1	4.5116206E-8
ancientness	1	4.5116206E-8
ancients	15	6.767431E-7
ancillae	1	4.5116206E-8
ancillary	37	1.6692996E-6
ancillus	1	4.5116206E-8
ancle	1	4.5116206E-8
ancona	1	4.5116206E-8
ancora	1	4.5116206E-8
ancova	10	4.5116207E-7
ancre	1	4.5116206E-8
ancylostoma	3	1.3534861E-7
ancón	4	1.8046482E-7
and	597941	0.02697683
and-a	1	4.5116206E-8
and-a-half	2	9.023241E-8
and-a-half-foot-long	1	4.5116206E-8
and-a-half-minute	1	4.5116206E-8
and-a-half-month-old	1	4.5116206E-8
and-and	1	4.5116206E-8
and-depending	1	4.5116206E-8
and-disagrees-with	1	4.5116206E-8
and-don	1	4.5116206E-8
and-filer	1	4.5116206E-8
and-in	2	9.023241E-8
and-more	1	4.5116206E-8
and-more-warts	1	4.5116206E-8
and-museum	1	4.5116206E-8
and-odd	1	4.5116206E-8
and-older	1	4.5116206E-8
and-over	1	4.5116206E-8
and-perhaps	1	4.5116206E-8
and-relationships	1	4.5116206E-8
and-this	1	4.5116206E-8
and-under	2	9.023241E-8
and-will-protect-us-so-everyone-keep-quiet	1	4.5116206E-8
anda	9	4.0604587E-7
andaccurately	1	4.5116206E-8
andale	3	1.3534861E-7
andaleeb	1	4.5116206E-8
andalex	1	4.5116206E-8
andalou	2	9.023241E-8
andaluca	1	4.5116206E-8
andalucia	3	1.3534861E-7
andalucian	2	9.023241E-8
andalucía	22	9.925566E-7
andalucían	6	2.7069723E-7
andalus	2	9.023241E-8
andalusia	6	2.7069723E-7
andalusian	9	4.0604587E-7
andalusian-born	1	4.5116206E-8
andalusians	1	4.5116206E-8
andaluz	2	9.023241E-8
andaluza	1	4.5116206E-8
andandrew	1	4.5116206E-8
andante	1	4.5116206E-8
andanthropogenic	1	4.5116206E-8
andantino	1	4.5116206E-8
andantioxidant	1	4.5116206E-8
andapplied	1	4.5116206E-8
andar	2	9.023241E-8
andatsdiditbettermystorystickingtoit	1	4.5116206E-8
andaudit	1	4.5116206E-8
andawarding	1	4.5116206E-8
andawn	2	9.023241E-8
andbetter	1	4.5116206E-8
andbibliographicreferences	1	4.5116206E-8
andblood	1	4.5116206E-8
andbuying	1	4.5116206E-8
andby	1	4.5116206E-8
andcertification	1	4.5116206E-8
andclosure	1	4.5116206E-8
andcompetitive	1	4.5116206E-8
andcompliance	1	4.5116206E-8
andcontrol	1	4.5116206E-8
andcoordination	1	4.5116206E-8
anddcm	1	4.5116206E-8
anddetermine	1	4.5116206E-8
anddeveloping	1	4.5116206E-8
ande	2	9.023241E-8
andeach	1	4.5116206E-8
andean	12	5.4139446E-7
andele	2	9.023241E-8
andelin	1	4.5116206E-8
andenbuch	1	4.5116206E-8
andenilso	2	9.023241E-8
ander	6	2.7069723E-7
anderman	3	1.3534861E-7
anders	12	5.4139446E-7
andersen	142	6.406501E-6
anderson	488	2.201671E-5
andersonville	1	4.5116206E-8
andersson	7	3.1581345E-7
andes	10	4.5116207E-7
andews	1	4.5116206E-8
andexplicitly	1	4.5116206E-8
andfederal	1	4.5116206E-8
andfour	1	4.5116206E-8
andhari	3	1.3534861E-7
andhow	1	4.5116206E-8
andhra	5	2.2558103E-7
andi	5	2.2558103E-7
andie	8	3.6092965E-7
andimax	1	4.5116206E-8
andimplementation	1	4.5116206E-8
andits	1	4.5116206E-8
andmaking	1	4.5116206E-8
andmaybeformyothersite	1	4.5116206E-8
andmercury	1	4.5116206E-8
andmodeling	1	4.5116206E-8
andnewsweek	1	4.5116206E-8
andno	1	4.5116206E-8
andnyha	1	4.5116206E-8
ando	1	4.5116206E-8
andoccurrence	1	4.5116206E-8
andopen	1	4.5116206E-8
andopportunity	1	4.5116206E-8
andor	2	9.023241E-8
andorra	1	4.5116206E-8
andother	1	4.5116206E-8
andouille	1	4.5116206E-8
andover	36	1.6241835E-6
andperforms	1	4.5116206E-8
andpsychologic	1	4.5116206E-8
andquotations	1	4.5116206E-8
andr	2	9.023241E-8
andra	2	9.023241E-8
andrade	3	1.3534861E-7
andratx	4	1.8046482E-7
andre	101	4.5567367E-6
andrea	75	3.3837155E-6
andreas	31	1.3986024E-6
andrecreation	2	9.023241E-8
andreduce	1	4.5116206E-8
andreduction	1	4.5116206E-8
andree	1	4.5116206E-8
andreesen	1	4.5116206E-8
andreessen	7	3.1581345E-7
andrei	12	5.4139446E-7
andreiko	1	4.5116206E-8
andrejs	1	4.5116206E-8
andreotti	4	1.8046482E-7
andreports	1	4.5116206E-8
andrequired	1	4.5116206E-8
andres	18	8.1209174E-7
andresino	1	4.5116206E-8
andresolved	1	4.5116206E-8
andresources	1	4.5116206E-8
andress	3	1.3534861E-7
andretti	4	1.8046482E-7
andreu	1	4.5116206E-8
andrew	1210	5.459061E-5
andrew-centric	1	4.5116206E-8
andrew-hesitant	1	4.5116206E-8
andrew-the-follower	1	4.5116206E-8
andrew-the-yes-man	1	4.5116206E-8
andrewartha	1	4.5116206E-8
andrewcentric	1	4.5116206E-8
andrewgirl	1	4.5116206E-8
andrewpiece	1	4.5116206E-8
andrews	82	3.6995289E-6
andrews-in	1	4.5116206E-8
andriacco	2	9.023241E-8
andrian	1	4.5116206E-8
andriesen	5	2.2558103E-7
andriessen	1	4.5116206E-8
andrieux	1	4.5116206E-8
andro	1	4.5116206E-8
androcentrism	1	4.5116206E-8
androcles	1	4.5116206E-8
androgen	178	8.0306845E-6
androgen-dependent	2	9.023241E-8
androgen-depleted	2	9.023241E-8
androgen-deprived	4	1.8046482E-7
androgen-driven	1	4.5116206E-8
androgen-free	1	4.5116206E-8
androgen-independent	5	2.2558103E-7
androgen-induced	8	3.6092965E-7
androgen-like	1	4.5116206E-8
androgen-mediated	12	5.4139446E-7
androgen-regulated	2	9.023241E-8
androgen-related	1	4.5116206E-8
androgen-replete	1	4.5116206E-8
androgen-responsive	14	6.316269E-7
androgen-sensitive	1	4.5116206E-8
androgen-treated	4	1.8046482E-7
androgenic	3	1.3534861E-7
androgens	38	1.7144158E-6
androgyne	1	4.5116206E-8
androgynous	4	1.8046482E-7
androgynously	3	1.3534861E-7
androgyny	9	4.0604587E-7
android	9	4.0604587E-7
androids	6	2.7069723E-7
andrology	2	9.023241E-8
andromeda	23	1.0376727E-6
andronico	3	1.3534861E-7
andronicus	3	1.3534861E-7
andronikos	1	4.5116206E-8
andropov	1	4.5116206E-8
andros	34	1.533951E-6
androscoggin	1	4.5116206E-8
androsia	2	9.023241E-8
androstane	1	4.5116206E-8
androstanol	15	6.767431E-7
androstenedione	13	5.865107E-7
androstenol	1	4.5116206E-8
androv	2	9.023241E-8
andru	1	4.5116206E-8
andruw	6	2.7069723E-7
andruzzi	3	1.3534861E-7
andrzej	2	9.023241E-8
andrás	3	1.3534861E-7
andrássy	9	4.0604587E-7
andré	25	1.1279052E-6
andréas	1	4.5116206E-8
andrés	7	3.1581345E-7
ands	9	4.0604587E-7
andsection	2	9.023241E-8
andsecurethe	1	4.5116206E-8
andseveralimpressivestatuesoframses	1	4.5116206E-8
andshe	1	4.5116206E-8
andsnes	10	4.5116207E-7
andsomely	1	4.5116206E-8
andstreetlife	1	4.5116206E-8
andsubpart	1	4.5116206E-8
andsymptoms	1	4.5116206E-8
andtaliban	3	1.3534861E-7
andtechniques	1	4.5116206E-8
andtenet	3	1.3534861E-7
andthat	1	4.5116206E-8
andthe	5	2.2558103E-7
andthemicrowavedrierisdead	1	4.5116206E-8
andthis	1	4.5116206E-8
andtizegha	1	4.5116206E-8
andto	1	4.5116206E-8
andttic	1	4.5116206E-8
anduille	1	4.5116206E-8
andulacia	1	4.5116206E-8
andverification	1	4.5116206E-8
andy	337	1.5204162E-5
andya	29	1.30837E-6
andycam	1	4.5116206E-8
andydworkin	1	4.5116206E-8
andyf	1	4.5116206E-8
andym	2	9.023241E-8
andyou	1	4.5116206E-8
andys	1	4.5116206E-8
andºprovid	1	4.5116206E-8
andónis	1	4.5116206E-8
andújar	1	4.5116206E-8
ane	2	9.023241E-8
anealling	1	4.5116206E-8
aneb	1	4.5116206E-8
anecdotal	84	3.7897614E-6
anecdotally	14	6.316269E-7
anecdote	71	3.2032506E-6
anecdote-examples	1	4.5116206E-8
anecdote-rich	1	4.5116206E-8
anecdotes	91	4.1055746E-6
anechoic	1	4.5116206E-8
anee	1	4.5116206E-8
anejo	1	4.5116206E-8
anelection	1	4.5116206E-8
anelectric	2	9.023241E-8
anella	1	4.5116206E-8
anemia	79	3.5641804E-6
anemia-drug	1	4.5116206E-8
anemia-related	1	4.5116206E-8
anemic	27	1.2181375E-6
anemission	1	4.5116206E-8
anemissions	1	4.5116206E-8
anemone	6	2.7069723E-7
anemones	7	3.1581345E-7
anemophily	2	9.023241E-8
anencephalics	2	9.023241E-8
anent	4	1.8046482E-7
anergic	2	9.023241E-8
anergy	4	1.8046482E-7
anerica	1	4.5116206E-8
anerican	1	4.5116206E-8
aneruysm	1	4.5116206E-8
anesthesia	107	4.827434E-6
anesthesiologist	11	4.962783E-7
anesthesiologists	12	5.4139446E-7
anesthesiology	3	1.3534861E-7
anesthetic	30	1.3534863E-6
anesthetics	14	6.316269E-7
anesthetist	1	4.5116206E-8
anesthetists	1	4.5116206E-8
anesthetization	3	1.3534861E-7
anesthetized	75	3.3837155E-6
anesthetizing	3	1.3534861E-7
anestrous	3	1.3534861E-7
anestrus	1	4.5116206E-8
anethol	1	4.5116206E-8
anette	1	4.5116206E-8
aneuploid	6	2.7069723E-7
aneuploidies	1	4.5116206E-8
aneuploids	4	1.8046482E-7
aneuploidy	16	7.218593E-7
aneurin	2	9.023241E-8
aneurism	1	4.5116206E-8
aneurisms	1	4.5116206E-8
aneurysm	14	6.316269E-7
aneurysmal	3	1.3534861E-7
aneurysms	5	2.2558103E-7
aneusomic	2	9.023241E-8
anevaluation	3	1.3534861E-7
anew	36	1.6241835E-6
anews	1	4.5116206E-8
anexis	1	4.5116206E-8
anexpenditure	1	4.5116206E-8
anf	1	4.5116206E-8
ang	89	4.0153423E-6
ang-hsi	1	4.5116206E-8
anga	1	4.5116206E-8
angau	1	4.5116206E-8
ange	5	2.2558103E-7
angel	5397	2.4349216E-4
angel-as-dork	1	4.5116206E-8
angel-baby	1	4.5116206E-8
angel-delayed	1	4.5116206E-8
angel-esque	1	4.5116206E-8
angel-hair	1	4.5116206E-8
angel-in-the-gutter-eating-rats	2	9.023241E-8
angel-ish	1	4.5116206E-8
angel-land	2	9.023241E-8
angel-like	1	4.5116206E-8
angel-loving	1	4.5116206E-8
angel-mopeage	1	4.5116206E-8
angel-obsessed	1	4.5116206E-8
angel-of-peace	1	4.5116206E-8
angel-pain	2	9.023241E-8
angel-raisins	1	4.5116206E-8
angel-related	5	2.2558103E-7
angel-souls	1	4.5116206E-8
angel-specific	1	4.5116206E-8
angel-spoilage	1	4.5116206E-8
angel-the	1	4.5116206E-8
angel-the-character	1	4.5116206E-8
angel-watching	1	4.5116206E-8
angel-wig	1	4.5116206E-8
angel-without-a-mission	1	4.5116206E-8
angel-y	1	4.5116206E-8
angela	111	5.007899E-6
angelbot	1	4.5116206E-8
angelcake	1	4.5116206E-8
angelcakes	1	4.5116206E-8
angeled	1	4.5116206E-8
angeleez	1	4.5116206E-8
angeleno	1	4.5116206E-8
angelenos	20	9.0232413E-7
angeles	2462	1.110761E-4
angeles-area	4	1.8046482E-7
angeles-based	13	5.865107E-7
angeles-set	1	4.5116206E-8
angeles-style	1	4.5116206E-8
angelesifcation	1	4.5116206E-8
angelestimes	1	4.5116206E-8
angeles–	2	9.023241E-8
angelfic	1	4.5116206E-8
angelfire	3	1.3534861E-7
angelfish	2	9.023241E-8
angeli	4	1.8046482E-7
angelic	16	7.218593E-7
angelica	8	3.6092965E-7
angelico	13	5.865107E-7
angelides	8	3.6092965E-7
angelika	1	4.5116206E-8
angelil	2	9.023241E-8
angelina	22	9.925566E-7
angeline	1	4.5116206E-8
angelini	1	4.5116206E-8
angelinnean	1	4.5116206E-8
angelisnbigrubbahsatin	1	4.5116206E-8
angelito	1	4.5116206E-8
angelitos	1	4.5116206E-8
angell	19	8.572079E-7
angellus	1	4.5116206E-8
angelman	4	1.8046482E-7
angelmobile	3	1.3534861E-7
angelo	25	1.1279052E-6
angelopoulos	2	9.023241E-8
angelos	11	4.962783E-7
angelou	16	7.218593E-7
angels	445	2.0076712E-5
angelsacolyte	1	4.5116206E-8
angelsu	1	4.5116206E-8
angeluna	1	4.5116206E-8
angelus	825	3.722087E-5
angelus-all-along	1	4.5116206E-8
angelus-from-the-happy-pill	1	4.5116206E-8
angelus-style	1	4.5116206E-8
angelus-will-do-anything-he-can-hang-onto	1	4.5116206E-8
angelus-y	3	1.3534861E-7
angelusy	1	4.5116206E-8
angelverse	6	2.7069723E-7
angely	1	4.5116206E-8
angent	1	4.5116206E-8
angeogenesis	1	4.5116206E-8
anger	405	1.8272063E-5
anger-at-work	1	4.5116206E-8
anger-in	1	4.5116206E-8
anger-management	2	9.023241E-8
anger-out	1	4.5116206E-8
anger-release	1	4.5116206E-8
angered	65	2.9325533E-6
angering	7	3.1581345E-7
angers	10	4.5116207E-7
anges	2	9.023241E-8
angevin	4	1.8046482E-7
anggrek	1	4.5116206E-8
angie	35	1.5790672E-6
angier	10	4.5116207E-7
angii-elicited	1	4.5116206E-8
angii-induced	1	4.5116206E-8
angilirq	1	4.5116206E-8
angina	30	1.3534863E-6
anginal	2	9.023241E-8
angioblasts	2	9.023241E-8
angiocath	1	4.5116206E-8
angiocatheter	2	9.023241E-8
angioedema	1	4.5116206E-8
angiofluorography	1	4.5116206E-8
angiogenesis	92	4.150691E-6
angiogenesis-inducing	1	4.5116206E-8
angiogenesis-related	3	1.3534861E-7
angiogenic	46	2.0753455E-6
angiogram	10	4.5116207E-7
angiographic	4	1.8046482E-7
angiographically	1	4.5116206E-8
angiography	26	1.1730214E-6
angioguard	9	4.0604587E-7
angiokeratomas	1	4.5116206E-8
angioplastic	1	4.5116206E-8
angioplasties	3	1.3534861E-7
angioplasty	31	1.3986024E-6
angiopoietin	5	2.2558103E-7
angiopoietins	2	9.023241E-8
angiosarcoma	1	4.5116206E-8
angiosarcomas	1	4.5116206E-8
angioscopy	1	4.5116206E-8
angiosperms	3	1.3534861E-7
angiostatic	12	5.4139446E-7
angiostatics	2	9.023241E-8
angiostatin	1	4.5116206E-8
angiotensin	38	1.7144158E-6
angiotensin-converting	5	2.2558103E-7
angius	1	4.5116206E-8
angkasa	1	4.5116206E-8
angkor	6	2.7069723E-7
angladon	1	4.5116206E-8
anglais	8	3.6092965E-7
angle	514	2.318973E-5
angled	16	7.218593E-7
angleman	2	9.023241E-8
anglenlorne	1	4.5116206E-8
anglenwezlee	1	4.5116206E-8
angler	23	1.0376727E-6
anglers	25	1.1279052E-6
angles	198	8.933009E-6
anglesea	2	9.023241E-8
anglesey	1	4.5116206E-8
angleterre	1	4.5116206E-8
angleton	3	1.3534861E-7
angleus	1	4.5116206E-8
anglia	3	1.3534861E-7
anglian	4	1.8046482E-7
anglican	46	2.0753455E-6
anglicans	12	5.4139446E-7
anglice	1	4.5116206E-8
anglicised	1	4.5116206E-8
anglicisms	6	2.7069723E-7
anglicization	1	4.5116206E-8
anglicize	2	9.023241E-8
anglicized	19	8.572079E-7
anglicizers	1	4.5116206E-8
anglicizing	1	4.5116206E-8
anglicum	1	4.5116206E-8
anglified	1	4.5116206E-8
angliiskii	1	4.5116206E-8
anglikon	1	4.5116206E-8
angling	26	1.1730214E-6
anglish	7	3.1581345E-7
anglo	219	9.880449E-6
anglo-american	1	4.5116206E-8
anglo-conformity	1	4.5116206E-8
anglo-hybrids	1	4.5116206E-8
anglo-maniac	1	4.5116206E-8
anglo-saxons	1	4.5116206E-8
anglo-saxophone	1	4.5116206E-8
anglo-waste	1	4.5116206E-8
anglocentric	1	4.5116206E-8
anglois	1	4.5116206E-8
anglomania	2	9.023241E-8
anglophile	4	1.8046482E-7
anglophiles	3	1.3534861E-7
anglophiliac	1	4.5116206E-8
anglophilic	3	1.3534861E-7
anglophobia	2	9.023241E-8
anglophone	12	5.4139446E-7
anglophones	6	2.7069723E-7
anglos	14	6.316269E-7
anglus	1	4.5116206E-8
angnardo	6	2.7069723E-7
angola	22	9.925566E-7
angolan	2	9.023241E-8
angoni	1	4.5116206E-8
angora	6	2.7069723E-7
angosta	1	4.5116206E-8
angostura	2	9.023241E-8
angram	1	4.5116206E-8
angrier	12	5.4139446E-7
angriest	5	2.2558103E-7
angrily	49	2.2106942E-6
angrp	3	1.3534861E-7
angry	629	2.8378094E-5
angry-for-just-cause	1	4.5116206E-8
angry-girl	1	4.5116206E-8
angry-psychotic	1	4.5116206E-8
angry-with-the-death-of	2	9.023241E-8
angry-without-a-cause	1	4.5116206E-8
angrycrazyruthless	1	4.5116206E-8
angrydoctor	2	9.023241E-8
angst	128	5.7748744E-6
angst-fest	3	1.3534861E-7
angst-filled	1	4.5116206E-8
angst-ridden	3	1.3534861E-7
angst-wracked	1	4.5116206E-8
angsted	1	4.5116206E-8
angstfest	1	4.5116206E-8
angstful	1	4.5116206E-8
angstier	1	4.5116206E-8
angstiest	1	4.5116206E-8
angsting	2	9.023241E-8
angstrom	3	1.3534861E-7
angstroms	1	4.5116206E-8
angsty	28	1.2632538E-6
anguage	1	4.5116206E-8
anguilla	2	9.023241E-8
anguipede	1	4.5116206E-8
anguish	52	2.3460427E-6
anguish-y	1	4.5116206E-8
anguished	32	1.4437186E-6
anguished-looking	1	4.5116206E-8
anguishing	1	4.5116206E-8
angular	25	1.1279052E-6
angulasbaby	1	4.5116206E-8
angulations	1	4.5116206E-8
angulatus	1	4.5116206E-8
angus	213	9.609752E-6
angus-ly	1	4.5116206E-8
angus-style	1	4.5116206E-8
angustias	2	9.023241E-8
angustiis	1	4.5116206E-8
angusy	2	9.023241E-8
angwissous	3	1.3534861E-7
angélico	1	4.5116206E-8
anh	1	4.5116206E-8
anhalt	2	9.023241E-8
anhalter	2	9.023241E-8
anhedonia	1	4.5116206E-8
anhela	1	4.5116206E-8
anheuser	16	7.218593E-7
anhidrosis	1	4.5116206E-8
anhouilh	1	4.5116206E-8
anhui	1	4.5116206E-8
anhydrase	9	4.0604587E-7
anhydride	4	1.8046482E-7
anhydrogalactose	2	9.023241E-8
anhydrous	15	6.767431E-7
ani	41	1.8497644E-6
aniacs	2	9.023241E-8
anibal	1	4.5116206E-8
anicca	1	4.5116206E-8
anicteric	2	9.023241E-8
anifowoshe	1	4.5116206E-8
anihi	1	4.5116206E-8
anika	1	4.5116206E-8
aniko	1	4.5116206E-8
anil	2	9.023241E-8
aniline-dyed	1	4.5116206E-8
anima	6	2.7069723E-7
animadversion	2	9.023241E-8
animadversions	1	4.5116206E-8
animae	1	4.5116206E-8
animal	1456	6.568919E-5
animal-based	1	4.5116206E-8
animal-consuming	1	4.5116206E-8
animal-control	1	4.5116206E-8
animal-driven	1	4.5116206E-8
animal-ethics	4	1.8046482E-7
animal-friendly	1	4.5116206E-8
animal-headed	1	4.5116206E-8
animal-inspired	1	4.5116206E-8
animal-loving	1	4.5116206E-8
animal-printed	1	4.5116206E-8
animal-righters	1	4.5116206E-8
animal-rights	7	3.1581345E-7
animal-skin	1	4.5116206E-8
animal-specific	1	4.5116206E-8
animal-to	1	4.5116206E-8
animal-to-animal	5	2.2558103E-7
animal-to-person	1	4.5116206E-8
animal-type	1	4.5116206E-8
animal-unit-month	2	9.023241E-8
animalcule	1	4.5116206E-8
animalibus	1	4.5116206E-8
animalistic	8	3.6092965E-7
animality	1	4.5116206E-8
animals	1943	8.766079E-5
animals-only	1	4.5116206E-8
animalsthat	1	4.5116206E-8
animalsto	1	4.5116206E-8
animal–microbe	1	4.5116206E-8
animal–vegetal	1	4.5116206E-8
animaniacs	6	2.7069723E-7
animaniacs-in	2	9.023241E-8
animas	2	9.023241E-8
animate	20	9.0232413E-7
animated	197	8.887892E-6
animatedly	7	3.1581345E-7
animates	6	2.7069723E-7
animating	10	4.5116207E-7
animation	103	4.6469695E-6
animations	11	4.962783E-7
animator	15	6.767431E-7
animators	11	4.962783E-7
animatronic	15	6.767431E-7
animatronically	1	4.5116206E-8
animatronics	1	4.5116206E-8
anime	15	6.767431E-7
animes	1	4.5116206E-8
animism	3	1.3534861E-7
animist	6	2.7069723E-7
animistic	2	9.023241E-8
animists	2	9.023241E-8
animorphs	1	4.5116206E-8
animosities	5	2.2558103E-7
animosity	46	2.0753455E-6
animportant	1	4.5116206E-8
animus	15	6.767431E-7
anindependent	1	4.5116206E-8
anion	11	4.962783E-7
anion-exchange	8	3.6092965E-7
anionic	23	1.0376727E-6
anions	4	1.8046482E-7
anipryl	2	9.023241E-8
anis	1	4.5116206E-8
anise	4	1.8046482E-7
anise-flavored	1	4.5116206E-8
aniseed	4	1.8046482E-7
aniseed-scented	1	4.5116206E-8
anish	2	9.023241E-8
anisocoria	1	4.5116206E-8
anisomorphic	2	9.023241E-8
anisomycin	14	6.316269E-7
anisomycin-stimulated	1	4.5116206E-8
anisomycin-treated	1	4.5116206E-8
anisonucleosis	2	9.023241E-8
anissina	33	1.4888349E-6
aniston	31	1.3986024E-6
anit	1	4.5116206E-8
anita	104	4.6920854E-6
anitfreeze	1	4.5116206E-8
anither	1	4.5116206E-8
anitra	1	4.5116206E-8
anity	1	4.5116206E-8
aniversary	1	4.5116206E-8
aniya	2	9.023241E-8
anja	1	4.5116206E-8
anjali	1	4.5116206E-8
anjelica	3	1.3534861E-7
anjin	2	9.023241E-8
anjing	1	4.5116206E-8
anjou	10	4.5116207E-7
ank	6	2.7069723E-7
anka	7	3.1581345E-7
ankara	31	1.3986024E-6
ankeny	2	9.023241E-8
anker	2	9.023241E-8
ankfc	2	9.023241E-8
ankh	4	1.8046482E-7
ankle	146	6.5869663E-6
ankle-deep	1	4.5116206E-8
ankle-length	6	2.7069723E-7
ankle-snapping	1	4.5116206E-8
ankles	58	2.61674E-6
anklesangle	1	4.5116206E-8
anklet	1	4.5116206E-8
ankleton	1	4.5116206E-8
anklets	3	1.3534861E-7
ankor	1	4.5116206E-8
anks-ity	1	4.5116206E-8
ankush	2	9.023241E-8
ankylosing	8	3.6092965E-7
ankylosis	3	1.3534861E-7
ankyrin	5	2.2558103E-7
ankyrins	2	9.023241E-8
anlage	26	1.1730214E-6
anlagen	10	4.5116207E-7
anlayzed	1	4.5116206E-8
anlysis	1	4.5116206E-8
ann	401	1.80916E-5
anna	181	8.166034E-6
annabel	8	3.6092965E-7
annabella	2	9.023241E-8
annabelle	11	4.962783E-7
annabeth	3	1.3534861E-7
annachie	2	9.023241E-8
annaka	1	4.5116206E-8
annakhil	1	4.5116206E-8
annakovsky	2	9.023241E-8
annal	1	4.5116206E-8
annalee	1	4.5116206E-8
annals	42	1.8948807E-6
annamaria	8	3.6092965E-7
annamese	1	4.5116206E-8
annan	137	6.1809205E-6
annan-brokered	1	4.5116206E-8
annan-omous	1	4.5116206E-8
annandale	5	2.2558103E-7
annandale-on	2	9.023241E-8
annane	2	9.023241E-8
annapolis	22	9.925566E-7
annapolis-sat	1	4.5116206E-8
annapurna	14	6.316269E-7
annapurnas	2	9.023241E-8
annarborous	1	4.5116206E-8
annas	2	9.023241E-8
annaud	3	1.3534861E-7
anne	490	2.2106942E-5
anne-de	1	4.5116206E-8
anne-style	1	4.5116206E-8
anneal	14	6.316269E-7
annealed	42	1.8948807E-6
annealing	115	5.188364E-6
annealing-extension	1	4.5116206E-8
anneals	3	1.3534861E-7
annecy	5	2.2558103E-7
annelaine	3	1.3534861E-7
anneli	1	4.5116206E-8
annelid	1	4.5116206E-8
annelida	1	4.5116206E-8
annelids	4	1.8046482E-7
annemarie	2	9.023241E-8
annenberg	7	3.1581345E-7
annenbergs	1	4.5116206E-8
annes	4	1.8046482E-7
annese	4	1.8046482E-7
anness	1	4.5116206E-8
annetastic	1	4.5116206E-8
annett	1	4.5116206E-8
annette	33	1.4888349E-6
annex	43	1.939997E-6
annexation	22	9.925566E-7
annexed	28	1.2632538E-6
annexes	4	1.8046482E-7
annexin	56	2.5265076E-6
annexing	5	2.2558103E-7
annexins	1	4.5116206E-8
anni	1	4.5116206E-8
annia	12	5.4139446E-7
annibale	7	3.1581345E-7
annick	1	4.5116206E-8
annie	100	4.511621E-6
anniesj	2	9.023241E-8
annif	1	4.5116206E-8
annihilate	9	4.0604587E-7
annihilated	11	4.962783E-7
annihilating	1	4.5116206E-8
annihilation	12	5.4139446E-7
annika	18	8.1209174E-7
annin	2	9.023241E-8
annis	2	9.023241E-8
annisa	1	4.5116206E-8
annisquam	1	4.5116206E-8
anniston	3	1.3534861E-7
anniversaries	13	5.865107E-7
anniversary	419	1.8903691E-5
anniversay	1	4.5116206E-8
anniversyar	1	4.5116206E-8
annmtg	1	4.5116206E-8
annnd	3	1.3534861E-7
annniversary	1	4.5116206E-8
anno	1	4.5116206E-8
annointed	1	4.5116206E-8
annoncement	2	9.023241E-8
annonciade	1	4.5116206E-8
annooying	1	4.5116206E-8
annot	1	4.5116206E-8
annotate	47	2.1204617E-6
annotated	290	1.30837E-5
annotates	1	4.5116206E-8
annotating	19	8.572079E-7
annotation	469	2.1159502E-5
annotation-based	1	4.5116206E-8
annotational	1	4.5116206E-8
annotationare	1	4.5116206E-8
annotationeditor	4	1.8046482E-7
annotations	238	1.0737657E-5
annotationsfor	1	4.5116206E-8
annotationstation	1	4.5116206E-8
annotative	1	4.5116206E-8
annotator	8	3.6092965E-7
annotators	1	4.5116206E-8
annoting	1	4.5116206E-8
annotto	2	9.023241E-8
annouced	1	4.5116206E-8
annoucement	1	4.5116206E-8
announce	241	1.08730055E-5
announced	1236	5.576363E-5
announcement	494	2.2287406E-5
announcements	100	4.511621E-6
announcer	62	2.7972048E-6
announcers	16	7.218593E-7
announces	106	4.782318E-6
announcing	153	6.9027797E-6
announcment	4	1.8046482E-7
annoy	67	3.022786E-6
annoyance	62	2.7972048E-6
annoyances	8	3.6092965E-7
annoyed	213	9.609752E-6
annoying	533	2.4046938E-5
annoyingly	21	9.4744036E-7
annoys	55	2.4813914E-6
annpying	1	4.5116206E-8
anntibiotics	1	4.5116206E-8
annua	2	9.023241E-8
annual	1821	8.2156614E-5
annual-meeting	1	4.5116206E-8
annual-meetings	1	4.5116206E-8
annualcombustion	3	1.3534861E-7
annualized	23	1.0376727E-6
annually	345	1.556509E-5
annualrpt	1	4.5116206E-8
annuals	14	6.316269E-7
annui	1	4.5116206E-8
annuitant	1	4.5116206E-8
annuitants	1	4.5116206E-8
annuities	24	1.0827889E-6
annuitity	1	4.5116206E-8
annuitizing	2	9.023241E-8
annuity	32	1.4437186E-6
annul	2	9.023241E-8
annular	3	1.3534861E-7
annulata	1	4.5116206E-8
annulate	2	9.023241E-8
annuli	1	4.5116206E-8
annulled	9	4.0604587E-7
annulling	1	4.5116206E-8
annulment	8	3.6092965E-7
annulments	2	9.023241E-8
annuls	1	4.5116206E-8
annulus	7	3.1581345E-7
annum	2	9.023241E-8
annunciation	17	7.669755E-7
annunziata	2	9.023241E-8
annunzio	5	2.2558103E-7
annun­ci­a­tion	1	4.5116206E-8
annus	4	1.8046482E-7
annuus	3	1.3534861E-7
anny	1	4.5116206E-8
ano	7	3.1581345E-7
anoble	2	9.023241E-8
anode	1	4.5116206E-8
anodized	3	1.3534861E-7
anodyne	18	8.1209174E-7
anoia	2	9.023241E-8
anoikis	5	2.2558103E-7
anoint	11	4.962783E-7
anointed	53	2.391159E-6
anointest	1	4.5116206E-8
anointing	7	3.1581345E-7
anointment	2	9.023241E-8
anoints	7	3.1581345E-7
anomalies	38	1.7144158E-6
anomalous	45	2.0302293E-6
anomalously	2	9.023241E-8
anomaly	39	1.7595321E-6
anomaly-the	1	4.5116206E-8
anomic	3	1.3534861E-7
anomie	11	4.962783E-7
anomolies	1	4.5116206E-8
anon	13	5.865107E-7
anone	1	4.5116206E-8
anonymiana	1	4.5116206E-8
anonymity	95	4.2860397E-6
anonymized	1	4.5116206E-8
anonymous	271	1.2226492E-5
anonymous-evil-which-must-be-destroyed	1	4.5116206E-8
anonymouse	1	4.5116206E-8
anonymously	38	1.7144158E-6
anonyms	1	4.5116206E-8
anooying	1	4.5116206E-8
anopheles	93	4.1958074E-6
anopheline	2	9.023241E-8
anoquodor	2	9.023241E-8
anorexia	50	2.2558104E-6
anorexic	34	1.533951E-6
anorexics	9	4.0604587E-7
anorxic	2	9.023241E-8
anosmias	2	9.023241E-8
anosognosia	2	9.023241E-8
anot	6	2.7069723E-7
anote	1	4.5116206E-8
anotehr	1	4.5116206E-8
anoth	2	9.023241E-8
anothe	1	4.5116206E-8
another	12281	5.5407215E-4
another-are	1	4.5116206E-8
another-it	1	4.5116206E-8
anotherand	1	4.5116206E-8
anotherthree	1	4.5116206E-8
anouk	4	1.8046482E-7
anouncement	1	4.5116206E-8
anova	204	9.203706E-6
anovas	10	4.5116207E-7
anovulation	1	4.5116206E-8
anovulatory	1	4.5116206E-8
anoxia	1	4.5116206E-8
anozer	5	2.2558103E-7
anp	1	4.5116206E-8
anpei	1	4.5116206E-8
anquetil	7	3.1581345E-7
anred	2	9.023241E-8
ans	8	3.6092965E-7
ansar	10	4.5116207E-7
ansar-ul	2	9.023241E-8
ansari	2	9.023241E-8
anschutz	6	2.7069723E-7
ansci	1	4.5116206E-8
anse	16	7.218593E-7
anse-aux	1	4.5116206E-8
ansel	5	2.2558103E-7
anselin	1	4.5116206E-8
ansell	4	1.8046482E-7
anselm	4	1.8046482E-7
anselma	1	4.5116206E-8
anselmo	19	8.572079E-7
ansen	30	1.3534863E-6
anses-d	1	4.5116206E-8
ansi	9	4.0604587E-7
ansible	1	4.5116206E-8
ansley	2	9.023241E-8
anson	15	6.767431E-7
ansty	1	4.5116206E-8
answeed	1	4.5116206E-8
answer	3162	1.4265745E-4
answer-desk	1	4.5116206E-8
answerable	7	3.1581345E-7
answered	504	2.2738568E-5
answererd	1	4.5116206E-8
answerers	1	4.5116206E-8
answering	291	1.3128816E-5
answering-machine	3	1.3534861E-7
answerphone	1	4.5116206E-8
answers	1064	4.8003643E-5
answerthink	1	4.5116206E-8
ant	84	3.7897614E-6
ant-nut	1	4.5116206E-8
ant-parasite	1	4.5116206E-8
ant-phosphotyrosine	1	4.5116206E-8
anta	3	1.3534861E-7
antacid	2	9.023241E-8
antacids	3	1.3534861E-7
antag	4	1.8046482E-7
antagonisation	2	9.023241E-8
antagonise	1	4.5116206E-8
antagonised	2	9.023241E-8
antagonising	1	4.5116206E-8
antagonism	62	2.7972048E-6
antagonisms	1	4.5116206E-8
antagonist	131	5.910223E-6
antagonist-bound	2	9.023241E-8
antagonistic	63	2.842321E-6
antagonistically	4	1.8046482E-7
antagonists	167	7.5344064E-6
antagonization	1	4.5116206E-8
antagonize	24	1.0827889E-6
antagonized	12	5.4139446E-7
antagonizes	11	4.962783E-7
antagonizing	20	9.0232413E-7
antananarivo	3	1.3534861E-7
antarctic	42	1.8948807E-6
antarctica	46	2.0753455E-6
antares	4	1.8046482E-7
antartica	2	9.023241E-8
antas	1	4.5116206E-8
antawn	1	4.5116206E-8
antca	1	4.5116206E-8
ante	55	2.4813914E-6
anteact	1	4.5116206E-8
anteater	1	4.5116206E-8
anteaters	1	4.5116206E-8
antebellum	14	6.316269E-7
anteceded	1	4.5116206E-8
antecedent	31	1.3986024E-6
antecedently	1	4.5116206E-8
antecedents	17	7.669755E-7
antechamber	7	3.1581345E-7
antechambers	2	9.023241E-8
antecubital	3	1.3534861E-7
anted	1	4.5116206E-8
antedate	5	2.2558103E-7
antedated	2	9.023241E-8
antedates	5	2.2558103E-7
antedating	2	9.023241E-8
antedatings	3	1.3534861E-7
antediluvian	6	2.7069723E-7
antegrade	3	1.3534861E-7
antegren	1	4.5116206E-8
anteing	2	9.023241E-8
antel	2	9.023241E-8
antelami	1	4.5116206E-8
antell	1	4.5116206E-8
antelope	34	1.533951E-6
antelopes	4	1.8046482E-7
antemortem	1	4.5116206E-8
antemortum	1	4.5116206E-8
antena	1	4.5116206E-8
antenae	1	4.5116206E-8
antenatal	7	3.1581345E-7
antenna	38	1.7144158E-6
antenna-like	1	4.5116206E-8
antennae	22	9.925566E-7
antennal	32	1.4437186E-6
antennapedia	3	1.3534861E-7
antennas	17	7.669755E-7
antennes	1	4.5116206E-8
antepartum	2	9.023241E-8
antepenultimate	1	4.5116206E-8
antequam	1	4.5116206E-8
antequera	7	3.1581345E-7
anteriad	1	4.5116206E-8
anterioposterior	1	4.5116206E-8
anterior	228	1.0286495E-5
anterior-posterior	7	3.1581345E-7
anteriorly	15	6.767431E-7
anterior–posterior	1	4.5116206E-8
anterograde	1	4.5116206E-8
anterolateral	4	1.8046482E-7
anteroom	2	9.023241E-8
anteroposterior	2	9.023241E-8
anteroventral	1	4.5116206E-8
antes	2	9.023241E-8
antforms	1	4.5116206E-8
anthee	6	2.7069723E-7
anthelminthic	1	4.5116206E-8
anthem	66	2.9776697E-6
anthema	1	4.5116206E-8
anthemic	2	9.023241E-8
anthemideae	8	3.6092965E-7
anthemideae-type	1	4.5116206E-8
anthemius	1	4.5116206E-8
anthems	13	5.865107E-7
anther	3	1.3534861E-7
anthers	2	9.023241E-8
anthill	3	1.3534861E-7
anthills	3	1.3534861E-7
anthocyanidins	1	4.5116206E-8
anthocyanines	1	4.5116206E-8
anthoine	2	9.023241E-8
anthologie	1	4.5116206E-8
anthologies	11	4.962783E-7
anthologists	1	4.5116206E-8
anthologized	1	4.5116206E-8
anthologizers	1	4.5116206E-8
anthologizing	1	4.5116206E-8
anthology	60	2.7069725E-6
anthony	339	1.5294394E-5
anthonys	1	4.5116206E-8
anthozoons	1	4.5116206E-8
anthracis	27	1.2181375E-6
anthracite	2	9.023241E-8
anthracks	1	4.5116206E-8
anthracycline	3	1.3534861E-7
anthracycline-containing	1	4.5116206E-8
anthracyclines	3	1.3534861E-7
anthranilate	20	9.0232413E-7
anthranilate-utilizing	1	4.5116206E-8
anthrax	119	5.3688286E-6
anthrax-by-mail	1	4.5116206E-8
anthrax-laced	1	4.5116206E-8
anthrax-like	1	4.5116206E-8
anthrax-response	1	4.5116206E-8
anthrax-scientist	3	1.3534861E-7
anthrax-tipped	1	4.5116206E-8
anthrax-type	1	4.5116206E-8
anthro	5	2.2558103E-7
anthropic	8	3.6092965E-7
anthropogenic	1	4.5116206E-8
anthropoid	1	4.5116206E-8
anthropological	24	1.0827889E-6
anthropologically	2	9.023241E-8
anthropologist	56	2.5265076E-6
anthropologists	43	1.939997E-6
anthropology	77	3.473948E-6
anthropology-speak	1	4.5116206E-8
anthropometric	22	9.925566E-7
anthropometrics	1	4.5116206E-8
anthropometry	2	9.023241E-8
anthropomorphic	9	4.0604587E-7
anthropomorphically	1	4.5116206E-8
anthropomorphism	1	4.5116206E-8
anthropomorphization	1	4.5116206E-8
anthropomorphize	3	1.3534861E-7
anthropomorphizing	4	1.8046482E-7
anthroponymy	1	4.5116206E-8
anthropormorphise	1	4.5116206E-8
anthro­pol­o­gists	1	4.5116206E-8
anthurium	1	4.5116206E-8
anthuriums	2	9.023241E-8
anti	1898	8.563056E-5
anti-?	52	2.3460427E-6
anti-?-actin	5	2.2558103E-7
anti-?-catenin	2	9.023241E-8
anti-?-coatomer	1	4.5116206E-8
anti-?-gal	1	4.5116206E-8
anti-?-gustducin	3	1.3534861E-7
anti-?-tubulin	6	2.7069723E-7
anti-?v?	1	4.5116206E-8
anti-abortion	87	3.92511E-6
anti-abortion-rights	2	9.023241E-8
anti-abortionist	2	9.023241E-8
anti-abortionists	1	4.5116206E-8
anti-abortive	1	4.5116206E-8
anti-abuse	1	4.5116206E-8
anti-academic	3	1.3534861E-7
anti-academy	1	4.5116206E-8
anti-acetylated	1	4.5116206E-8
anti-actin	2	9.023241E-8
anti-active	2	9.023241E-8
anti-adenoviral	1	4.5116206E-8
anti-adhesive	1	4.5116206E-8
anti-ads	1	4.5116206E-8
anti-adultery	2	9.023241E-8
anti-aesthetic	1	4.5116206E-8
anti-affirmative	5	2.2558103E-7
anti-affirmative-action	5	2.2558103E-7
anti-ageing	1	4.5116206E-8
anti-aggregant	1	4.5116206E-8
anti-aging	3	1.3534861E-7
anti-air	3	1.3534861E-7
anti-aircraft	37	1.6692996E-6
anti-airline	1	4.5116206E-8
anti-al	1	4.5116206E-8
anti-allergy	1	4.5116206E-8
anti-alpha	1	4.5116206E-8
anti-androgen	2	9.023241E-8
anti-angiogenesis	1	4.5116206E-8
anti-angiogenic	10	4.5116207E-7
anti-anorexia	1	4.5116206E-8
anti-anti	3	1.3534861E-7
anti-anti-cloning	2	9.023241E-8
anti-anti-divorce	1	4.5116206E-8
anti-antidisestablishmentarianism	1	4.5116206E-8
anti-anxiety	8	3.6092965E-7
anti-anything	1	4.5116206E-8
anti-apartheid	5	2.2558103E-7
anti-apologizing	1	4.5116206E-8
anti-apoptotic	44	1.9851132E-6
anti-apoptotically	3	1.3534861E-7
anti-aquaporin	2	9.023241E-8
anti-arrhythmic	1	4.5116206E-8
anti-art	1	4.5116206E-8
anti-arthritic	1	4.5116206E-8
anti-asbestos	1	4.5116206E-8
anti-asbt	1	4.5116206E-8
anti-askye	1	4.5116206E-8
anti-assisted	1	4.5116206E-8
anti-assisted-suicide	1	4.5116206E-8
anti-asspull	1	4.5116206E-8
anti-atherogenesis	1	4.5116206E-8
anti-atherogenic	1	4.5116206E-8
anti-atherosclerotic	1	4.5116206E-8
anti-authoritarian	3	1.3534861E-7
anti-authoritarianism	2	9.023241E-8
anti-authority	1	4.5116206E-8
anti-autism	1	4.5116206E-8
anti-b	1	4.5116206E-8
anti-backlash	1	4.5116206E-8
anti-bacteriants	1	4.5116206E-8
anti-baking	1	4.5116206E-8
anti-baldness	1	4.5116206E-8
anti-ballerina	1	4.5116206E-8
anti-ballistic	6	2.7069723E-7
anti-ballistic-missile	1	4.5116206E-8
anti-banner	1	4.5116206E-8
anti-battle	1	4.5116206E-8
anti-big-government	1	4.5116206E-8
anti-bigotry	1	4.5116206E-8
anti-bilingualism	1	4.5116206E-8
anti-biography	1	4.5116206E-8
anti-biological	1	4.5116206E-8
anti-biotics	6	2.7069723E-7
anti-biotin	2	9.023241E-8
anti-birth-control	1	4.5116206E-8
anti-bistate	1	4.5116206E-8
anti-black	5	2.2558103E-7
anti-bloat	2	9.023241E-8
anti-blockbuster	1	4.5116206E-8
anti-blood-clotting	1	4.5116206E-8
anti-blue	1	4.5116206E-8
anti-bodies	1	4.5116206E-8
anti-body	1	4.5116206E-8
anti-bombing	5	2.2558103E-7
anti-boring	1	4.5116206E-8
anti-bourgeois	1	4.5116206E-8
anti-bovine	2	9.023241E-8
anti-boxing	1	4.5116206E-8
anti-breast	1	4.5116206E-8
anti-breeding	1	4.5116206E-8
anti-bribery	1	4.5116206E-8
anti-brutality	1	4.5116206E-8
anti-buffista	1	4.5116206E-8
anti-bureaucratic	1	4.5116206E-8
anti-business	9	4.0604587E-7
anti-busing	2	9.023241E-8
anti-c-crk	1	4.5116206E-8
anti-c-jun	1	4.5116206E-8
anti-caffeine	1	4.5116206E-8
anti-caldesmon	1	4.5116206E-8
anti-calnexin	2	9.023241E-8
anti-calponin	1	4.5116206E-8
anti-calreticulin	2	9.023241E-8
anti-camel	1	4.5116206E-8
anti-camel-toe	1	4.5116206E-8
anti-campaign	1	4.5116206E-8
anti-cancer	8	3.6092965E-7
anti-capital	1	4.5116206E-8
anti-capitalist	4	1.8046482E-7
anti-caspase	1	4.5116206E-8
anti-catalase	2	9.023241E-8
anti-cathepsin	1	4.5116206E-8
anti-catheter	1	4.5116206E-8
anti-celebrity	1	4.5116206E-8
anti-cellularism	1	4.5116206E-8
anti-censorship	1	4.5116206E-8
anti-chameleon	1	4.5116206E-8
anti-change	1	4.5116206E-8
anti-charismatic	1	4.5116206E-8
anti-chart-pop	1	4.5116206E-8
anti-chemical	1	4.5116206E-8
anti-chemokine	1	4.5116206E-8
anti-chicken	4	1.8046482E-7
anti-chimera	1	4.5116206E-8
anti-chlamydial	2	9.023241E-8
anti-choice	5	2.2558103E-7
anti-cholesterol	1	4.5116206E-8
anti-cholinergic	1	4.5116206E-8
anti-christ	2	9.023241E-8
anti-cigarette	1	4.5116206E-8
anti-civil-libertarian	1	4.5116206E-8
anti-class	1	4.5116206E-8
anti-cleaved	2	9.023241E-8
anti-clerical	5	2.2558103E-7
anti-clericalism	2	9.023241E-8
anti-clericalist	1	4.5116206E-8
anti-climactic	4	1.8046482E-7
anti-climatic	1	4.5116206E-8
anti-climax	3	1.3534861E-7
anti-cloning	1	4.5116206E-8
anti-clotting	1	4.5116206E-8
anti-coagulant	3	1.3534861E-7
anti-coffee	2	9.023241E-8
anti-collagen	6	2.7069723E-7
anti-collagen-type	1	4.5116206E-8
anti-colonial	5	2.2558103E-7
anti-color	1	4.5116206E-8
anti-commercial	2	9.023241E-8
anti-commercialism	1	4.5116206E-8
anti-commodity	1	4.5116206E-8
anti-communism	8	3.6092965E-7
anti-communist	9	4.0604587E-7
anti-communists	1	4.5116206E-8
anti-community	1	4.5116206E-8
anti-competitive	26	1.1730214E-6
anti-conglomerate	1	4.5116206E-8
anti-connor	1	4.5116206E-8
anti-conservationist	1	4.5116206E-8
anti-conservative	1	4.5116206E-8
anti-conservatives	1	4.5116206E-8
anti-conspiratorial	1	4.5116206E-8
anti-constitutional	1	4.5116206E-8
anti-consumer	3	1.3534861E-7
anti-consumerism	1	4.5116206E-8
anti-cool	1	4.5116206E-8
anti-corporate	3	1.3534861E-7
anti-corruption	2	9.023241E-8
anti-crime	6	2.7069723E-7
anti-criminal	1	4.5116206E-8
anti-crisis	1	4.5116206E-8
anti-crowd	1	4.5116206E-8
anti-cyclin	6	2.7069723E-7
anti-cynicism	1	4.5116206E-8
anti-cytochrome	7	3.1581345E-7
anti-cytokine	2	9.023241E-8
anti-dancing	1	4.5116206E-8
anti-dating	1	4.5116206E-8
anti-death	1	4.5116206E-8
anti-defamation	2	9.023241E-8
anti-democratic	9	4.0604587E-7
anti-dengue	1	4.5116206E-8
anti-depressant	6	2.7069723E-7
anti-depressants	14	6.316269E-7
anti-desecration	1	4.5116206E-8
anti-diabetic	1	4.5116206E-8
anti-diarrheal	1	4.5116206E-8
anti-digoxigenin	9	4.0604587E-7
anti-digoxigenin-peroxidase	1	4.5116206E-8
anti-digoxygenin	2	9.023241E-8
anti-discrimination	16	7.218593E-7
anti-diva	1	4.5116206E-8
anti-divorce	1	4.5116206E-8
anti-doomsaying	2	9.023241E-8
anti-doping	1	4.5116206E-8
anti-draft	1	4.5116206E-8
anti-dramatic	1	4.5116206E-8
anti-dreyfusard-poujadist-lepenist	1	4.5116206E-8
anti-drinking	1	4.5116206E-8
anti-drug	53	2.391159E-6
anti-drug-war	1	4.5116206E-8
anti-drunk	2	9.023241E-8
anti-ds	1	4.5116206E-8
anti-duck	1	4.5116206E-8
anti-e	2	9.023241E-8
anti-economics	1	4.5116206E-8
anti-economist	1	4.5116206E-8
anti-education	2	9.023241E-8
anti-elastin	2	9.023241E-8
anti-electric-car	1	4.5116206E-8
anti-electrons	1	4.5116206E-8
anti-elimination	7	3.1581345E-7
anti-elitism	2	9.023241E-8
anti-elitist	2	9.023241E-8
anti-emotion	1	4.5116206E-8
anti-empathy	1	4.5116206E-8
anti-endomysial	1	4.5116206E-8
anti-endothelial	2	9.023241E-8
anti-enthusiasm	2	9.023241E-8
anti-entrepreneurial	1	4.5116206E-8
anti-environment	13	5.865107E-7
anti-environmental	3	1.3534861E-7
anti-environmentalist	1	4.5116206E-8
anti-epilepsy	1	4.5116206E-8
anti-epileptic	3	1.3534861E-7
anti-eradication	1	4.5116206E-8
anti-erotic	1	4.5116206E-8
anti-essentialism	1	4.5116206E-8
anti-establishment	9	4.0604587E-7
anti-estrogen	2	9.023241E-8
anti-estrogenic	1	4.5116206E-8
anti-estrogens	1	4.5116206E-8
anti-evolutionary	1	4.5116206E-8
anti-expansion	1	4.5116206E-8
anti-expert	1	4.5116206E-8
anti-expos	1	4.5116206E-8
anti-fade	4	1.8046482E-7
anti-fading	1	4.5116206E-8
anti-family	5	2.2558103E-7
anti-fan	1	4.5116206E-8
anti-fascist	3	1.3534861E-7
anti-fashion	2	9.023241E-8
anti-father	1	4.5116206E-8
anti-federal-government	1	4.5116206E-8
anti-female	1	4.5116206E-8
anti-feminism	1	4.5116206E-8
anti-feminist	3	1.3534861E-7
anti-feminists	2	9.023241E-8
anti-fibrillarin	1	4.5116206E-8
anti-fibrinolytic	1	4.5116206E-8
anti-fibronectin	2	9.023241E-8
anti-flag	2	9.023241E-8
anti-flair	1	4.5116206E-8
anti-flour	1	4.5116206E-8
anti-flu	3	1.3534861E-7
anti-fluorescein	2	9.023241E-8
anti-foreign	1	4.5116206E-8
anti-fraud	2	9.023241E-8
anti-free	1	4.5116206E-8
anti-free-enterprise	1	4.5116206E-8
anti-free-trade	1	4.5116206E-8
anti-freeze	1	4.5116206E-8
anti-fungal	2	9.023241E-8
anti-fxxx	1	4.5116206E-8
anti-gag	1	4.5116206E-8
anti-gamblers	1	4.5116206E-8
anti-gambling	12	5.4139446E-7
anti-gang	2	9.023241E-8
anti-gay	21	9.4744036E-7
anti-gay-discrimination	1	4.5116206E-8
anti-gay-job-discrimination	1	4.5116206E-8
anti-gaydar	1	4.5116206E-8
anti-genomic	1	4.5116206E-8
anti-germ-warfare	1	4.5116206E-8
anti-gliadin	1	4.5116206E-8
anti-glitter	1	4.5116206E-8
anti-global	1	4.5116206E-8
anti-globalization	2	9.023241E-8
anti-glucagon	1	4.5116206E-8
anti-glucocorticoid	1	4.5116206E-8
anti-glucocorticoid-independent	1	4.5116206E-8
anti-glucokinase	1	4.5116206E-8
anti-glutamate	1	4.5116206E-8
anti-goat	7	3.1581345E-7
anti-government	24	1.0827889E-6
anti-gp	4	1.8046482E-7
anti-granny	1	4.5116206E-8
anti-grape	1	4.5116206E-8
anti-gravin	2	9.023241E-8
anti-gravitons	1	4.5116206E-8
anti-gravity	2	9.023241E-8
anti-grown-up	1	4.5116206E-8
anti-growth	1	4.5116206E-8
anti-guilt	1	4.5116206E-8
anti-guinea	1	4.5116206E-8
anti-guitar	1	4.5116206E-8
anti-gun	3	1.3534861E-7
anti-gun-control	1	4.5116206E-8
anti-h	5	2.2558103E-7
anti-haemorrhagic	1	4.5116206E-8
anti-hamster	1	4.5116206E-8
anti-haredi	2	9.023241E-8
anti-health	1	4.5116206E-8
anti-hemagglutinin	2	9.023241E-8
anti-hero	4	1.8046482E-7
anti-heroes	1	4.5116206E-8
anti-histamines	1	4.5116206E-8
anti-historianism	1	4.5116206E-8
anti-historical	2	9.023241E-8
anti-homosexual	2	9.023241E-8
anti-horse	1	4.5116206E-8
anti-horse-meat	1	4.5116206E-8
anti-hsp	2	9.023241E-8
anti-human	68	3.067902E-6
anti-human-sarcospan	1	4.5116206E-8
anti-humanitarian	1	4.5116206E-8
anti-humectant	1	4.5116206E-8
anti-humor	1	4.5116206E-8
anti-hurricane	1	4.5116206E-8
anti-hydrogen	3	1.3534861E-7
anti-hypertensive	2	9.023241E-8
anti-hypertensives	2	9.023241E-8
anti-i	3	1.3534861E-7
anti-id	1	4.5116206E-8
anti-idealist	1	4.5116206E-8
anti-idiotype	2	9.023241E-8
anti-idiotypic	5	2.2558103E-7
anti-illegal	1	4.5116206E-8
anti-image	1	4.5116206E-8
anti-immigrant	10	4.5116207E-7
anti-immigration	3	1.3534861E-7
anti-impeachment	8	3.6092965E-7
anti-imperialist	4	1.8046482E-7
anti-impotence	5	2.2558103E-7
anti-incarceration	1	4.5116206E-8
anti-income-tax	1	4.5116206E-8
anti-independence	13	5.865107E-7
anti-indie	1	4.5116206E-8
anti-infection	1	4.5116206E-8
anti-infective	1	4.5116206E-8
anti-inflammatories	2	9.023241E-8
anti-inflammatory	73	3.2934831E-6
anti-inflationary	1	4.5116206E-8
anti-initiation	1	4.5116206E-8
anti-insect	1	4.5116206E-8
anti-insight	1	4.5116206E-8
anti-insulin	1	4.5116206E-8
anti-intellectual	16	7.218593E-7
anti-intellectualism	4	1.8046482E-7
anti-intellectualisms	1	4.5116206E-8
anti-intellectualization	1	4.5116206E-8
anti-interleukin	1	4.5116206E-8
anti-interventionism	1	4.5116206E-8
anti-interventionist	1	4.5116206E-8
anti-iraq	1	4.5116206E-8
anti-islet	1	4.5116206E-8
anti-ita	2	9.023241E-8
anti-itch	2	9.023241E-8
anti-jam	1	4.5116206E-8
anti-karyopherin	1	4.5116206E-8
anti-kayak	1	4.5116206E-8
anti-kid	1	4.5116206E-8
anti-lamin	7	3.1581345E-7
anti-lamins	1	4.5116206E-8
anti-language	16	7.218593E-7
anti-languages	1	4.5116206E-8
anti-latent	1	4.5116206E-8
anti-left	1	4.5116206E-8
anti-liberal	1	4.5116206E-8
anti-life	1	4.5116206E-8
anti-ligand	1	4.5116206E-8
anti-light	1	4.5116206E-8
anti-line-item	1	4.5116206E-8
anti-lipoic	3	1.3534861E-7
anti-liquor	1	4.5116206E-8
anti-little	1	4.5116206E-8
anti-lock	3	1.3534861E-7
anti-log	1	4.5116206E-8
anti-lottery	1	4.5116206E-8
anti-m	2	9.023241E-8
anti-magnetized	1	4.5116206E-8
anti-majoritarian	1	4.5116206E-8
anti-malarial	15	6.767431E-7
anti-malarials	5	2.2558103E-7
anti-mandate	1	4.5116206E-8
anti-manipulation	3	1.3534861E-7
anti-market	4	1.8046482E-7
anti-matches	1	4.5116206E-8
anti-materialistic	1	4.5116206E-8
anti-math	1	4.5116206E-8
anti-matter	4	1.8046482E-7
anti-me	1	4.5116206E-8
anti-media	1	4.5116206E-8
anti-meliorism	2	9.023241E-8
anti-meliorist	1	4.5116206E-8
anti-meliorists	8	3.6092965E-7
anti-microbial	1	4.5116206E-8
anti-middle	1	4.5116206E-8
anti-military	1	4.5116206E-8
anti-militia	1	4.5116206E-8
anti-mineralocorticoid	1	4.5116206E-8
anti-miscegenation	1	4.5116206E-8
anti-missile	33	1.4888349E-6
anti-missiles	2	9.023241E-8
anti-mitochondrial	2	9.023241E-8
anti-mitotic	1	4.5116206E-8
anti-moisture	1	4.5116206E-8
anti-monarchists	1	4.5116206E-8
anti-monarchy	1	4.5116206E-8
anti-monopolistic	1	4.5116206E-8
anti-mosquito	1	4.5116206E-8
anti-mouse	119	5.3688286E-6
anti-mugging	1	4.5116206E-8
anti-murine	8	3.6092965E-7
anti-muscarinic	8	3.6092965E-7
anti-myc	8	3.6092965E-7
anti-myocilin	2	9.023241E-8
anti-myosin	1	4.5116206E-8
anti-mystical	1	4.5116206E-8
anti-myth	1	4.5116206E-8
anti-n	1	4.5116206E-8
anti-narcotics	1	4.5116206E-8
anti-nationalist	1	4.5116206E-8
anti-natural	1	4.5116206E-8
anti-nausea	1	4.5116206E-8
anti-neoplastic	3	1.3534861E-7
anti-nerve	1	4.5116206E-8
anti-neurofilament	1	4.5116206E-8
anti-neurokinin	2	9.023241E-8
anti-new	1	4.5116206E-8
anti-nipple	1	4.5116206E-8
anti-nmt	1	4.5116206E-8
anti-nociceptive	1	4.5116206E-8
anti-normative	1	4.5116206E-8
anti-nuclear	2	9.023241E-8
anti-nuke	1	4.5116206E-8
anti-obesity	3	1.3534861E-7
anti-oestrogen	1	4.5116206E-8
anti-oestrogens	1	4.5116206E-8
anti-oil	1	4.5116206E-8
anti-olivers	1	4.5116206E-8
anti-oncogene	1	4.5116206E-8
anti-onomatopoeia	1	4.5116206E-8
anti-oppression	1	4.5116206E-8
anti-orange-vegetable	1	4.5116206E-8
anti-osteocalcin	2	9.023241E-8
anti-osteoclast	1	4.5116206E-8
anti-osteoclastogenic	6	2.7069723E-7
anti-ovalbumin	2	9.023241E-8
anti-ownership	1	4.5116206E-8
anti-oxidant	2	9.023241E-8
anti-oxidants	1	4.5116206E-8
anti-oxidation	1	4.5116206E-8
anti-p	14	6.316269E-7
anti-pain	1	4.5116206E-8
anti-papacy	1	4.5116206E-8
anti-paparazzi	1	4.5116206E-8
anti-parallel	2	9.023241E-8
anti-party	1	4.5116206E-8
anti-patriarchal	1	4.5116206E-8
anti-peace	3	1.3534861E-7
anti-pedophile	1	4.5116206E-8
anti-penton	1	4.5116206E-8
anti-peptide	8	3.6092965E-7
anti-personnel	5	2.2558103E-7
anti-phantom	1	4.5116206E-8
anti-phospho	13	5.865107E-7
anti-phospho-c-jun	2	9.023241E-8
anti-phospho-histone	1	4.5116206E-8
anti-phospho-moesin	1	4.5116206E-8
anti-phospho-p	6	2.7069723E-7
anti-phospholipid	1	4.5116206E-8
anti-phosphorylated	6	2.7069723E-7
anti-phosphoserine	1	4.5116206E-8
anti-phosphotyrosine	12	5.4139446E-7
anti-phthalate	2	9.023241E-8
anti-pimp	1	4.5116206E-8
anti-piracy	2	9.023241E-8
anti-planned	1	4.5116206E-8
anti-plasmin	1	4.5116206E-8
anti-playoff	1	4.5116206E-8
anti-pledge	3	1.3534861E-7
anti-plushie	1	4.5116206E-8
anti-poker	4	1.8046482E-7
anti-political	1	4.5116206E-8
anti-politician	1	4.5116206E-8
anti-politics	1	4.5116206E-8
anti-pollution	3	1.3534861E-7
anti-polysaccharide	1	4.5116206E-8
anti-pop	1	4.5116206E-8
anti-popular-culture	1	4.5116206E-8
anti-pork	2	9.023241E-8
anti-porn	1	4.5116206E-8
anti-pornography	5	2.2558103E-7
anti-pot	1	4.5116206E-8
anti-poverty	14	6.316269E-7
anti-preference	1	4.5116206E-8
anti-pregnancy	1	4.5116206E-8
anti-prejudice	1	4.5116206E-8
anti-prenatal	2	9.023241E-8
anti-press	3	1.3534861E-7
anti-primary	1	4.5116206E-8
anti-profilin	2	9.023241E-8
anti-proinsulin	1	4.5116206E-8
anti-proliferation	1	4.5116206E-8
anti-proliferationists	1	4.5116206E-8
anti-proliferative	14	6.316269E-7
anti-promotion	1	4.5116206E-8
anti-property	1	4.5116206E-8
anti-protectionism	1	4.5116206E-8
anti-protein	1	4.5116206E-8
anti-protons	2	9.023241E-8
anti-psychiatrists	1	4.5116206E-8
anti-psychotic	1	4.5116206E-8
anti-public-education	1	4.5116206E-8
anti-pyretic	3	1.3534861E-7
anti-pyretics	5	2.2558103E-7
anti-rabbit	73	3.2934831E-6
anti-raccoon	1	4.5116206E-8
anti-race	1	4.5116206E-8
anti-racialism	1	4.5116206E-8
anti-racism	3	1.3534861E-7
anti-racist	7	3.1581345E-7
anti-rape	1	4.5116206E-8
anti-rat	18	8.1209174E-7
anti-realist	1	4.5116206E-8
anti-reform	2	9.023241E-8
anti-reggae	1	4.5116206E-8
anti-regulation	3	1.3534861E-7
anti-regulatory	3	1.3534861E-7
anti-rejection	3	1.3534861E-7
anti-religious	6	2.7069723E-7
anti-repression	1	4.5116206E-8
anti-republican	1	4.5116206E-8
anti-resorbing	3	1.3534861E-7
anti-resorptive	3	1.3534861E-7
anti-retaliation	2	9.023241E-8
anti-retroviral	7	3.1581345E-7
anti-right	2	9.023241E-8
anti-riot	1	4.5116206E-8
anti-roll	4	1.8046482E-7
anti-rotation	1	4.5116206E-8
anti-royal	1	4.5116206E-8
anti-royalist	5	2.2558103E-7
anti-sanction	1	4.5116206E-8
anti-sarcospan	1	4.5116206E-8
anti-sassy	1	4.5116206E-8
anti-satire	1	4.5116206E-8
anti-scalping	1	4.5116206E-8
anti-scanning	1	4.5116206E-8
anti-secession	1	4.5116206E-8
anti-seizure	3	1.3534861E-7
anti-semantic	1	4.5116206E-8
anti-semite	1	4.5116206E-8
anti-semitic	1	4.5116206E-8
anti-semitism	4	1.8046482E-7
anti-sense	20	9.0232413E-7
anti-sera	3	1.3534861E-7
anti-serotonergic	1	4.5116206E-8
anti-serum	4	1.8046482E-7
anti-sex	2	9.023241E-8
anti-sheep	3	1.3534861E-7
anti-ship	3	1.3534861E-7
anti-shredding	1	4.5116206E-8
anti-sigma	1	4.5116206E-8
anti-sin	1	4.5116206E-8
anti-skid	1	4.5116206E-8
anti-slavery	3	1.3534861E-7
anti-smoking	25	1.1279052E-6
anti-smooth	1	4.5116206E-8
anti-smuggling	1	4.5116206E-8
anti-snakebite	1	4.5116206E-8
anti-snarkiness	1	4.5116206E-8
anti-snore	1	4.5116206E-8
anti-social	22	9.925566E-7
anti-socialist	1	4.5116206E-8
anti-sodomy	6	2.7069723E-7
anti-soy	4	1.8046482E-7
anti-spectrin	2	9.023241E-8
anti-sprawl	1	4.5116206E-8
anti-ss	1	4.5116206E-8
anti-stalker	1	4.5116206E-8
anti-stalking	2	9.023241E-8
anti-statism	1	4.5116206E-8
anti-statist	1	4.5116206E-8
anti-stereotype	1	4.5116206E-8
anti-streptavidin	3	1.3534861E-7
anti-submarine	2	9.023241E-8
anti-substance	1	4.5116206E-8
anti-super	1	4.5116206E-8
anti-sweatshop	2	9.023241E-8
anti-takeover	1	4.5116206E-8
anti-talent	2	9.023241E-8
anti-tank	4	1.8046482E-7
anti-tax	16	7.218593E-7
anti-teacher	1	4.5116206E-8
anti-technological	1	4.5116206E-8
anti-technology	2	9.023241E-8
anti-teen	1	4.5116206E-8
anti-telemarketing	1	4.5116206E-8
anti-terror	8	3.6092965E-7
anti-terrorism	41	1.8497644E-6
anti-terrorist	21	9.4744036E-7
anti-testimonials	1	4.5116206E-8
anti-testosterone	1	4.5116206E-8
anti-teuro	1	4.5116206E-8
anti-that	1	4.5116206E-8
anti-theft	1	4.5116206E-8
anti-theophylline	10	4.5116207E-7
anti-thrombin	1	4.5116206E-8
anti-thrombotic	1	4.5116206E-8
anti-tiramisu	4	1.8046482E-7
anti-tobacco	21	9.4744036E-7
anti-tobacco-company	1	4.5116206E-8
anti-tobacconist	1	4.5116206E-8
anti-tobacconists	7	3.1581345E-7
anti-topoisomerase	2	9.023241E-8
anti-total	3	1.3534861E-7
anti-toxin	2	9.023241E-8
anti-trade	2	9.023241E-8
anti-traditional	1	4.5116206E-8
anti-truancy	2	9.023241E-8
anti-trust	24	1.0827889E-6
anti-trypsin	3	1.3534861E-7
anti-tuberculosis	4	1.8046482E-7
anti-tuberculous	1	4.5116206E-8
anti-tubulin	2	9.023241E-8
anti-tumor	46	2.0753455E-6
anti-tumour	2	9.023241E-8
anti-type	4	1.8046482E-7
anti-tyrosinase	1	4.5116206E-8
anti-tyrosine	1	4.5116206E-8
anti-u	1	4.5116206E-8
anti-ubiquitin	2	9.023241E-8
anti-union	7	3.1581345E-7
anti-unionism	1	4.5116206E-8
anti-urban	2	9.023241E-8
anti-urban-poverty	1	4.5116206E-8
anti-v	1	4.5116206E-8
anti-vamp	2	9.023241E-8
anti-vampire	1	4.5116206E-8
anti-vengeance	1	4.5116206E-8
anti-venom	4	1.8046482E-7
anti-veto	1	4.5116206E-8
anti-vibration	1	4.5116206E-8
anti-vimentin	1	4.5116206E-8
anti-vinculin	1	4.5116206E-8
anti-violence	3	1.3534861E-7
anti-viral	4	1.8046482E-7
anti-virus	8	3.6092965E-7
anti-visible	1	4.5116206E-8
anti-vivisectionist	1	4.5116206E-8
anti-voucher	2	9.023241E-8
anti-war	32	1.4437186E-6
anti-white	5	2.2558103E-7
anti-wilderness	1	4.5116206E-8
anti-willey	1	4.5116206E-8
anti-woman	1	4.5116206E-8
anti-worker	1	4.5116206E-8
anti-wrod	2	9.023241E-8
antiabortion	4	1.8046482E-7
antiaircraft	9	4.0604587E-7
antiallergic	1	4.5116206E-8
antiamericanism	1	4.5116206E-8
antiandrogen	6	2.7069723E-7
antiandrogens	3	1.3534861E-7
antiangiogenic	1	4.5116206E-8
antianxiety	1	4.5116206E-8
antiapoptotic	11	4.962783E-7
antiarrhythmics	1	4.5116206E-8
antiarthritic	1	4.5116206E-8
antiatherogenic	1	4.5116206E-8
antibacterial	20	9.0232413E-7
antibacterials	3	1.3534861E-7
antiballistic	1	4.5116206E-8
antibeach	2	9.023241E-8
antibes	2	9.023241E-8
antibiograms	3	1.3534861E-7
antibiosis	3	1.3534861E-7
antibiotic	249	1.1233936E-5
antibiotic-antimycotic	3	1.3534861E-7
antibiotic-free	2	9.023241E-8
antibiotic-mycotic	1	4.5116206E-8
antibiotic-resistance	1	4.5116206E-8
antibiotic-resistant	9	4.0604587E-7
antibiotics	384	1.7324623E-5
antiblood	1	4.5116206E-8
antibodies	1206	5.4410146E-5
antibody	1421	6.411013E-5
antibody-amplification	1	4.5116206E-8
antibody-antigen	1	4.5116206E-8
antibody-associated	1	4.5116206E-8
antibody-based	3	1.3534861E-7
antibody-biotin	1	4.5116206E-8
antibody-bound	3	1.3534861E-7
antibody-coated	1	4.5116206E-8
antibody-coated-bead	1	4.5116206E-8
antibody-coding	1	4.5116206E-8
antibody-conjugated	1	4.5116206E-8
antibody-conjugated-beads	1	4.5116206E-8
antibody-containing	1	4.5116206E-8
antibody-directed	1	4.5116206E-8
antibody-drug	1	4.5116206E-8
antibody-enhanced	4	1.8046482E-7
antibody-enzyme	1	4.5116206E-8
antibody-matrix	2	9.023241E-8
antibody-mediated	1	4.5116206E-8
antibody-protein	1	4.5116206E-8
antibody-related	1	4.5116206E-8
antibody-stained	1	4.5116206E-8
antibody–antigen	1	4.5116206E-8
antibuddhist	1	4.5116206E-8
antic	4	1.8046482E-7
antica	4	1.8046482E-7
anticancer	37	1.6692996E-6
anticapitalism	1	4.5116206E-8
anticapsular	17	7.669755E-7
anticardiolipin	1	4.5116206E-8
anticarsia	1	4.5116206E-8
antichaos	1	4.5116206E-8
antichi	1	4.5116206E-8
antichoice	2	9.023241E-8
anticholinergic	6	2.7069723E-7
antichrist	84	3.7897614E-6
antichymotrypsin	2	9.023241E-8
antici	2	9.023241E-8
anticipate	164	7.3990577E-6
anticipated	288	1.2993468E-5
anticipates	28	1.2632538E-6
anticipatethis	1	4.5116206E-8
anticipating	81	3.6544127E-6
anticipation	126	5.684642E-6
anticipation-making	2	9.023241E-8
anticipations	2	9.023241E-8
anticipatory	7	3.1581345E-7
anticlerical	2	9.023241E-8
anticlericalism	1	4.5116206E-8
anticlimactic	9	4.0604587E-7
anticlimax	11	4.962783E-7
antico	1	4.5116206E-8
anticoagulant	13	5.865107E-7
anticoagulant-treated	2	9.023241E-8
anticoagulated	2	9.023241E-8
anticoagulation	6	2.7069723E-7
anticodon	4	1.8046482E-7
anticodon-codon	1	4.5116206E-8
anticollagen	9	4.0604587E-7
anticollegio	1	4.5116206E-8
anticolonial	3	1.3534861E-7
anticommunist	3	1.3534861E-7
anticompetitive	3	1.3534861E-7
anticomplementary	1	4.5116206E-8
anticonvulsant	13	5.865107E-7
anticonvulsants	7	3.1581345E-7
anticorrelated	2	9.023241E-8
anticorrelation	3	1.3534861E-7
anticorrelations	3	1.3534861E-7
anticorruption	1	4.5116206E-8
anticrime	1	4.5116206E-8
antics	59	2.6618561E-6
anticyclic	1	4.5116206E-8
anticytokine	1	4.5116206E-8
antideficiency	1	4.5116206E-8
antidepressant	34	1.533951E-6
antidepressants	23	1.0376727E-6
antidepressents	1	4.5116206E-8
antidepressive	1	4.5116206E-8
antidevelopment	1	4.5116206E-8
antidiabetic	4	1.8046482E-7
antidigoxigenin	1	4.5116206E-8
antidisestablishmentarians	2	9.023241E-8
antidiuretic	3	1.3534861E-7
antidody	1	4.5116206E-8
antidogmatic	1	4.5116206E-8
antidopaminergic	1	4.5116206E-8
antidote	48	2.1655778E-6
antidotes	4	1.8046482E-7
antidrug	2	9.023241E-8
antiedematogenic	1	4.5116206E-8
antiekmarkt	2	9.023241E-8
antiemetic	1	4.5116206E-8
antiemetics	2	9.023241E-8
antienviron	1	4.5116206E-8
antienvironment	1	4.5116206E-8
antiepileptic	1	4.5116206E-8
antiepileptics	1	4.5116206E-8
antierosive	4	1.8046482E-7
antiestrogenic	2	9.023241E-8
antiestrogens	5	2.2558103E-7
antietam	4	1.8046482E-7
antiethical	2	9.023241E-8
antifade	8	3.6092965E-7
antiferromagnet	6	2.7069723E-7
antiferromagnetic	2	9.023241E-8
antifibrogenic	1	4.5116206E-8
antifibrotic	2	9.023241E-8
antifolates	1	4.5116206E-8
antifraud	1	4.5116206E-8
antifreeze	9	4.0604587E-7
antifreeze-like	1	4.5116206E-8
antifungal	11	4.962783E-7
antifungals	4	1.8046482E-7
antiga	4	1.8046482E-7
antigame	1	4.5116206E-8
antiganglioside	1	4.5116206E-8
antigay	2	9.023241E-8
antigen	417	1.8813458E-5
antigen-antibody	8	3.6092965E-7
antigen-binding	1	4.5116206E-8
antigen-challenged	1	4.5116206E-8
antigen-coated	2	9.023241E-8
antigen-containing	1	4.5116206E-8
antigen-dependent	1	4.5116206E-8
antigen-depleted	1	4.5116206E-8
antigen-driven	3	1.3534861E-7
antigen-enriched	1	4.5116206E-8
antigen-free	1	4.5116206E-8
antigen-induced	18	8.1209174E-7
antigen-presentation	1	4.5116206E-8
antigen-presenting	19	8.572079E-7
antigen-processing	1	4.5116206E-8
antigen-receptor	2	9.023241E-8
antigen-retrieval	1	4.5116206E-8
antigen-selected	1	4.5116206E-8
antigen-specific	33	1.4888349E-6
antigen-unmasking	1	4.5116206E-8
antigenic	57	2.5716238E-6
antigenically	1	4.5116206E-8
antigenicity	4	1.8046482E-7
antigenome	1	4.5116206E-8
antigenomic	3	1.3534861E-7
antigens	156	7.0381284E-6
antiglobalist	1	4.5116206E-8
antiglucocorticoid	1	4.5116206E-8
antiglur	1	4.5116206E-8
antigoat	1	4.5116206E-8
antigone	3	1.3534861E-7
antigonus	1	4.5116206E-8
antigovernment	2	9.023241E-8
antigravity	5	2.2558103E-7
antigua	21	9.4744036E-7
antigun	1	4.5116206E-8
antiguo	1	4.5116206E-8
antiguos	1	4.5116206E-8
antihaemorrhagic	1	4.5116206E-8
antihepatocarcinogen	1	4.5116206E-8
antihero	3	1.3534861E-7
antihistamine	6	2.7069723E-7
antihistamines	10	4.5116207E-7
antihistimine	1	4.5116206E-8
antihuman	8	3.6092965E-7
antihydrogen	1	4.5116206E-8
antihyperlipidemic	2	9.023241E-8
antihypertensive	29	1.30837E-6
antihypertensives	2	9.023241E-8
antiinfectives	1	4.5116206E-8
antiinflammatory	11	4.962783E-7
antik	1	4.5116206E-8
antikenmuseum	1	4.5116206E-8
antilabor	1	4.5116206E-8
antilipoxigenase	1	4.5116206E-8
antillean	2	9.023241E-8
antilles	27	1.2181375E-6
antilock	17	7.669755E-7
antilog	2	9.023241E-8
antilogarithm-transformed	1	4.5116206E-8
antimacassar	1	4.5116206E-8
antimalaria	2	9.023241E-8
antimalarial	12	5.4139446E-7
antimalarials	6	2.7069723E-7
antimatter	15	6.767431E-7
antimetabolic	1	4.5116206E-8
antimetric	2	9.023241E-8
antimicrobial	43	1.939997E-6
antimicrobials	5	2.2558103E-7
antimissile	4	1.8046482E-7
antimitotic	10	4.5116207E-7
antimitotics	4	1.8046482E-7
antimonial	1	4.5116206E-8
antimonos	1	4.5116206E-8
antimony	5	2.2558103E-7
antimorphic	1	4.5116206E-8
antimouse	8	3.6092965E-7
antimurine	1	4.5116206E-8
antimuscarinic	11	4.962783E-7
antimutator	5	2.2558103E-7
antimycin	1	4.5116206E-8
antimycotic	7	3.1581345E-7
antimyosin	1	4.5116206E-8
antimyotoxic	1	4.5116206E-8
antin	2	9.023241E-8
antinatalist	2	9.023241E-8
antineoplastic	5	2.2558103E-7
antineutrinos	1	4.5116206E-8
antinociception	2	9.023241E-8
antinociceptive	4	1.8046482E-7
antinomian	1	4.5116206E-8
antinomianism	2	9.023241E-8
antinor	1	4.5116206E-8
antinori	4	1.8046482E-7
antinuclear	4	1.8046482E-7
antioch	3	1.3534861E-7
antiochus	1	4.5116206E-8
antioco	1	4.5116206E-8
antioestrogen	1	4.5116206E-8
antiopa	1	4.5116206E-8
antioxidant	80	3.6092965E-6
antioxidant-free	1	4.5116206E-8
antioxidants	59	2.6618561E-6
antioxidative	2	9.023241E-8
antipain	1	4.5116206E-8
antiparallel	11	4.962783E-7
antiparasitic	5	2.2558103E-7
antiparietal	1	4.5116206E-8
antiparkinson	2	9.023241E-8
antiparkinsonian	3	1.3534861E-7
antiparos	7	3.1581345E-7
antiparticles	1	4.5116206E-8
antipasta	1	4.5116206E-8
antipasti	1	4.5116206E-8
antipathies	1	4.5116206E-8
antipathy	18	8.1209174E-7
antipeptide	1	4.5116206E-8
antiperinuclear	1	4.5116206E-8
antiperiplanar	3	1.3534861E-7
antipersonnel	1	4.5116206E-8
antiperspirant	1	4.5116206E-8
antiphase	1	4.5116206E-8
antiphlogistic	1	4.5116206E-8
antipholi	1	4.5116206E-8
antipholus	6	2.7069723E-7
antipholuses	1	4.5116206E-8
antiphospholipase	2	9.023241E-8
antiphospholipid	2	9.023241E-8
antiphosphotyrosine	1	4.5116206E-8
antipiracy	1	4.5116206E-8
antiplasmodial	1	4.5116206E-8
antiplatelet	4	1.8046482E-7
antipneumococcal	1	4.5116206E-8
antipodean	18	8.1209174E-7
antipodeans	4	1.8046482E-7
antipollution	3	1.3534861E-7
antipolyadp-ribose	1	4.5116206E-8
antiport	2	9.023241E-8
antiporter	3	1.3534861E-7
antipoverty	4	1.8046482E-7
antiprejudice	1	4.5116206E-8
antiprivatization	1	4.5116206E-8
antiprogesterone	1	4.5116206E-8
antiprogestrone	1	4.5116206E-8
antiproliferative	9	4.0604587E-7
antiproteases	1	4.5116206E-8
antiproteoglycan	1	4.5116206E-8
antiproteolytic	1	4.5116206E-8
antipruritic	1	4.5116206E-8
antipsychotic	16	7.218593E-7
antipsychotics	5	2.2558103E-7
antipyretic	1	4.5116206E-8
antipyretics	1	4.5116206E-8
antiquaille	1	4.5116206E-8
antiquaires	1	4.5116206E-8
antiquarian	15	6.767431E-7
antiquarians	2	9.023241E-8
antiquaris	3	1.3534861E-7
antiquated	40	1.8046483E-6
antiquatedness	1	4.5116206E-8
antique	165	7.444174E-6
antique-car-collecting	1	4.5116206E-8
antique-furnished	1	4.5116206E-8
antique-ish	2	9.023241E-8
antique-store	2	9.023241E-8
antiqued	1	4.5116206E-8
antiquedress	2	9.023241E-8
antiques	190	8.572079E-6
antiques-collector	1	4.5116206E-8
antiques-column	2	9.023241E-8
antiques-column-bw	1	4.5116206E-8
antiques-hunter	1	4.5116206E-8
antiques-lovers	1	4.5116206E-8
antiquey	1	4.5116206E-8
antiquing	1	4.5116206E-8
antiquities	36	1.6241835E-6
antiquity	39	1.7595321E-6
antiquus	1	4.5116206E-8
antirabbit	4	1.8046482E-7
antiracism	1	4.5116206E-8
antiregulatory	1	4.5116206E-8
antireligious	3	1.3534861E-7
antirepressor	1	4.5116206E-8
antirepressors	1	4.5116206E-8
antiresorptive	3	1.3534861E-7
antiretroviral	132	5.9553395E-6
antiretroviral-experienced	10	4.5116207E-7
antiretroviral-naïve	12	5.4139446E-7
antiretroviral-treated	1	4.5116206E-8
antiretrovirals	12	5.4139446E-7
antirheu	1	4.5116206E-8
antirheumatic	12	5.4139446E-7
antirrhinum	1	4.5116206E-8
antis	2	9.023241E-8
antiscian	1	4.5116206E-8
antiscientism	2	9.023241E-8
antisedition	1	4.5116206E-8
antisemitic	1	4.5116206E-8
antisense	280	1.2632538E-5
antisense-expressing	2	9.023241E-8
antisense-induced	1	4.5116206E-8
antisense-infected	3	1.3534861E-7
antisense-mediated	3	1.3534861E-7
antisense-orientation	1	4.5116206E-8
antisense-strand	2	9.023241E-8
antisense-transfected	4	1.8046482E-7
antisepsis	1	4.5116206E-8
antiseptic	18	8.1209174E-7
antiseptically	2	9.023241E-8
antiseptics	1	4.5116206E-8
antisera	46	2.0753455E-6
antiserum	68	3.067902E-6
antises	1	4.5116206E-8
antisex	1	4.5116206E-8
antisexist	2	9.023241E-8
antislavery	1	4.5116206E-8
antismog	2	9.023241E-8
antismoking	2	9.023241E-8
antisociable	1	4.5116206E-8
antisocial	24	1.0827889E-6
antistatism	1	4.5116206E-8
antistáseos	2	9.023241E-8
antisupporters	1	4.5116206E-8
antitank	6	2.7069723E-7
antitax	4	1.8046482E-7
antitermination	2	9.023241E-8
antiterrorism	12	5.4139446E-7
antiterrorist	2	9.023241E-8
antithesis	28	1.2632538E-6
antithetical	12	5.4139446E-7
antithetically	1	4.5116206E-8
antithrombin	7	3.1581345E-7
antithrombotic	7	3.1581345E-7
antithyroid	5	2.2558103E-7
antitobacco	1	4.5116206E-8
antitrade	1	4.5116206E-8
antitrust	258	1.16399815E-5
antitrypsin	3	1.3534861E-7
antituberculous	1	4.5116206E-8
antitumor	21	9.4744036E-7
antitumoral	1	4.5116206E-8
antitumour	1	4.5116206E-8
antitussives	1	4.5116206E-8
antivenin	2	9.023241E-8
antivenom	1	4.5116206E-8
antiviral	78	3.5190642E-6
antiviral-resistant	1	4.5116206E-8
antivirals	6	2.7069723E-7
antivirus	2	9.023241E-8
antiwar	17	7.669755E-7
antiwoman	1	4.5116206E-8
antizyme	4	1.8046482E-7
anti­democratic	1	4.5116206E-8
anti–cleaved	1	4.5116206E-8
antje	1	4.5116206E-8
antler	6	2.7069723E-7
antler-topped	2	9.023241E-8
antlered	1	4.5116206E-8
antlers	15	6.767431E-7
antley	2	9.023241E-8
antognini	2	9.023241E-8
antoine	24	1.0827889E-6
antoinette	30	1.3534863E-6
anton	19	8.572079E-7
antona	1	4.5116206E-8
antonacci	1	4.5116206E-8
antone	2	9.023241E-8
antonelli	3	1.3534861E-7
antonelliana	1	4.5116206E-8
antonello	2	9.023241E-8
antoni	26	1.1730214E-6
antonia	20	9.0232413E-7
antonie	1	4.5116206E-8
antoniesbreestraat	2	9.023241E-8
antonin	25	1.1279052E-6
antonine	2	9.023241E-8
antoninus	1	4.5116206E-8
antonio	378	1.7053926E-5
antonio-based	1	4.5116206E-8
antonioni	1	4.5116206E-8
antonius	1	4.5116206E-8
antonovich	5	2.2558103E-7
antonucci	1	4.5116206E-8
antony	26	1.1730214E-6
antonym	3	1.3534861E-7
antonyms	4	1.8046482E-7
antoní	1	4.5116206E-8
antopocerus	1	4.5116206E-8
antosh	2	9.023241E-8
antowain	4	1.8046482E-7
antp	8	3.6092965E-7
antproof	1	4.5116206E-8
antral	18	8.1209174E-7
antrim	1	4.5116206E-8
antron	1	4.5116206E-8
antropología	1	4.5116206E-8
antrum	1	4.5116206E-8
ants	79	3.5641804E-6
antsy	14	6.316269E-7
antuna	1	4.5116206E-8
antunes	1	4.5116206E-8
antwaan	1	4.5116206E-8
antwerp	7	3.1581345E-7
antwoine	1	4.5116206E-8
antz	6	2.7069723E-7
antónia	1	4.5116206E-8
antónio	17	7.669755E-7
antônio	1	4.5116206E-8
anu	5	2.2558103E-7
anubis	2	9.023241E-8
anuff	5	2.2558103E-7
anuk	1	4.5116206E-8
anumber	2	9.023241E-8
anunciada	1	4.5116206E-8
anup	1	4.5116206E-8
anuradha	1	4.5116206E-8
anurans	1	4.5116206E-8
anuria	1	4.5116206E-8
anus	10	4.5116207E-7
anuses	2	9.023241E-8
anusol	1	4.5116206E-8
anv	1	4.5116206E-8
anvers	1	4.5116206E-8
anvil	25	1.1279052E-6
anvil-heavy	1	4.5116206E-8
anvilicious	6	2.7069723E-7
anviliscious	1	4.5116206E-8
anvillery	1	4.5116206E-8
anvillicious	2	9.023241E-8
anvilling	1	4.5116206E-8
anvilly	8	3.6092965E-7
anvils	14	6.316269E-7
anwar	23	1.0376727E-6
anway	4	1.8046482E-7
anwer	1	4.5116206E-8
anwering	1	4.5116206E-8
anwr	11	4.962783E-7
anx	3	1.3534861E-7
anxieties	51	2.3009266E-6
anxiety	353	1.5926022E-5
anxiety-booster	1	4.5116206E-8
anxiety-filled	1	4.5116206E-8
anxiety-free	1	4.5116206E-8
anxiety-inducing	1	4.5116206E-8
anxiety-making	2	9.023241E-8
anxiety-provoking	1	4.5116206E-8
anxiety-reducing	1	4.5116206E-8
anxiety-reliever	1	4.5116206E-8
anxiety-ridden	3	1.3534861E-7
anxiolytic	2	9.023241E-8
anxiolytics	3	1.3534861E-7
anxious	239	1.0782774E-5
anxiously	29	1.30837E-6
any	21963	9.908873E-4
any-angled	1	4.5116206E-8
any-kind-of-adjective	1	4.5116206E-8
any-where	1	4.5116206E-8
anya	561	2.5310192E-5
anya-centric	1	4.5116206E-8
anya-slaggage	1	4.5116206E-8
anyaka	1	4.5116206E-8
anyang	3	1.3534861E-7
anyangiles	1	4.5116206E-8
anyanka	6	2.7069723E-7
anyankah	1	4.5116206E-8
anyar	1	4.5116206E-8
anyas	3	1.3534861E-7
anybody	1435	6.4741755E-5
anychanges	1	4.5116206E-8
anyday	3	1.3534861E-7
anyexisting	1	4.5116206E-8
anyhitng	2	9.023241E-8
anyhoo	6	2.7069723E-7
anyhow	165	7.444174E-6
anymooooooore	1	4.5116206E-8
anymore	1482	6.6862216E-5
anyohe	1	4.5116206E-8
anyone	4119	1.8583366E-4
anyone-black	1	4.5116206E-8
anyones	1	4.5116206E-8
anyother	1	4.5116206E-8
anyplace	28	1.2632538E-6
anysing	1	4.5116206E-8
anystandard	1	4.5116206E-8
anyt	1	4.5116206E-8
anyth	3	1.3534861E-7
anythign	1	4.5116206E-8
anythin	1	4.5116206E-8
anything	7791	3.5150038E-4
anything-as	1	4.5116206E-8
anything-goes	5	2.2558103E-7
anythings	1	4.5116206E-8
anythng	1	4.5116206E-8
anythoing	1	4.5116206E-8
anytime	252	1.1369284E-5
anyting	1	4.5116206E-8
anytone	1	4.5116206E-8
anytown	2	9.023241E-8
anyutility	2	9.023241E-8
anywaaan	1	4.5116206E-8
anyway	3493	1.5759091E-4
anyways	73	3.2934831E-6
anywhere	939	4.2364118E-5
anywho	1	4.5116206E-8
anywhoo	2	9.023241E-8
anzac	2	9.023241E-8
anzacs	1	4.5116206E-8
anzaisho	1	4.5116206E-8
anzak	1	4.5116206E-8
anzio	1	4.5116206E-8
an­cient	1	4.5116206E-8
anís	5	2.2558103E-7
anógia	4	1.8046482E-7
anópoli	1	4.5116206E-8
ao	17	7.669755E-7
aoa	3	1.3534861E-7
aoac	3	1.3534861E-7
aoanet	1	4.5116206E-8
aobut	2	9.023241E-8
aod	4	1.8046482E-7
aof	1	4.5116206E-8
aoh	1	4.5116206E-8
aoi	1	4.5116206E-8
aoife	1	4.5116206E-8
aoki	3	1.3534861E-7
aol	734	3.3115295E-5
aol-ads	4	1.8046482E-7
aol-albrecht	4	1.8046482E-7
aol-albrect	1	4.5116206E-8
aol-case	2	9.023241E-8
aol-earnings	4	1.8046482E-7
aol-kellner	1	4.5116206E-8
aol-merge-assess	1	4.5116206E-8
aol-microsoft-sony-clear	2	9.023241E-8
aol-moore	2	9.023241E-8
aol-next	3	1.3534861E-7
aol-the-corporation	1	4.5116206E-8
aol-time	13	5.865107E-7
aol-time-moore	3	1.3534861E-7
aol-time-scene	2	9.023241E-8
aol-turmoil	3	1.3534861E-7
aol-type	1	4.5116206E-8
aols	1	4.5116206E-8
aoltw	3	1.3534861E-7
aon	19	8.572079E-7
aoolw	1	4.5116206E-8
aopa	1	4.5116206E-8
aor	12	5.4139446E-7
aord	5	2.2558103E-7
aordable	2	9.023241E-8
aorded	1	4.5116206E-8
aords	3	1.3534861E-7
aors	1	4.5116206E-8
aort	1	4.5116206E-8
aorta	43	1.939997E-6
aortas	15	6.767431E-7
aortic	49	2.2106942E-6
aorticbanding	1	4.5116206E-8
aortocaval	3	1.3534861E-7
aoshima	2	9.023241E-8
aosta	2	9.023241E-8
aot	1	4.5116206E-8
aotc	1	4.5116206E-8
aotm	1	4.5116206E-8
aotus	1	4.5116206E-8
aoua	1	4.5116206E-8
aoud	1	4.5116206E-8
aout	2	9.023241E-8
aovca	1	4.5116206E-8
aow	1	4.5116206E-8
aoyama	2	9.023241E-8
août	1	4.5116206E-8
ap	442	1.9941363E-5
ap-dna	1	4.5116206E-8
ap-endonucleases	1	4.5116206E-8
ap-induced	2	9.023241E-8
ap-inhibition	1	4.5116206E-8
ap-pcr	1	4.5116206E-8
ap-ph	4	1.8046482E-7
ap-sensitive	2	9.023241E-8
ap-site	2	9.023241E-8
ap-treated	1	4.5116206E-8
apa	36	1.6241835E-6
apace	17	7.669755E-7
apache	193	8.707428E-6
apache-ii	3	1.3534861E-7
apacheii	1	4.5116206E-8
apaches	24	1.0827889E-6
apachú	1	4.5116206E-8
apaf	15	6.767431E-7
apah	1	4.5116206E-8
apai	6	2.7069723E-7
apair	1	4.5116206E-8
apak	1	4.5116206E-8
apalachi	1	4.5116206E-8
apalled	2	9.023241E-8
apalling	1	4.5116206E-8
apalrc	2	9.023241E-8
apaprently	2	9.023241E-8
aparent	1	4.5116206E-8
aparicio	5	2.2558103E-7
apariciones	1	4.5116206E-8
aparición	1	4.5116206E-8
apart	912	4.114598E-5
apart-about	1	4.5116206E-8
apartheid	40	1.8046483E-6
apartheid-era	6	2.7069723E-7
apartheid-like	1	4.5116206E-8
aparthotel	1	4.5116206E-8
apartment	1157	5.219945E-5
apartment-block	1	4.5116206E-8
apartment-finding	1	4.5116206E-8
apartment-haver	1	4.5116206E-8
apartment-mate	1	4.5116206E-8
apartment-private	1	4.5116206E-8
apartmented	2	9.023241E-8
apartmenti	1	4.5116206E-8
apartmentma	1	4.5116206E-8
apartments	277	1.2497189E-5
apartness	2	9.023241E-8
apart­ments	1	4.5116206E-8
apathetic	16	7.218593E-7
apathy	49	2.2106942E-6
apattern	1	4.5116206E-8
apb	3	1.3534861E-7
apba	58	2.61674E-6
apc	66	2.9776697E-6
apc-resistant	1	4.5116206E-8
apcs	21	9.4744036E-7
apd	2	9.023241E-8
ape	100	4.511621E-6
ape-man	1	4.5116206E-8
apear	1	4.5116206E-8
apec	3	1.3534861E-7
aped	2	9.023241E-8
apeiis	1	4.5116206E-8
apelike	2	9.023241E-8
apellation	1	4.5116206E-8
apennine	2	9.023241E-8
apennines	8	3.6092965E-7
aper	1	4.5116206E-8
apercu	1	4.5116206E-8
apercus	1	4.5116206E-8
apergillus	1	4.5116206E-8
aperiodic	10	4.5116207E-7
aperiodicity	2	9.023241E-8
aperitif	7	3.1581345E-7
aperitifs	2	9.023241E-8
apermaking	1	4.5116206E-8
aperta	4	1.8046482E-7
aperteneth	1	4.5116206E-8
aperture	7	3.1581345E-7
apertures	2	9.023241E-8
aperçu	1	4.5116206E-8
aperçus	3	1.3534861E-7
apes	79	3.5641804E-6
apeshit	5	2.2558103E-7
apet	1	4.5116206E-8
apetite	1	4.5116206E-8
apex	61	2.7520887E-6
apf	10	4.5116207E-7
apgar	3	1.3534861E-7
apgars	1	4.5116206E-8
aph	14	6.316269E-7
apha	7	3.1581345E-7
aphaease	1	4.5116206E-8
aphaia	1	4.5116206E-8
aphasia	6	2.7069723E-7
aphasic	1	4.5116206E-8
aphasics	1	4.5116206E-8
apheresis	10	4.5116207E-7
aphetic	1	4.5116206E-8
aphid	19	8.572079E-7
aphidicola	3	1.3534861E-7
aphidoidea	1	4.5116206E-8
aphids	14	6.316269E-7
aphis	49	2.2106942E-6
apholate	2	9.023241E-8
aphorism	11	4.962783E-7
aphorisms	6	2.7069723E-7
aphorist	1	4.5116206E-8
aphra	1	4.5116206E-8
aphrenia	2	9.023241E-8
aphrodesiac	1	4.5116206E-8
aphrodisac	1	4.5116206E-8
aphrodisiac	17	7.669755E-7
aphrodisiacal	1	4.5116206E-8
aphrodisiacs	2	9.023241E-8
aphrodisias	1	4.5116206E-8
aphrodite	11	4.962783E-7
aphronesia	2	9.023241E-8
aphthong	1	4.5116206E-8
api	27	1.2181375E-6
apiaceae	2	9.023241E-8
apical	75	3.3837155E-6
apical-basal	1	4.5116206E-8
apically	4	1.8046482E-7
apicomplexa	1	4.5116206E-8
apicomplexan	3	1.3534861E-7
apicomplexans	2	9.023241E-8
apiculture	1	4.5116206E-8
apiece	44	1.9851132E-6
apigenin	1	4.5116206E-8
apilim	1	4.5116206E-8
apin	2	9.023241E-8
aping	6	2.7069723E-7
apired	1	4.5116206E-8
apis	12	5.4139446E-7
apita	1	4.5116206E-8
apiñar	1	4.5116206E-8
apl	3	1.3534861E-7
aplace	1	4.5116206E-8
aplasia	11	4.962783E-7
aplastic	6	2.7069723E-7
aplenty	9	4.0604587E-7
apley	1	4.5116206E-8
apliplations	1	4.5116206E-8
aplogise	1	4.5116206E-8
aplomb	18	8.1209174E-7
aplp	1	4.5116206E-8
aplysia	8	3.6092965E-7
apma	1	4.5116206E-8
apn	57	2.5716238E-6
apn-containing	1	4.5116206E-8
apn-sized	1	4.5116206E-8
apnea	6	2.7069723E-7
apnea-hypopnea	1	4.5116206E-8
apneas	1	4.5116206E-8
apnoea	1	4.5116206E-8
apns	4	1.8046482E-7
apnsa-designate	1	4.5116206E-8
apo	16	7.218593E-7
apo-titin	1	4.5116206E-8
apo-transferrin	1	4.5116206E-8
apoa	13	5.865107E-7
apoaiv	2	9.023241E-8
apoalert	1	4.5116206E-8
apob	6	2.7069723E-7
apobec	19	8.572079E-7
apoc	8	3.6092965E-7
apocaclypse	1	4.5116206E-8
apocaclyspe	1	4.5116206E-8
apocali	3	1.3534861E-7
apocalii	1	4.5116206E-8
apocalpyse	2	9.023241E-8
apocalyi	1	4.5116206E-8
apocalypse	202	9.113473E-6
apocalypse-awaiters	1	4.5116206E-8
apocalypse-causing	2	9.023241E-8
apocalypse-defender	1	4.5116206E-8
apocalypse-nowish	1	4.5116206E-8
apocalypse-tipping	1	4.5116206E-8
apocalypses	11	4.962783E-7
apocalypsey	1	4.5116206E-8
apocalypsi	2	9.023241E-8
apocalypsim	1	4.5116206E-8
apocalypso	4	1.8046482E-7
apocalypsos	2	9.023241E-8
apocalypsy	2	9.023241E-8
apocalyptae	2	9.023241E-8
apocalyptarian	1	4.5116206E-8
apocalyptarians	1	4.5116206E-8
apocalypti	3	1.3534861E-7
apocalyptic	67	3.022786E-6
apocalyptically	1	4.5116206E-8
apocalypting	1	4.5116206E-8
apocalyses	1	4.5116206E-8
apocalysi	2	9.023241E-8
apocalysis	1	4.5116206E-8
apocawhatsis	1	4.5116206E-8
apochryphal	1	4.5116206E-8
apoclaypse	2	9.023241E-8
apocofashionlypse	1	4.5116206E-8
apocol	1	4.5116206E-8
apocolaypse	1	4.5116206E-8
apocolypse	8	3.6092965E-7
apocolypses	1	4.5116206E-8
apocolypsii	2	9.023241E-8
apocolyptic	2	9.023241E-8
apocolyptimus	2	9.023241E-8
apocopated	1	4.5116206E-8
apocrine	1	4.5116206E-8
apocrypha	5	2.2558103E-7
apocryphal	14	6.316269E-7
apod	3	1.3534861E-7
apodictically	1	4.5116206E-8
apodosis	1	4.5116206E-8
apoe	31	1.3986024E-6
apogee	7	3.1581345E-7
apolar	3	1.3534861E-7
apolcalyptic	1	4.5116206E-8
apolipoprotein	34	1.533951E-6
apolipoproteins	6	2.7069723E-7
apolitcal	1	4.5116206E-8
apolitical	18	8.1209174E-7
apollinaire	4	1.8046482E-7
apollinare	2	9.023241E-8
apollinaris	2	9.023241E-8
apollo	145	6.54185E-6
apollo-fucked	1	4.5116206E-8
apollo-like	1	4.5116206E-8
apollodataadapteri	1	4.5116206E-8
apollon	6	2.7069723E-7
apollonia	2	9.023241E-8
apollonian	11	4.962783E-7
apollonians	1	4.5116206E-8
apollyon	1	4.5116206E-8
apologetic	34	1.533951E-6
apologetically	7	3.1581345E-7
apologetics	2	9.023241E-8
apologia	11	4.962783E-7
apologies	114	5.1432476E-6
apologise	23	1.0376727E-6
apologised	6	2.7069723E-7
apologist	18	8.1209174E-7
apologists	16	7.218593E-7
apologize	235	1.0602309E-5
apologized	105	4.737202E-6
apologizes	29	1.30837E-6
apologizing	52	2.3460427E-6
apology	273	1.2316725E-5
apology-strewn	2	9.023241E-8
apomorphine	1	4.5116206E-8
apophyseal	3	1.3534861E-7
apoplast	3	1.3534861E-7
apoplastic	8	3.6092965E-7
apoplasts	1	4.5116206E-8
apoplectic	11	4.962783E-7
apoplexy	6	2.7069723E-7
apoprotein	4	1.8046482E-7
apoproteins	2	9.023241E-8
apoptag	4	1.8046482E-7
apoptogenic	3	1.3534861E-7
apoptose	2	9.023241E-8
apoptosis	890	4.0153423E-5
apoptosis-associated	2	9.023241E-8
apoptosis-derived	1	4.5116206E-8
apoptosis-inducing	5	2.2558103E-7
apoptosis-regulating	2	9.023241E-8
apoptosis-regulatory	1	4.5116206E-8
apoptosis-related	4	1.8046482E-7
apoptosis-resistance	1	4.5116206E-8
apoptosisby	1	4.5116206E-8
apoptosisin	2	9.023241E-8
apoptosisis	1	4.5116206E-8
apoptosisof	1	4.5116206E-8
apoptotic	260	1.1730213E-5
apoptotic-inducing	1	4.5116206E-8
apoptotic-like	2	9.023241E-8
apoptotic-positive	1	4.5116206E-8
apoptotic-signaling	1	4.5116206E-8
apoptotically	1	4.5116206E-8
apoptoticcells	1	4.5116206E-8
apoptoticmyocytes	1	4.5116206E-8
apoptygma	2	9.023241E-8
aposelene	2	9.023241E-8
aposelenium	2	9.023241E-8
apositive	1	4.5116206E-8
apossibly	1	4.5116206E-8
aposta	2	9.023241E-8
apostain	2	9.023241E-8
apostasies	1	4.5116206E-8
apostasy	14	6.316269E-7
apostate	10	4.5116207E-7
apostates	3	1.3534861E-7
apostil	1	4.5116206E-8
apostle	49	2.2106942E-6
apostles	30	1.3534863E-6
apostolate	1	4.5116206E-8
apostolic	6	2.7069723E-7
apostolical	2	9.023241E-8
apostoloi	1	4.5116206E-8
apostrophe	23	1.0376727E-6
apostrophes	11	4.962783E-7
apotag	1	4.5116206E-8
apothecaries	3	1.3534861E-7
apothecary	4	1.8046482E-7
apothegm	1	4.5116206E-8
apotheosis	21	9.4744036E-7
apoyo	1	4.5116206E-8
app	106	4.782318E-6
app-fd	1	4.5116206E-8
app-like	3	1.3534861E-7
appa	1	4.5116206E-8
appalachia	10	4.5116207E-7
appalachian	46	2.0753455E-6
appalachians	9	4.0604587E-7
appaling	1	4.5116206E-8
appall	7	3.1581345E-7
appall-worthy	1	4.5116206E-8
appalled	129	5.8199907E-6
appalling	95	4.2860397E-6
appallingly	13	5.865107E-7
appalls	6	2.7069723E-7
appaloosa	1	4.5116206E-8
appaloosas	1	4.5116206E-8
appalred	3	1.3534861E-7
appar	1	4.5116206E-8
apparantly	3	1.3534861E-7
apparatchik	12	5.4139446E-7
apparatchiks	4	1.8046482E-7
apparate	1	4.5116206E-8
apparatii	1	4.5116206E-8
apparatus	185	8.346498E-6
apparatuses	3	1.3534861E-7
appareance	1	4.5116206E-8
apparel	404	1.8226947E-5
apparel-consumption	1	4.5116206E-8
apparel-maker	5	2.2558103E-7
apparel-makers	16	7.218593E-7
apparel-making	1	4.5116206E-8
apparent	1032	4.6559926E-5
apparentl	1	4.5116206E-8
apparentlly	1	4.5116206E-8
apparently	2236	1.00879835E-4
apparently-dissipating	1	4.5116206E-8
apparition	22	9.925566E-7
apparitional	1	4.5116206E-8
apparitions	16	7.218593E-7
apparrent	1	4.5116206E-8
appartamenti	1	4.5116206E-8
appartements	1	4.5116206E-8
appartment	1	4.5116206E-8
apparuit	1	4.5116206E-8
appeaerance	1	4.5116206E-8
appeal	969	4.3717606E-5
appealed	100	4.511621E-6
appealing	328	1.4798115E-5
appealingly	10	4.5116207E-7
appealling	2	9.023241E-8
appeals	446	2.0121828E-5
appeals-court	1	4.5116206E-8
appear	2009	9.063846E-5
appear-at	1	4.5116206E-8
appearance	947	4.272505E-5
appearance-obsessed	1	4.5116206E-8
appearances	216	9.7451E-6
appearance–	1	4.5116206E-8
appearance–reality	2	9.023241E-8
appeard	2	9.023241E-8
appeared	1518	6.84864E-5
appearence	4	1.8046482E-7
appearences	4	1.8046482E-7
appearing	289	1.3038583E-5
appears	2116	9.546589E-5
appease	41	1.8497644E-6
appeased	9	4.0604587E-7
appeasement	20	9.0232413E-7
appeasers	1	4.5116206E-8
appeases	4	1.8046482E-7
appeasing	14	6.316269E-7
appel	2	9.023241E-8
appelation	2	9.023241E-8
appelbaum	3	1.3534861E-7
appelbome	1	4.5116206E-8
appelfeld	3	1.3534861E-7
appellants	3	1.3534861E-7
appellate	41	1.8497644E-6
appellation	23	1.0376727E-6
appellations	8	3.6092965E-7
appellatives	1	4.5116206E-8
appelle	1	4.5116206E-8
appellees	3	1.3534861E-7
append	9	4.0604587E-7
appendage	10	4.5116207E-7
appendages	19	8.572079E-7
appendectomies	1	4.5116206E-8
appendectomy	2	9.023241E-8
appended	34	1.533951E-6
appendices	25	1.1279052E-6
appendicitis	8	3.6092965E-7
appendiculatum	3	1.3534861E-7
appending	8	3.6092965E-7
appendix	439	1.9806015E-5
appendixes	9	4.0604587E-7
appendixlists	1	4.5116206E-8
appends	2	9.023241E-8
appenines	1	4.5116206E-8
appennine	1	4.5116206E-8
appens	1	4.5116206E-8
appenzell	1	4.5116206E-8
apperances	1	4.5116206E-8
apperantly	1	4.5116206E-8
apperson	1	4.5116206E-8
appertain	1	4.5116206E-8
appetentem	1	4.5116206E-8
appetit	5	2.2558103E-7
appetite	184	8.301382E-6
appetite-stimulating	1	4.5116206E-8
appetites	37	1.6692996E-6
appetizer	17	7.669755E-7
appetizers	17	7.669755E-7
appetizing	14	6.316269E-7
appetizingly	1	4.5116206E-8
appia	3	1.3534861E-7
appiah	14	6.316269E-7
appian	2	9.023241E-8
appication	1	4.5116206E-8
appier	23	1.0376727E-6
appl	3	1.3534861E-7
applachian	3	1.3534861E-7
applaud	88	3.9702263E-6
applauded	74	3.3385993E-6
applauding	21	9.4744036E-7
applauds	53	2.391159E-6
applause	91	4.1055746E-6
applause-getters	1	4.5116206E-8
apple	519	2.3415312E-5
apple-biting	1	4.5116206E-8
apple-branded	1	4.5116206E-8
apple-cheeked	1	4.5116206E-8
apple-everything	1	4.5116206E-8
apple-hosted	1	4.5116206E-8
apple-pear	1	4.5116206E-8
apple-pie	2	9.023241E-8
apple-supplied	1	4.5116206E-8
applebaum	1	4.5116206E-8
applebee	5	2.2558103E-7
applebees	1	4.5116206E-8
applebome	18	8.1209174E-7
appleby	14	6.316269E-7
applecare	1	4.5116206E-8
applegarth	1	4.5116206E-8
applegate	4	1.8046482E-7
appleman	2	9.023241E-8
apples	158	7.1283607E-6
apples-and-oranges	1	4.5116206E-8
apples-to-apples	1	4.5116206E-8
applesauce	9	4.0604587E-7
appleseed	8	3.6092965E-7
applet	7	3.1581345E-7
applet-generated	1	4.5116206E-8
appleton	10	4.5116207E-7
appletons	1	4.5116206E-8
applets	5	2.2558103E-7
applewhite	3	1.3534861E-7
applewood	4	1.8046482E-7
applewood-smoked	1	4.5116206E-8
appliance	36	1.6241835E-6
applianced	1	4.5116206E-8
appliances	90	4.0604587E-6
applic	2	9.023241E-8
applicability	76	3.4288316E-6
applicable	441	1.9896248E-5
applicableemission	2	9.023241E-8
applicableimplementation	1	4.5116206E-8
applicandum	1	4.5116206E-8
applicant	74	3.3385993E-6
applicants	180	8.120917E-6
applicarent	1	4.5116206E-8
application	1001	4.5161323E-5
application-listed	1	4.5116206E-8
application-targeted	1	4.5116206E-8
application-what	1	4.5116206E-8
applications	626	2.8242745E-5
applicatn	1	4.5116206E-8
applicator	4	1.8046482E-7
applicuerunt	1	4.5116206E-8
applicuisset	1	4.5116206E-8
applicuisti	1	4.5116206E-8
applied	1495	6.744873E-5
applies	295	1.3309281E-5
appling	3	1.3534861E-7
applipicable	1	4.5116206E-8
applique	4	1.8046482E-7
appliqued	1	4.5116206E-8
appliques	3	1.3534861E-7
appliqué	1	4.5116206E-8
appliqués	3	1.3534861E-7
apply	996	4.4935743E-5
applying	347	1.5655323E-5
appoint	98	4.4213884E-6
appointed	321	1.44823025E-5
appointed-for-life	1	4.5116206E-8
appointee	43	1.939997E-6
appointees	46	2.0753455E-6
appointers	1	4.5116206E-8
appointing	35	1.5790672E-6
appointive	3	1.3534861E-7
appointment	349	1.5745556E-5
appointments	113	5.098131E-6
appointmet	1	4.5116206E-8
appoints	17	7.669755E-7
appold	2	9.023241E-8
appomattox	7	3.1581345E-7
apponens	1	4.5116206E-8
apporpriate	1	4.5116206E-8
apport	1	4.5116206E-8
apportion	5	2.2558103E-7
apportioned	6	2.7069723E-7
apportionment	8	3.6092965E-7
apportions	1	4.5116206E-8
apporve	1	4.5116206E-8
appose	1	4.5116206E-8
apposed	4	1.8046482E-7
apposing	1	4.5116206E-8
apposite	6	2.7069723E-7
apposition	8	3.6092965E-7
appositional	4	1.8046482E-7
appositions	5	2.2558103E-7
appositive	5	2.2558103E-7
appositus	1	4.5116206E-8
appp	1	4.5116206E-8
apppa	12	5.4139446E-7
apppa-binding	1	4.5116206E-8
apppbodipy	2	9.023241E-8
apppn	33	1.4888349E-6
appppa	14	6.316269E-7
appppn	29	1.30837E-6
appraisal	82	3.6995289E-6
appraisals	10	4.5116207E-7
appraise	28	1.2632538E-6
appraised	26	1.1730214E-6
appraiser	8	3.6092965E-7
appraisers	2	9.023241E-8
appraises	7	3.1581345E-7
appraising	4	1.8046482E-7
appreciable	35	1.5790672E-6
appreciably	35	1.5790672E-6
appreciate	624	2.8152514E-5
appreciated	261	1.177533E-5
appreciates	32	1.4437186E-6
appreciating	34	1.533951E-6
appreciation	219	9.880449E-6
appreciations	4	1.8046482E-7
appreciative	42	1.8948807E-6
appreciatively	12	5.4139446E-7
appreciator	5	2.2558103E-7
appredendissent	1	4.5116206E-8
apprehend	10	4.5116207E-7
apprehended	23	1.0376727E-6
apprehenderof	1	4.5116206E-8
apprehending	5	2.2558103E-7
apprehension	33	1.4888349E-6
apprehensions	7	3.1581345E-7
apprehensive	16	7.218593E-7
apprehensively	2	9.023241E-8
apprend	1	4.5116206E-8
apprendi	4	1.8046482E-7
apprendre	1	4.5116206E-8
apprentice	26	1.1730214E-6
apprentice-work	1	4.5116206E-8
apprenticed	7	3.1581345E-7
apprentices	8	3.6092965E-7
apprenticeship	17	7.669755E-7
apprenticeships	4	1.8046482E-7
apprenticing	2	9.023241E-8
apprise	4	1.8046482E-7
apprised	4	1.8046482E-7
appro-priateness	1	4.5116206E-8
approach	3023	1.363863E-4
approachability	1	4.5116206E-8
approachable	8	3.6092965E-7
approached	266	1.2000911E-5
approachers	1	4.5116206E-8
approaches	861	3.8845053E-5
approaching	211	9.51952E-6
approachoutlined	1	4.5116206E-8
approbation	9	4.0604587E-7
approbative	1	4.5116206E-8
approching	1	4.5116206E-8
appropos	2	9.023241E-8
appropria	1	4.5116206E-8
appropriable	1	4.5116206E-8
appropriacy	1	4.5116206E-8
appropriate	2059	9.289427E-5
appropriate-according	1	4.5116206E-8
appropriate-for-gestational	1	4.5116206E-8
appropriate-in	1	4.5116206E-8
appropriate-sounding	1	4.5116206E-8
appropriate-that	1	4.5116206E-8
appropriatearchitecture	1	4.5116206E-8
appropriated	76	3.4288316E-6
appropriately	229	1.03316115E-5
appropriateness	46	2.0753455E-6
appropriates	4	1.8046482E-7
appropriating	16	7.218593E-7
appropriation	87	3.92511E-6
appropriations	257	1.1594865E-5
appropriations-defense	1	4.5116206E-8
appropriations-will	1	4.5116206E-8
appropriators	1	4.5116206E-8
approval	812	3.663436E-5
approval-disapproval	1	4.5116206E-8
approvals	42	1.8948807E-6
approve	327	1.4753E-5
approved	1199	5.4094333E-5
approveddesignation	1	4.5116206E-8
approver	1	4.5116206E-8
approves	39	1.7595321E-6
approving	73	3.2934831E-6
approvingchanges	1	4.5116206E-8
approvingly	15	6.767431E-7
approx	15	6.767431E-7
approximate	165	7.444174E-6
approximate-match	1	4.5116206E-8
approximated	37	1.6692996E-6
approximately	1902	8.581102E-5
approximates	20	9.0232413E-7
approximating	13	5.865107E-7
approximation	113	5.098131E-6
approximations	15	6.767431E-7
approximatley	1	4.5116206E-8
approximatly	1	4.5116206E-8
approximators	1	4.5116206E-8
apps	5	2.2558103E-7
appt	2	9.023241E-8
appts	3	1.3534861E-7
appurtenances	2	9.023241E-8
appurtences	2	9.023241E-8
appuyer	2	9.023241E-8
appx	2	9.023241E-8
appétit	2	9.023241E-8
apr	446	2.0121828E-5
apra	5	2.2558103E-7
aprataxin	2	9.023241E-8
apraxia	2	9.023241E-8
apreciate	1	4.5116206E-8
apres	1	4.5116206E-8
apresents	2	9.023241E-8
apresyan	1	4.5116206E-8
aprex	1	4.5116206E-8
apre­mont	1	4.5116206E-8
apri	1	4.5116206E-8
aprice	1	4.5116206E-8
apricot	13	5.865107E-7
apricots	14	6.316269E-7
april	1676	7.5614764E-5
april-bot	1	4.5116206E-8
april-early	1	4.5116206E-8
april-june	1	4.5116206E-8
april-through	1	4.5116206E-8
aprilbot	5	2.2558103E-7
aprile	2	9.023241E-8
april–	10	4.5116207E-7
aprimary	1	4.5116206E-8
aprivate	1	4.5116206E-8
aprofile	1	4.5116206E-8
apron	29	1.30837E-6
apron-clad	1	4.5116206E-8
apron-staged	1	4.5116206E-8
aproned	1	4.5116206E-8
aprons	14	6.316269E-7
apropos	52	2.3460427E-6
aprotinin	49	2.2106942E-6
aproved	1	4.5116206E-8
aprovides	1	4.5116206E-8
aprt	2	9.023241E-8
aprtment	2	9.023241E-8
après	2	9.023241E-8
aprés	1	4.5116206E-8
aprés-ski	1	4.5116206E-8
aps	4	1.8046482E-7
apsara	1	4.5116206E-8
apse	30	1.3534863E-6
apses	33	1.4888349E-6
apses-like	1	4.5116206E-8
apsley	2	9.023241E-8
apso	1	4.5116206E-8
apt	150	6.767431E-6
aptamer	16	7.218593E-7
aptamers	5	2.2558103E-7
aptazyme	19	8.572079E-7
aptazymes	16	7.218593E-7
apted	3	1.3534861E-7
apteek	1	4.5116206E-8
aptenodytes	1	4.5116206E-8
apteronotus	1	4.5116206E-8
apterous	5	2.2558103E-7
aptest	2	9.023241E-8
aptitude	36	1.6241835E-6
aptitudes	3	1.3534861E-7
aptly	38	1.7144158E-6
aptly-named	1	4.5116206E-8
aptly-titled	1	4.5116206E-8
aptness	2	9.023241E-8
apu	3	1.3534861E-7
apuleius	1	4.5116206E-8
apulia	3	1.3534861E-7
apurinic	5	2.2558103E-7
apv	135	6.0906877E-6
apw	1	4.5116206E-8
apyrase	2	9.023241E-8
apyrimidinic	3	1.3534861E-7
apátság	1	4.5116206E-8
apéritif	3	1.3534861E-7
aq	19	8.572079E-7
aqaarib	2	9.023241E-8
aqaba	3	1.3534861E-7
aqmd	2	9.023241E-8
aqp	128	5.7748744E-6
aqp-like	3	1.3534861E-7
aqp-type	1	4.5116206E-8
aqps	64	2.8874372E-6
aqsa	9	4.0604587E-7
aqua	22	9.925566E-7
aqua-cycling	1	4.5116206E-8
aqua-glyceroporin	1	4.5116206E-8
aquacide	1	4.5116206E-8
aquacise	1	4.5116206E-8
aquacity	1	4.5116206E-8
aquaculture	9	4.0604587E-7
aquadextrous	1	4.5116206E-8
aquae	4	1.8046482E-7
aquafina	2	9.023241E-8
aquafresh	5	2.2558103E-7
aquagrill	3	1.3534861E-7
aquaintance	1	4.5116206E-8
aquaintances	1	4.5116206E-8
aqualand	1	4.5116206E-8
aqualebrium	1	4.5116206E-8
aqualeisure	1	4.5116206E-8
aqualife	1	4.5116206E-8
aqualine	1	4.5116206E-8
aqualosers	1	4.5116206E-8
aquaman	10	4.5116207E-7
aquamarine	10	4.5116207E-7
aquanetta	1	4.5116206E-8
aquantifies	1	4.5116206E-8
aquapark	2	9.023241E-8
aquaplaning	1	4.5116206E-8
aquaporin	12	5.4139446E-7
aquaporin-related	2	9.023241E-8
aquaporins	4	1.8046482E-7
aquaria	2	9.023241E-8
aquarian	4	1.8046482E-7
aquarians	2	9.023241E-8
aquarium	123	5.5492933E-6
aquariums	9	4.0604587E-7
aquarius	21	9.4744036E-7
aquascope	2	9.023241E-8
aquasur	1	4.5116206E-8
aquateric	14	6.316269E-7
aquaterra	1	4.5116206E-8
aquathon	1	4.5116206E-8
aquatic	87	3.92511E-6
aquatic-sports	1	4.5116206E-8
aquatics	7	3.1581345E-7
aquatint	1	4.5116206E-8
aquaworld	5	2.2558103E-7
aquba	1	4.5116206E-8
aquebogue	1	4.5116206E-8
aqueduct	37	1.6692996E-6
aqueducts	7	3.1581345E-7
aqueduto	1	4.5116206E-8
aquel	1	4.5116206E-8
aquella	1	4.5116206E-8
aquellas	1	4.5116206E-8
aquensem	1	4.5116206E-8
aqueous	130	5.8651067E-6
aqueous-phase	1	4.5116206E-8
aqueously	2	9.023241E-8
aqueria	2	9.023241E-8
aqui	3	1.3534861E-7
aquifer	6	2.7069723E-7
aquifers	6	2.7069723E-7
aquifex	27	1.2181375E-6
aquificales	2	9.023241E-8
aquila	14	6.316269E-7
aquiline	1	4.5116206E-8
aquinas	15	6.767431E-7
aquincum	9	4.0604587E-7
aquinnah	1	4.5116206E-8
aquino	2	9.023241E-8
aquire	2	9.023241E-8
aquis	1	4.5116206E-8
aquisition	1	4.5116206E-8
aquitaine	8	3.6092965E-7
aquitania	2	9.023241E-8
aquitted	1	4.5116206E-8
aquiver	1	4.5116206E-8
aquàrium	1	4.5116206E-8
aquárium	1	4.5116206E-8
aquí	4	1.8046482E-7
ar	396	1.7866018E-5
ar-ar	1	4.5116206E-8
ar-are	1	4.5116206E-8
ar-dependent	6	2.7069723E-7
ar-dna	1	4.5116206E-8
ar-expressing	1	4.5116206E-8
ar-inactivating	2	9.023241E-8
ar-initiated	1	4.5116206E-8
ar-mediated	5	2.2558103E-7
ar-mi	1	4.5116206E-8
ar-rafiiq	1	4.5116206E-8
ar-rajl	1	4.5116206E-8
ar-responsive	1	4.5116206E-8
ar-specific	1	4.5116206E-8
ar-turmerone	1	4.5116206E-8
ara	21	9.4744036E-7
arab	848	3.8258542E-5
arab-dominated	3	1.3534861E-7
arab-led	1	4.5116206E-8
arab-looking	2	9.023241E-8
arab-majority	1	4.5116206E-8
arab-manufactured	1	4.5116206E-8
arab-owned	1	4.5116206E-8
arab-poet	1	4.5116206E-8
arab-run	2	9.023241E-8
arab-sponsored	1	4.5116206E-8
arab-style	2	9.023241E-8
arabah	1	4.5116206E-8
arabe	3	1.3534861E-7
arabella	1	4.5116206E-8
arabesque	5	2.2558103E-7
arabesques	10	4.5116207E-7
arabi	33	1.4888349E-6
arabia	312	1.4076257E-5
arabian	59	2.6618561E-6
arabian-sponsored	1	4.5116206E-8
arabians	4	1.8046482E-7
arabic	298	1.344463E-5
arabic-language	6	2.7069723E-7
arabic-sounding	2	9.023241E-8
arabic-speaking	5	2.2558103E-7
arabica	1	4.5116206E-8
arabicgreek	1	4.5116206E-8
arabicincluded	1	4.5116206E-8
arabictravel	1	4.5116206E-8
arabidopis	1	4.5116206E-8
arabidopsis	538	2.427252E-5
arabidopsisaqp	1	4.5116206E-8
arabidopsischromosomes	1	4.5116206E-8
arabidopsisgenome	2	9.023241E-8
arabidopsismyosins	2	9.023241E-8
arabiensis	2	9.023241E-8
arabino	1	4.5116206E-8
arabino-heptulosonate	1	4.5116206E-8
arabinofuranoside	4	1.8046482E-7
arabinofuranosyl	1	4.5116206E-8
arabinose	4	1.8046482E-7
arabinose-binding	1	4.5116206E-8
arabiopsis	1	4.5116206E-8
arabipdosis	1	4.5116206E-8
arabism	3	1.3534861E-7
arabist	1	4.5116206E-8
arabists	1	4.5116206E-8
arabization	1	4.5116206E-8
arable	9	4.0604587E-7
arablish	1	4.5116206E-8
arabs	236	1.06474245E-5
arabs-u	1	4.5116206E-8
arabsthink	1	4.5116206E-8
araby	1	4.5116206E-8
arabí	2	9.023241E-8
arac	3	1.3534861E-7
arac-like	2	9.023241E-8
araca	1	4.5116206E-8
araceae	1	4.5116206E-8
aracena	1	4.5116206E-8
arachadyl	1	4.5116206E-8
arachaeoglobus	1	4.5116206E-8
arachidic	1	4.5116206E-8
arachidonate	2	9.023241E-8
arachidonic	31	1.3986024E-6
arachidonoyl	1	4.5116206E-8
arachidonyl	1	4.5116206E-8
arachidoyl	5	2.2558103E-7
arachinodic	1	4.5116206E-8
arachis	1	4.5116206E-8
arachnaphobe	1	4.5116206E-8
arachnid	1	4.5116206E-8
arachnids	3	1.3534861E-7
arachnodactyly	2	9.023241E-8
arachnologist	1	4.5116206E-8
arachnophobia	1	4.5116206E-8
arachova	2	9.023241E-8
aracoeli	1	4.5116206E-8
aradam	1	4.5116206E-8
arade	4	1.8046482E-7
arafa	1	4.5116206E-8
arafat	374	1.687346E-5
arago	1	4.5116206E-8
aragon	18	8.1209174E-7
aragones	1	4.5116206E-8
aragonese	4	1.8046482E-7
aragorn	33	1.4888349E-6
aragornesque	1	4.5116206E-8
aragó	3	1.3534861E-7
aragón	12	5.4139446E-7
arah	2	9.023241E-8
araiguma	1	4.5116206E-8
arakeen	1	4.5116206E-8
araki	1	4.5116206E-8
aral	1	4.5116206E-8
araldite	2	9.023241E-8
arama	1	4.5116206E-8
aramaic	24	1.0827889E-6
aramark	3	1.3534861E-7
aramburuzabala	17	7.669755E-7
aramco	1	4.5116206E-8
arame	2	9.023241E-8
aramean	1	4.5116206E-8
aramic	1	4.5116206E-8
aramis	2	9.023241E-8
aramony	2	9.023241E-8
arana	2	9.023241E-8
aranca	1	4.5116206E-8
aranda	1	4.5116206E-8
aranesp	8	3.6092965E-7
arange	2	9.023241E-8
aranguez	1	4.5116206E-8
aranha	1	4.5116206E-8
aranibar	1	4.5116206E-8
aranjaized	1	4.5116206E-8
aranjuez	7	3.1581345E-7
aransas	20	9.0232413E-7
arany	1	4.5116206E-8
aranyhordó	1	4.5116206E-8
araoz	2	9.023241E-8
arap	4	1.8046482E-7
arapaho	7	3.1581345E-7
arapahoe	4	1.8046482E-7
arappco	1	4.5116206E-8
aras	1	4.5116206E-8
arashiyama	4	1.8046482E-7
arasteh	1	4.5116206E-8
arata	2	9.023241E-8
arati	1	4.5116206E-8
araton	1	4.5116206E-8
arau	1	4.5116206E-8
arava	3	1.3534861E-7
aravalli	4	1.8046482E-7
aravi	1	4.5116206E-8
aravinda	1	4.5116206E-8
aravis	1	4.5116206E-8
arawak	25	1.1279052E-6
arawaks	1	4.5116206E-8
arax	2	9.023241E-8
araújo	1	4.5116206E-8
arb	27	1.2181375E-6
arb-home	2	9.023241E-8
arbacia	7	3.1581345E-7
arbed	1	4.5116206E-8
arbeiter	1	4.5116206E-8
arbenz	1	4.5116206E-8
arber	4	1.8046482E-7
arbeter	5	2.2558103E-7
arbi	2	9.023241E-8
arbib	2	9.023241E-8
arbiter	19	8.572079E-7
arbiters	8	3.6092965E-7
arbitrage	5	2.2558103E-7
arbitragers	1	4.5116206E-8
arbitrageur	2	9.023241E-8
arbitrageurs	2	9.023241E-8
arbitraging	1	4.5116206E-8
arbitrarily	72	3.248367E-6
arbitrariness	7	3.1581345E-7
arbitrary	246	1.1098587E-5
arbitrate	6	2.7069723E-7
arbitrating	1	4.5116206E-8
arbitration	41	1.8497644E-6
arbitrator	14	6.316269E-7
arbitrators	5	2.2558103E-7
arbitray	1	4.5116206E-8
arbitrium	1	4.5116206E-8
arbitron	1	4.5116206E-8
arbo	1	4.5116206E-8
arbois	4	1.8046482E-7
arbor	93	4.1958074E-6
arborea	1	4.5116206E-8
arboreal	6	2.7069723E-7
arborescens	1	4.5116206E-8
arboretum	9	4.0604587E-7
arboretums	1	4.5116206E-8
arboreus	2	9.023241E-8
arborio	1	4.5116206E-8
arborites	1	4.5116206E-8
arborizations	2	9.023241E-8
arbors	1	4.5116206E-8
arborway	1	4.5116206E-8
arbour	3	1.3534861E-7
arbre	1	4.5116206E-8
arbs	1	4.5116206E-8
arbuckle	5	2.2558103E-7
arbuckles	2	9.023241E-8
arbus	7	3.1581345E-7
arbuscular	2	9.023241E-8
arbusto	3	1.3534861E-7
arbutus	1	4.5116206E-8
arby	18	8.1209174E-7
arc	352	1.5880905E-5
arc-as-a-whole	1	4.5116206E-8
arc-dependent	2	9.023241E-8
arc-driven	6	2.7069723E-7
arc-et	1	4.5116206E-8
arc-heavy	1	4.5116206E-8
arc-ier	1	4.5116206E-8
arc-iness	1	4.5116206E-8
arc-jet	1	4.5116206E-8
arc-light	1	4.5116206E-8
arc-massage	1	4.5116206E-8
arc-ness	1	4.5116206E-8
arc-relevant	1	4.5116206E-8
arc-wise	1	4.5116206E-8
arc-y	5	2.2558103E-7
arca	5	2.2558103E-7
arcade	65	2.9325533E-6
arcade-covered	1	4.5116206E-8
arcaded	25	1.1279052E-6
arcades	37	1.6692996E-6
arcadia	12	5.4139446E-7
arcadian	4	1.8046482E-7
arcadis	3	1.3534861E-7
arcana	8	3.6092965E-7
arcand	2	9.023241E-8
arcane	66	2.9776697E-6
arcanely	1	4.5116206E-8
arcangel	1	4.5116206E-8
arcanum	1	4.5116206E-8
arcata	1	4.5116206E-8
arcaícos	1	4.5116206E-8
arce	7	3.1581345E-7
arced	1	4.5116206E-8
arceli	1	4.5116206E-8
arcelor	4	1.8046482E-7
arcfu	1	4.5116206E-8
arch	180	8.120917E-6
arch-backed	1	4.5116206E-8
arch-cockney	1	4.5116206E-8
arch-concern	1	4.5116206E-8
arch-conservative	2	9.023241E-8
arch-dragoness	1	4.5116206E-8
arch-enemies	1	4.5116206E-8
arch-enemy	2	9.023241E-8
arch-foe	2	9.023241E-8
arch-like	1	4.5116206E-8
arch-nemesis	2	9.023241E-8
arch-nemisis	1	4.5116206E-8
arch-patriarch	1	4.5116206E-8
arch-progressive	1	4.5116206E-8
arch-protectionist	1	4.5116206E-8
arch-representative	1	4.5116206E-8
arch-rival	2	9.023241E-8
arch-rivals	2	9.023241E-8
arch-sleuth	1	4.5116206E-8
arch-supported	1	4.5116206E-8
arch-terrorists	1	4.5116206E-8
arch-villain	1	4.5116206E-8
archaea	151	6.8125473E-6
archaea-eukaryotes	1	4.5116206E-8
archaea-specific	2	9.023241E-8
archaeal	100	4.511621E-6
archaeal-bacterial	1	4.5116206E-8
archaean	1	4.5116206E-8
archaebacteria	22	9.925566E-7
archaebacteria-derived	1	4.5116206E-8
archaebacterial	8	3.6092965E-7
archaebacterium	3	1.3534861E-7
archael	1	4.5116206E-8
archaelog	1	4.5116206E-8
archaelogist	1	4.5116206E-8
archaelogy	1	4.5116206E-8
archaeo-eukaryotic	11	4.962783E-7
archaeoglobus	20	9.0232413E-7
archaeological	207	9.3390545E-6
archaeologist	37	1.6692996E-6
archaeologists	85	3.8348776E-6
archaeology	59	2.6618561E-6
archaeology-related	1	4.5116206E-8
archaeometallurgist	1	4.5116206E-8
archaeon	16	7.218593E-7
archaic	62	2.7972048E-6
archaics	2	9.023241E-8
archaisms	4	1.8046482E-7
archangel	13	5.865107E-7
archbigot	1	4.5116206E-8
archbishop	75	3.3837155E-6
archbishopric	1	4.5116206E-8
archbishops	4	1.8046482E-7
archdale	2	9.023241E-8
archdeacon	4	1.8046482E-7
archdiocesan	9	4.0604587E-7
archdiocese	138	6.2260365E-6
archdioceses	2	9.023241E-8
archduchess	1	4.5116206E-8
archduke	12	5.4139446E-7
arche	7	3.1581345E-7
archea	1	4.5116206E-8
archeabacteria	3	1.3534861E-7
arched	64	2.8874372E-6
archegetis	1	4.5116206E-8
archenemies	2	9.023241E-8
archenemy	7	3.1581345E-7
archeologica	1	4.5116206E-8
archeological	19	8.572079E-7
archeologico	3	1.3534861E-7
archeologist	2	9.023241E-8
archeologists	7	3.1581345E-7
archeology	14	6.316269E-7
archeology-in-reverse	1	4.5116206E-8
archer	166	7.4892905E-6
archerd	2	9.023241E-8
archers	10	4.5116207E-7
archery	13	5.865107E-7
arches	129	5.8199907E-6
archetti	1	4.5116206E-8
archetypal	38	1.7144158E-6
archetype	28	1.2632538E-6
archetype-haunted	1	4.5116206E-8
archetypes	11	4.962783E-7
archevêché	1	4.5116206E-8
archfiend	1	4.5116206E-8
archia	1	4.5116206E-8
archibald	18	8.1209174E-7
archibold	4	1.8046482E-7
archie	42	1.8948807E-6
archie-faction	1	4.5116206E-8
archies	9	4.0604587E-7
archilochos	1	4.5116206E-8
archimbaud	2	9.023241E-8
archimedes	3	1.3534861E-7
arching	13	5.865107E-7
archipelago	44	1.9851132E-6
archipelagoes	1	4.5116206E-8
archipiélago	3	1.3534861E-7
architect	353	1.5926022E-5
architect-engineer	1	4.5116206E-8
architect-mathematician-poet	1	4.5116206E-8
architect-sculptor	1	4.5116206E-8
architect-to-be	1	4.5116206E-8
architected	6	2.7069723E-7
architectengineer	1	4.5116206E-8
architecting	2	9.023241E-8
architective	1	4.5116206E-8
architects	207	9.3390545E-6
architectural	290	1.30837E-5
architecturally	19	8.572079E-7
architecture	747	3.3701806E-5
architecture-specific	1	4.5116206E-8
architecturefor	1	4.5116206E-8
architectureis	1	4.5116206E-8
architectureoptimization	1	4.5116206E-8
architectures	41	1.8497644E-6
architecturesis	1	4.5116206E-8
architraves	1	4.5116206E-8
archiv	2	9.023241E-8
archivage	1	4.5116206E-8
archival	50	2.2558104E-6
archive	142	6.406501E-6
archive-surfing	1	4.5116206E-8
archive-sweat	1	4.5116206E-8
archived	25	1.1279052E-6
archives	172	7.759988E-6
archiving	17	7.669755E-7
archivist	6	2.7069723E-7
archivists	9	4.0604587E-7
archivo	1	4.5116206E-8
archi­tec­ture	1	4.5116206E-8
archly	12	5.4139446E-7
archnemesis	1	4.5116206E-8
archos	4	1.8046482E-7
archrationalist	1	4.5116206E-8
archrival	9	4.0604587E-7
archrivals	1	4.5116206E-8
archvillain	2	9.023241E-8
archvillains	1	4.5116206E-8
archway	15	6.767431E-7
archways	2	9.023241E-8
archwork	2	9.023241E-8
archy	1	4.5116206E-8
arch­bishop	1	4.5116206E-8
archéologique	2	9.023241E-8
arcing	2	9.023241E-8
arcjet	2	9.023241E-8
arclet	1	4.5116206E-8
arclight	4	1.8046482E-7
arcman	1	4.5116206E-8
arco	16	7.218593E-7
arcopedico	3	1.3534861E-7
arcopedicos	1	4.5116206E-8
arcos	3	1.3534861E-7
arcs	45	2.0302293E-6
arcsin	3	1.3534861E-7
arctan	1	4.5116206E-8
arctanthemum	5	2.2558103E-7
arctic	67	3.022786E-6
arctic-dwelling	1	4.5116206E-8
arctoides	1	4.5116206E-8
arctos	1	4.5116206E-8
arcturus	2	9.023241E-8
arcuate	6	2.7069723E-7
arcus	1	4.5116206E-8
arcview	1	4.5116206E-8
arcy	10	4.5116207E-7
ard	55	2.4813914E-6
ard-immunoreactivity	2	9.023241E-8
arda	2	9.023241E-8
ardabil	1	4.5116206E-8
ardagh	1	4.5116206E-8
ardannabon	1	4.5116206E-8
ardastra	1	4.5116206E-8
ardea	1	4.5116206E-8
ardeatine	1	4.5116206E-8
ardeche	1	4.5116206E-8
arden	17	7.669755E-7
ardennes	4	1.8046482E-7
ardent	45	2.0302293E-6
ardently	14	6.316269E-7
ardhanarishvara	1	4.5116206E-8
ardilla	1	4.5116206E-8
ardine	1	4.5116206E-8
ardipithecus	1	4.5116206E-8
ardittou	1	4.5116206E-8
ardlie	1	4.5116206E-8
ardmore	4	1.8046482E-7
ardolino	2	9.023241E-8
ardor	16	7.218593E-7
ardour	1	4.5116206E-8
ardoyne	1	4.5116206E-8
ardoz	1	4.5116206E-8
ardrey	1	4.5116206E-8
ards	56	2.5265076E-6
ardsley	2	9.023241E-8
arduous	34	1.533951E-6
ardèche	2	9.023241E-8
are	106744	0.0048158844
are-jet	1	4.5116206E-8
are-mrna	2	9.023241E-8
are-tata-luciferase	7	3.1581345E-7
area	5677	2.561247E-4
area-code	1	4.5116206E-8
area-istas	2	9.023241E-8
area-ites	1	4.5116206E-8
area-product	1	4.5116206E-8
area-sources	1	4.5116206E-8
area-to-volume	2	9.023241E-8
area-under-the-curve	1	4.5116206E-8
areaandtutmosis	1	4.5116206E-8
areactively	1	4.5116206E-8
areal	1	4.5116206E-8
areapplied	1	4.5116206E-8
arear	1	4.5116206E-8
areas	2779	1.2537793E-4
areas-backing	1	4.5116206E-8
areas-control	1	4.5116206E-8
areas-corporate	1	4.5116206E-8
areas-urban	1	4.5116206E-8
areasin	1	4.5116206E-8
areasonable	1	4.5116206E-8
areasonn	2	9.023241E-8
areawide	1	4.5116206E-8
arecession	1	4.5116206E-8
arecibo	5	2.2558103E-7
arecoming	1	4.5116206E-8
arediscounted	1	4.5116206E-8
aree	1	4.5116206E-8
areet	1	4.5116206E-8
arefers	1	4.5116206E-8
arefrom	1	4.5116206E-8
areg	1	4.5116206E-8
areheart	1	4.5116206E-8
areia	1	4.5116206E-8
arein	1	4.5116206E-8
arelated	1	4.5116206E-8
areligious	2	9.023241E-8
arellano	5	2.2558103E-7
aremore	1	4.5116206E-8
aren	48	2.1655778E-6
arena	285	1.2858119E-5
arena-rigging	1	4.5116206E-8
arena-rock	4	1.8046482E-7
arena-rocking	1	4.5116206E-8
arena-scale	1	4.5116206E-8
arenabowl	1	4.5116206E-8
arenal	6	2.7069723E-7
arenaria	4	1.8046482E-7
arenas	32	1.4437186E-6
arend	1	4.5116206E-8
arendt	29	1.30837E-6
arens	2	9.023241E-8
arensky	5	2.2558103E-7
arenson	8	3.6092965E-7
arent	1	4.5116206E-8
areopagos	2	9.023241E-8
areos	2	9.023241E-8
arep	3	1.3534861E-7
areplotted	1	4.5116206E-8
areport	1	4.5116206E-8
arepresent	1	4.5116206E-8
arepublican	1	4.5116206E-8
arequipa	3	1.3534861E-7
ares	17	7.669755E-7
areselected	1	4.5116206E-8
areso	1	4.5116206E-8
areste	1	4.5116206E-8
arestegui	1	4.5116206E-8
arete	2	9.023241E-8
areterminally	1	4.5116206E-8
aretha	15	6.767431E-7
arethites	1	4.5116206E-8
aretsky	2	9.023241E-8
aretusa	1	4.5116206E-8
aretz	130	5.8651067E-6
areuniversal	1	4.5116206E-8
areused	2	9.023241E-8
arey	2	9.023241E-8
arezzo	3	1.3534861E-7
arf	30	1.3534863E-6
arfbinds	1	4.5116206E-8
arfgene	1	4.5116206E-8
arfogwl	1	4.5116206E-8
arfs	1	4.5116206E-8
arg	107	4.827434E-6
arg-?	1	4.5116206E-8
arg-paranitroanilide	1	4.5116206E-8
arga	2	9.023241E-8
argaman	1	4.5116206E-8
argana	4	1.8046482E-7
argenbright	3	1.3534861E-7
argent	3	1.3534861E-7
argent-antarctic-review	1	4.5116206E-8
argentaria	4	1.8046482E-7
argentario	3	1.3534861E-7
argentea	1	4.5116206E-8
argenteria	1	4.5116206E-8
argenti	2	9.023241E-8
argentina	263	1.1865563E-5
argentina-coverup	3	1.3534861E-7
argentina-evita	4	1.8046482E-7
argentina-style	2	9.023241E-8
argentine	87	3.92511E-6
argentine-style	1	4.5116206E-8
argentinean	4	1.8046482E-7
argentines	12	5.4139446E-7
argentinian	11	4.962783E-7
argentinians	1	4.5116206E-8
argento	6	2.7069723E-7
argentum	2	9.023241E-8
argf	1	4.5116206E-8
arggghhhh	3	1.3534861E-7
arggh	2	9.023241E-8
argghhhhhhhh	1	4.5116206E-8
argh	121	5.459061E-6
argillite	1	4.5116206E-8
arginine	76	3.4288316E-6
arginine-rich	4	1.8046482E-7
arginines	9	4.0604587E-7
argininosuccinate	1	4.5116206E-8
argmax	6	2.7069723E-7
argo	3	1.3534861E-7
argolid	5	2.2558103E-7
argon	15	6.767431E-7
argon-ion	1	4.5116206E-8
argonath	1	4.5116206E-8
argonaut	1	4.5116206E-8
argonaute	1	4.5116206E-8
argonauts	4	1.8046482E-7
argonne	11	4.962783E-7
argos	9	4.0604587E-7
argosy	1	4.5116206E-8
argot	21	9.4744036E-7
args	3	1.3534861E-7
arguable	14	6.316269E-7
arguably	177	7.985569E-6
argue	912	4.114598E-5
argue-y	1	4.5116206E-8
argued	753	3.3972505E-5
argued-might	1	4.5116206E-8
arguello	3	1.3534861E-7
arguement	3	1.3534861E-7
argues	634	2.8603676E-5
argueta	5	2.2558103E-7
arguineguín	1	4.5116206E-8
arguing	406	1.831718E-5
argumantar	1	4.5116206E-8
argument	1337	6.032037E-5
argument-ender	1	4.5116206E-8
argument-stopping	1	4.5116206E-8
argumentación	1	4.5116206E-8
argumentation	5	2.2558103E-7
argumentative	10	4.5116207E-7
argumentativeness	1	4.5116206E-8
argumentgative	1	4.5116206E-8
argumento	2	9.023241E-8
arguments	506	2.28288E-5
argureoio	1	4.5116206E-8
argureoiou	1	4.5116206E-8
argureolou	1	4.5116206E-8
argus	7	3.1581345E-7
argye	1	4.5116206E-8
argyle	3	1.3534861E-7
argyll	2	9.023241E-8
arhats	1	4.5116206E-8
ari	86	3.879994E-6
aria	12	5.4139446E-7
ariab	1	4.5116206E-8
ariadne	4	1.8046482E-7
arian	8	3.6092965E-7
ariana	4	1.8046482E-7
ariane	4	1.8046482E-7
arianna	30	1.3534863E-6
arianne	2	9.023241E-8
arians	3	1.3534861E-7
arias	9	4.0604587E-7
ariation	1	4.5116206E-8
ariba	2	9.023241E-8
aribau	1	4.5116206E-8
aricept	1	4.5116206E-8
arid	39	1.7595321E-6
aridane	1	4.5116206E-8
aridity	3	1.3534861E-7
arie	3	1.3534861E-7
arief	3	1.3534861E-7
arieh	1	4.5116206E-8
arieiro	6	2.7069723E-7
ariel	84	3.7897614E-6
arielle	4	1.8046482E-7
arienzo	1	4.5116206E-8
aries	15	6.767431E-7
arif	1	4.5116206E-8
arigato	1	4.5116206E-8
aright	1	4.5116206E-8
arihleka	1	4.5116206E-8
arikara	2	9.023241E-8
arim	1	4.5116206E-8
arima	2	9.023241E-8
arimathea	2	9.023241E-8
ariminium	1	4.5116206E-8
arina	1	4.5116206E-8
arinc	4	1.8046482E-7
arince	4	1.8046482E-7
arinrummy	1	4.5116206E-8
ario	1	4.5116206E-8
arioch	1	4.5116206E-8
arion	1	4.5116206E-8
aripiprazole	1	4.5116206E-8
aris	1	4.5116206E-8
arise	332	1.4978581E-5
arisen	78	3.5190642E-6
arises	185	8.346498E-6
arisia	5	2.2558103E-7
arising	162	7.3088254E-6
arison	3	1.3534861E-7
arista	31	1.3986024E-6
aristae	17	7.669755E-7
aristide	46	2.0753455E-6
aristo	1	4.5116206E-8
aristocats	1	4.5116206E-8
aristocracy	68	3.067902E-6
aristocrat	22	9.925566E-7
aristocratic	59	2.6618561E-6
aristocratic-mandated	1	4.5116206E-8
aristocratically	1	4.5116206E-8
aristocrats	42	1.8948807E-6
aristolochia	9	4.0604587E-7
aristolochic	5	2.2558103E-7
aristophanes	9	4.0604587E-7
aristoplan	1	4.5116206E-8
aristotelian	7	3.1581345E-7
aristotle	51	2.3009266E-6
aristrockracy	1	4.5116206E-8
aristú	1	4.5116206E-8
arithmetic	81	3.6544127E-6
arithmetical	5	2.2558103E-7
arithmetically	3	1.3534861E-7
arithmetric	1	4.5116206E-8
aritsugu	1	4.5116206E-8
ariv	2	9.023241E-8
arivaca	1	4.5116206E-8
ariway	1	4.5116206E-8
arix	16	7.218593E-7
arixmutation	1	4.5116206E-8
ariya	1	4.5116206E-8
ariz	64	2.8874372E-6
ariz-fire-indians	3	1.3534861E-7
arizmendi	2	9.023241E-8
arizona	738	3.329576E-5
arizona-based	3	1.3534861E-7
arizonan	1	4.5116206E-8
arizonans	6	2.7069723E-7
arizonarepublic	23	1.0376727E-6
arjen	1	4.5116206E-8
arjun	1	4.5116206E-8
arjuna	1	4.5116206E-8
ark	62	2.7972048E-6
arkaden	2	9.023241E-8
arkadíou	2	9.023241E-8
arkan	5	2.2558103E-7
arkansan	1	4.5116206E-8
arkansans	1	4.5116206E-8
arkansas	298	1.344463E-5
arkansas-based	3	1.3534861E-7
arkard	1	4.5116206E-8
arkart	1	4.5116206E-8
arkasota	1	4.5116206E-8
arked	1	4.5116206E-8
arkeoloji	1	4.5116206E-8
arkestra	6	2.7069723E-7
arkham	2	9.023241E-8
arkhipelag	1	4.5116206E-8
arkie	1	4.5116206E-8
arkin	7	3.1581345E-7
arkla	1	4.5116206E-8
arkle	1	4.5116206E-8
arkwright	3	1.3534861E-7
arkádi	2	9.023241E-8
arl	12	5.4139446E-7
arledge	11	4.962783E-7
arlen	34	1.533951E-6
arlene	18	8.1209174E-7
arlequin	2	9.023241E-8
arles	19	8.572079E-7
arlet	1	4.5116206E-8
arlett	1	4.5116206E-8
arletta	3	1.3534861E-7
arli	1	4.5116206E-8
arlie	10	4.5116207E-7
arlington	255	1.1504632E-5
arlinton	1	4.5116206E-8
arliss	1	4.5116206E-8
arlo	1	4.5116206E-8
arlozorof	1	4.5116206E-8
arly	1	4.5116206E-8
arm	1033	4.660504E-5
arm-alone	2	9.023241E-8
arm-around-the-shoulder	1	4.5116206E-8
arm-by-arm	1	4.5116206E-8
arm-distal	9	4.0604587E-7
arm-fz	4	1.8046482E-7
arm-holes	1	4.5116206E-8
arm-in-arm	1	4.5116206E-8
arm-less	1	4.5116206E-8
arm-like	1	4.5116206E-8
arm-loppage	1	4.5116206E-8
arm-task	2	9.023241E-8
arm-thick	1	4.5116206E-8
arm-twisting	13	5.865107E-7
arm-waving	1	4.5116206E-8
arm-wrestle	2	9.023241E-8
arm-wrestles	1	4.5116206E-8
arm-wrestling	1	4.5116206E-8
armada	11	4.962783E-7
armadas	1	4.5116206E-8
armadillo	19	8.572079E-7
armadillos	4	1.8046482E-7
armado	1	4.5116206E-8
armageddon	61	2.7520887E-6
armageddon-clone	1	4.5116206E-8
armageddon-time	1	4.5116206E-8
armaggeddon	1	4.5116206E-8
armaggedon	4	1.8046482E-7
armagh	2	9.023241E-8
armament	3	1.3534861E-7
armamentarium	4	1.8046482E-7
armaments	8	3.6092965E-7
armand	11	4.962783E-7
armando	9	4.0604587E-7
armani	37	1.6692996E-6
armapophar	2	9.023241E-8
armar	1	4.5116206E-8
armas	14	6.316269E-7
armathwaite	1	4.5116206E-8
armature	1	4.5116206E-8
armação	2	9.023241E-8
armband	2	9.023241E-8
armbands	5	2.2558103E-7
armbar	1	4.5116206E-8
armbars	2	9.023241E-8
armbro	1	4.5116206E-8
armbrust	4	1.8046482E-7
armbuster	1	4.5116206E-8
armc	1	4.5116206E-8
armchair	30	1.3534863E-6
armchairs	10	4.5116207E-7
armdageddon	1	4.5116206E-8
armed	487	2.1971593E-5
armed-citizen	1	4.5116206E-8
armed-forces	1	4.5116206E-8
armen	16	7.218593E-7
armenia	34	1.533951E-6
armenia-specific	2	9.023241E-8
armenian	50	2.2558104E-6
armenians	9	4.0604587E-7
armeria	1	4.5116206E-8
armería	2	9.023241E-8
armes	8	3.6092965E-7
armesto	1	4.5116206E-8
armey	197	8.887892E-6
armey-retire	2	9.023241E-8
armfuls	1	4.5116206E-8
armholes	2	9.023241E-8
armi	1	4.5116206E-8
armidale	1	4.5116206E-8
armies	118	5.3237122E-6
armigera	3	1.3534861E-7
armii	1	4.5116206E-8
armiles	1	4.5116206E-8
armin	3	1.3534861E-7
armina	3	1.3534861E-7
arming	40	1.8046483E-6
arminio	2	9.023241E-8
armisen	1	4.5116206E-8
armistead	1	4.5116206E-8
armistice	10	4.5116207E-7
armitage	43	1.939997E-6
armitt	2	9.023241E-8
armload	2	9.023241E-8
armoire	8	3.6092965E-7
armoires	1	4.5116206E-8
armon	1	4.5116206E-8
armona	1	4.5116206E-8
armonk	1	4.5116206E-8
armor	82	3.6995289E-6
armor-piercing	1	4.5116206E-8
armor-plated	1	4.5116206E-8
armor-plating	1	4.5116206E-8
armored	50	2.2558104E-6
armored-car	1	4.5116206E-8
armored-plated	1	4.5116206E-8
armorers	2	9.023241E-8
armories	1	4.5116206E-8
armorique	1	4.5116206E-8
armory	11	4.962783E-7
armour	7	3.1581345E-7
armoured	1	4.5116206E-8
armouries	1	4.5116206E-8
armoury	2	9.023241E-8
armpit	22	9.925566E-7
armpits	9	4.0604587E-7
armrest	2	9.023241E-8
arms	1086	4.89962E-5
arms-control	2	9.023241E-8
arms-cut	1	4.5116206E-8
arms-dealing	1	4.5116206E-8
arms-for-hostages	8	3.6092965E-7
arms-manufacturing	1	4.5116206E-8
arms-pcr	2	9.023241E-8
arms-reduction	1	4.5116206E-8
arms-selling	2	9.023241E-8
arms-shopping	1	4.5116206E-8
arms-smuggling	1	4.5116206E-8
arms-toting	1	4.5116206E-8
armstead	5	2.2558103E-7
armstong	1	4.5116206E-8
armstrong	664	2.9957162E-5
armstrongs	1	4.5116206E-8
armsunbending	1	4.5116206E-8
armwrestling	1	4.5116206E-8
army	1497	6.753896E-5
army-domestic-violence	1	4.5116206E-8
army-language	1	4.5116206E-8
army-navy	1	4.5116206E-8
army-technology	1	4.5116206E-8
armée	6	2.7069723E-7
armó	1	4.5116206E-8
arn	4	1.8046482E-7
arna	54	2.436275E-6
arna-based	1	4.5116206E-8
arnaldo	1	4.5116206E-8
arnamai	3	1.3534861E-7
arnaout	16	7.218593E-7
arnatsiaq	1	4.5116206E-8
arnaud	2	9.023241E-8
arnault	7	3.1581345E-7
arnavutköy	2	9.023241E-8
arnaz	1	4.5116206E-8
arndt	2	9.023241E-8
arne	3	1.3534861E-7
arner	2	9.023241E-8
arnet	1	4.5116206E-8
arnett	17	7.669755E-7
arni	1	4.5116206E-8
arnica	4	1.8046482E-7
arnie	7	3.1581345E-7
arnies	2	9.023241E-8
arnimallee	1	4.5116206E-8
arno	14	6.316269E-7
arnold	252	1.1369284E-5
arnoldian	1	4.5116206E-8
arnoldo	3	1.3534861E-7
arnolds	1	4.5116206E-8
arnolfini	1	4.5116206E-8
arnolfo	6	2.7069723E-7
arnott	9	4.0604587E-7
arnow	2	9.023241E-8
arnp	2	9.023241E-8
arnt	3	1.3534861E-7
arntz	1	4.5116206E-8
arnu	1	4.5116206E-8
aroa	38	1.7144158E-6
arob	14	6.316269E-7
aroc	2	9.023241E-8
aroche	1	4.5116206E-8
aroclor	1	4.5116206E-8
arod	1	4.5116206E-8
aroe	1	4.5116206E-8
arof	2	9.023241E-8
arog	2	9.023241E-8
arogenate	10	4.5116207E-7
arogenate-specificity	1	4.5116206E-8
arogers	1	4.5116206E-8
aroh	8	3.6092965E-7
arok	1	4.5116206E-8
arol	1	4.5116206E-8
arola	2	9.023241E-8
arollos	1	4.5116206E-8
aroma	34	1.533951E-6
aromahealthtexas	1	4.5116206E-8
aromas	24	1.0827889E-6
aromatase	12	5.4139446E-7
aromatherapist	1	4.5116206E-8
aromatherapists	1	4.5116206E-8
aromatherapy	7	3.1581345E-7
aromatic	95	4.2860397E-6
aromatic-pathway	3	1.3534861E-7
aromatically	1	4.5116206E-8
aromaticivorans	1	4.5116206E-8
aromatics	1	4.5116206E-8
aron	13	5.865107E-7
arona	2	9.023241E-8
aronne	3	1.3534861E-7
aronofsky	3	1.3534861E-7
aronow	1	4.5116206E-8
aronowitz	2	9.023241E-8
arons	4	1.8046482E-7
aronsohn	1	4.5116206E-8
aronson	5	2.2558103E-7
arooaroo	2	9.023241E-8
aroq	103	4.6469695E-6
aror	6	2.7069723E-7
arora	1	4.5116206E-8
arosa	1	4.5116206E-8
arose	220	9.925566E-6
aross	2	9.023241E-8
arou	1	4.5116206E-8
aroud	1	4.5116206E-8
around	12145	5.479363E-4
around-comes	1	4.5116206E-8
around-the	3	1.3534861E-7
around-the-clock	7	3.1581345E-7
around-the-world	10	4.5116207E-7
around-town	1	4.5116206E-8
arounder	1	4.5116206E-8
arounds	1	4.5116206E-8
arousal	18	8.1209174E-7
arouse	21	9.4744036E-7
aroused	48	2.1655778E-6
arouser	1	4.5116206E-8
arouses	12	5.4139446E-7
arousing	9	4.0604587E-7
arowana	4	1.8046482E-7
arp	41	1.8497644E-6
arpa	1	4.5116206E-8
arpana	1	4.5116206E-8
arpanet	5	2.2558103E-7
arpe	22	9.925566E-7
arpeggiated	1	4.5116206E-8
arpeggio	1	4.5116206E-8
arpeggios	1	4.5116206E-8
arpel	1	4.5116206E-8
arpens	1	4.5116206E-8
arpet	1	4.5116206E-8
arpey	2	9.023241E-8
arppaapp	1	4.5116206E-8
arpppapp	1	4.5116206E-8
arps	4	1.8046482E-7
arpád	5	2.2558103E-7
arqueologica	1	4.5116206E-8
arqueología	2	9.023241E-8
arqueològic	2	9.023241E-8
arqueológico	15	6.767431E-7
arquett	1	4.5116206E-8
arquette	34	1.533951E-6
arquitectes	1	4.5116206E-8
arquitectura	1	4.5116206E-8
arr	49	2.2106942E-6
arr-specific	1	4.5116206E-8
arra	1	4.5116206E-8
arrabiata	1	4.5116206E-8
arrabiatta	1	4.5116206E-8
arrah	1	4.5116206E-8
arraigned	12	5.4139446E-7
arraignment	18	8.1209174E-7
arraiolos	2	9.023241E-8
arrakis	1	4.5116206E-8
arran	4	1.8046482E-7
arrange	194	8.752544E-6
arranged	389	1.7550205E-5
arrangement	314	1.4166489E-5
arrangements	288	1.2993468E-5
arrangements-in	2	9.023241E-8
arranger	13	5.865107E-7
arrangers	1	4.5116206E-8
arranges	7	3.1581345E-7
arranging	71	3.2032506E-6
arrangments	1	4.5116206E-8
arrant	3	1.3534861E-7
arraras	1	4.5116206E-8
arras	5	2.2558103E-7
array	1088	4.9086433E-5
array-and-string	1	4.5116206E-8
array-based	4	1.8046482E-7
array-bound	1	4.5116206E-8
array-id	3	1.3534861E-7
array-level	1	4.5116206E-8
array-specific	2	9.023241E-8
array-to-array	3	1.3534861E-7
array-wise	1	4.5116206E-8
arraydesign	5	2.2558103E-7
arraydesigns	2	9.023241E-8
arrayed	29	1.30837E-6
arrayer	7	3.1581345E-7
arrayexpress	10	4.5116207E-7
arraygroup	2	9.023241E-8
arraying	3	1.3534861E-7
arraymaker	1	4.5116206E-8
arrayoligoselector	17	7.669755E-7
arrays	717	3.2348322E-5
arraysuite	1	4.5116206E-8
arraytools	1	4.5116206E-8
arrayvision	2	9.023241E-8
arrearage	1	4.5116206E-8
arrears	10	4.5116207E-7
arrecife	3	1.3534861E-7
arrendataria	1	4.5116206E-8
arrephoroi	1	4.5116206E-8
arres	1	4.5116206E-8
arrest	597	2.6934375E-5
arrest-associated	1	4.5116206E-8
arrest-proficient	1	4.5116206E-8
arrest-slaying	1	4.5116206E-8
arrest-story	1	4.5116206E-8
arrested	634	2.8603676E-5
arrestee	2	9.023241E-8
arrestees	2	9.023241E-8
arrestin	6	2.7069723E-7
arrestin-dependent	1	4.5116206E-8
arresting	57	2.5716238E-6
arrestins	1	4.5116206E-8
arrests	128	5.7748744E-6
arrests-very	1	4.5116206E-8
arrggggh	1	4.5116206E-8
arrgghh	3	1.3534861E-7
arrgh	27	1.2181375E-6
arrghh	1	4.5116206E-8
arrghhh	1	4.5116206E-8
arrhenius	2	9.023241E-8
arrhthmia	1	4.5116206E-8
arrhythmia	14	6.316269E-7
arrhythmias	24	1.0827889E-6
arrhythmic	9	4.0604587E-7
arrhythmically	1	4.5116206E-8
arrhythmicity	2	9.023241E-8
arrhythmogenic	1	4.5116206E-8
arri	1	4.5116206E-8
arriaga	8	3.6092965E-7
arriagada	2	9.023241E-8
arriba	1	4.5116206E-8
arrick	2	9.023241E-8
arrifana	1	4.5116206E-8
arrigan	6	2.7069723E-7
arrigo	2	9.023241E-8
arrijalu	1	4.5116206E-8
arrington	5	2.2558103E-7
arripui	1	4.5116206E-8
arris	1	4.5116206E-8
arrison	1	4.5116206E-8
arrival	376	1.6963693E-5
arrivals	49	2.2106942E-6
arrive	434	1.9580433E-5
arrived	918	4.141668E-5
arrivees	1	4.5116206E-8
arrives	164	7.3990577E-6
arriving	214	9.654868E-6
arriviste	1	4.5116206E-8
arrivistes	2	9.023241E-8
arrizoli	2	9.023241E-8
arrizón	1	4.5116206E-8
arrobas	1	4.5116206E-8
arrogance	108	4.87255E-6
arrogant	104	4.6920854E-6
arrogantly	4	1.8046482E-7
arrogare	1	4.5116206E-8
arrogated	1	4.5116206E-8
arrojo	9	4.0604587E-7
arromanches	1	4.5116206E-8
arron	1	4.5116206E-8
arrondisiment	1	4.5116206E-8
arrondissement	6	2.7069723E-7
arrondissements	2	9.023241E-8
arrot	1	4.5116206E-8
arrota	1	4.5116206E-8
arroux	1	4.5116206E-8
arrow	224	1.01060305E-5
arrow-bearing	1	4.5116206E-8
arrow-stab	1	4.5116206E-8
arrow-straight	2	9.023241E-8
arroway	5	2.2558103E-7
arrowed	1	4.5116206E-8
arrowhead	58	2.61674E-6
arrowheads	40	1.8046483E-6
arrowood	3	1.3534861E-7
arrows	197	8.887892E-6
arroyo	7	3.1581345E-7
arroz	3	1.3534861E-7
arrozricemelocotónpeach	1	4.5116206E-8
arrr-eye-pee	3	1.3534861E-7
arrrg	1	4.5116206E-8
arrrggghghgh	1	4.5116206E-8
arrrggghh	1	4.5116206E-8
arrrggh	1	4.5116206E-8
arrrgh	8	3.6092965E-7
arrrghh	1	4.5116206E-8
arrrr	3	1.3534861E-7
arrrrggggghhhhh	1	4.5116206E-8
arrrrgh	2	9.023241E-8
arrrrr	4	1.8046482E-7
arrrrrgh	1	4.5116206E-8
arrrrrrr	1	4.5116206E-8
arrrrrrrrgh	1	4.5116206E-8
arrrrrrrrrgh	1	4.5116206E-8
arrthymia	1	4.5116206E-8
arruda	1	4.5116206E-8
arry	1	4.5116206E-8
arrábida	4	1.8046482E-7
arráez	1	4.5116206E-8
ars	141	6.361385E-6
arsa	6	2.7069723E-7
arsakhanova	3	1.3534861E-7
arsb	6	2.7069723E-7
arsc	94	4.2409233E-6
arsd	5	2.2558103E-7
arsdmut	1	4.5116206E-8
arse	22	9.925566E-7
arsed	5	2.2558103E-7
arseiam	1	4.5116206E-8
arsenal	74	3.3385993E-6
arsenali	1	4.5116206E-8
arsenals	12	5.4139446E-7
arsenate	41	1.8497644E-6
arsenault	4	1.8046482E-7
arsenec	1	4.5116206E-8
arsenic	94	4.2409233E-6
arsenic-contaminated	2	9.023241E-8
arsenic-heavy	1	4.5116206E-8
arsenic-induced	2	9.023241E-8
arsenic-tainted	1	4.5116206E-8
arsenio	16	7.218593E-7
arsenite	13	5.865107E-7
arsenite-cerate	1	4.5116206E-8
arsenite-specific	1	4.5116206E-8
arsenite-stimulated	1	4.5116206E-8
arsepiss	1	4.5116206E-8
arses	4	1.8046482E-7
arsh	6	2.7069723E-7
arshile	1	4.5116206E-8
arsi	1	4.5116206E-8
arsinoe	1	4.5116206E-8
arsinoion	1	4.5116206E-8
arsinée	1	4.5116206E-8
arson	30	1.3534863E-6
arson-caused	2	9.023241E-8
arson-for-profit	1	4.5116206E-8
arsonist	8	3.6092965E-7
arsonists	4	1.8046482E-7
arsons	4	1.8046482E-7
arsr	1	4.5116206E-8
arsénio	1	4.5116206E-8
art	3679	1.6598252E-4
art-advisory	1	4.5116206E-8
art-ambition	1	4.5116206E-8
art-book	1	4.5116206E-8
art-buying	1	4.5116206E-8
art-cinema	1	4.5116206E-8
art-collection	1	4.5116206E-8
art-deco	1	4.5116206E-8
art-film	1	4.5116206E-8
art-harvard	1	4.5116206E-8
art-historical	3	1.3534861E-7
art-historically	1	4.5116206E-8
art-history-minded	1	4.5116206E-8
art-house	22	9.925566E-7
art-linkletter	1	4.5116206E-8
art-lover	1	4.5116206E-8
art-lovers	2	9.023241E-8
art-mediated	3	1.3534861E-7
art-punk	1	4.5116206E-8
art-related	2	9.023241E-8
art-rock	1	4.5116206E-8
art-school	1	4.5116206E-8
art-slogan	1	4.5116206E-8
art-song	2	9.023241E-8
art-supplies	1	4.5116206E-8
art-treated	1	4.5116206E-8
art-world	2	9.023241E-8
arta	4	1.8046482E-7
artagnan	6	2.7069723E-7
artaud	14	6.316269E-7
artc	5	2.2558103E-7
artd	25	1.1279052E-6
arte	32	1.4437186E-6
arteanunk	1	4.5116206E-8
artec	1	4.5116206E-8
artefact	9	4.0604587E-7
artefacts	11	4.962783E-7
artefactually	1	4.5116206E-8
artemether	3	1.3534861E-7
artemia	15	6.767431E-7
artemis	25	1.1279052E-6
artemisia	126	5.684642E-6
artemisia-group	1	4.5116206E-8
artemisias	4	1.8046482E-7
artemisiastrum	1	4.5116206E-8
artemisiatrum	1	4.5116206E-8
artemisiinae	36	1.6241835E-6
artemisinin	5	2.2558103E-7
artemisinin-based	2	9.023241E-8
artemisinins	3	1.3534861E-7
artemision	1	4.5116206E-8
artemon	1	4.5116206E-8
artenara	1	4.5116206E-8
arter	2	9.023241E-8
arteria	1	4.5116206E-8
arterial	237	1.0692541E-5
arterialized	1	4.5116206E-8
arteries	112	5.0530152E-6
arteriogenesis	2	9.023241E-8
arteriography	2	9.023241E-8
arteriolar	1	4.5116206E-8
arterioles	2	9.023241E-8
arteriolosclerosis	2	9.023241E-8
arteriopathy	3	1.3534861E-7
arteriosclerosis	5	2.2558103E-7
arteriosclerotic	1	4.5116206E-8
arteriosus	1	4.5116206E-8
arteriotomy	1	4.5116206E-8
arteriovenous	3	1.3534861E-7
artery	243	1.0963238E-5
artes	12	5.4139446E-7
artesania	1	4.5116206E-8
artesanìas	1	4.5116206E-8
artesanía	6	2.7069723E-7
artesanías	2	9.023241E-8
artesian	3	1.3534861E-7
artesonado	1	4.5116206E-8
artesunate	5	2.2558103E-7
arteta	2	9.023241E-8
artex	2	9.023241E-8
arte­sanato	1	4.5116206E-8
artforum	1	4.5116206E-8
artful	46	2.0753455E-6
artfully	31	1.3986024E-6
artfully-torn	1	4.5116206E-8
artfullyby	1	4.5116206E-8
arth	2	9.023241E-8
artho	1	4.5116206E-8
arthogenic	1	4.5116206E-8
arthouse	2	9.023241E-8
arthouses	1	4.5116206E-8
arthousey	1	4.5116206E-8
arthralgias	1	4.5116206E-8
arthritic	73	3.2934831E-6
arthritically	1	4.5116206E-8
arthritides	5	2.2558103E-7
arthritis	422	1.903904E-5
arthritis-hobbled	1	4.5116206E-8
arthritis-resistant	1	4.5116206E-8
arthritis-susceptible	1	4.5116206E-8
arthritogenic	2	9.023241E-8
arthrocentesis	1	4.5116206E-8
arthroconidia	2	9.023241E-8
arthropathies	4	1.8046482E-7
arthropathy	6	2.7069723E-7
arthroplasties	1	4.5116206E-8
arthroplasty	19	8.572079E-7
arthropod	8	3.6092965E-7
arthropod-chordate	1	4.5116206E-8
arthropoda	4	1.8046482E-7
arthropods	21	9.4744036E-7
arthroraphis	1	4.5116206E-8
arthroscopic	11	4.962783E-7
arthroscopically	1	4.5116206E-8
arthroscopy	3	1.3534861E-7
arthur	497	2.2422755E-5
arthurian	7	3.1581345E-7
arthurs	1	4.5116206E-8
arti	2	9.023241E-8
artic	3	1.3534861E-7
artical	1	4.5116206E-8
artichoke	27	1.2181375E-6
artichokes	8	3.6092965E-7
article	3108	1.4022116E-4
articleid	1	4.5116206E-8
articles	1015	4.579295E-5
articles-the	1	4.5116206E-8
articular	28	1.2632538E-6
articulate	151	6.8125473E-6
articulated	68	3.067902E-6
articulately	2	9.023241E-8
articulates	11	4.962783E-7
articulating	14	6.316269E-7
articulation	18	8.1209174E-7
articulations	1	4.5116206E-8
articulators	1	4.5116206E-8
articulatory	7	3.1581345E-7
artie	5	2.2558103E-7
artiellia	3	1.3534861E-7
artier	3	1.3534861E-7
artifact	88	3.9702263E-6
artifact-free	3	1.3534861E-7
artifact-y	1	4.5116206E-8
artifacts	326	1.4707884E-5
artifactual	30	1.3534863E-6
artifactually	5	2.2558103E-7
artifical	1	4.5116206E-8
artifice	32	1.4437186E-6
artificer	1	4.5116206E-8
artifices	1	4.5116206E-8
artificial	383	1.7279508E-5
artificial-intelligence	1	4.5116206E-8
artificial-vision	1	4.5116206E-8
artificiality	4	1.8046482E-7
artificially	64	2.8874372E-6
artillery	60	2.7069725E-6
artillery-wielding	1	4.5116206E-8
artilleryman	1	4.5116206E-8
artillerymen	2	9.023241E-8
artimedes	1	4.5116206E-8
artin	3	1.3534861E-7
artiness	1	4.5116206E-8
artis	10	4.5116207E-7
artisan	26	1.1730214E-6
artisanal	19	8.572079E-7
artisans	70	3.1581344E-6
artist	732	3.3025062E-5
artist-blacksmith	1	4.5116206E-8
artist-phenomenon	1	4.5116206E-8
artiste	4	1.8046482E-7
artistes	3	1.3534861E-7
artistic	368	1.6602764E-5
artistic-like	1	4.5116206E-8
artistically	26	1.1730214E-6
artistry	25	1.1279052E-6
artists	880	3.9702263E-5
artists-u	1	4.5116206E-8
artless	9	4.0604587E-7
artlessly	3	1.3534861E-7
artlessness	5	2.2558103E-7
artnet	5	2.2558103E-7
artnews	2	9.023241E-8
arto	1	4.5116206E-8
artrell	1	4.5116206E-8
artrutx	1	4.5116206E-8
arts	990	4.4665045E-5
arts-and-crafts	3	1.3534861E-7
arts-and-craftsy	1	4.5116206E-8
arts-index-worthy	1	4.5116206E-8
arts-like	1	4.5116206E-8
arts-n-crafts	1	4.5116206E-8
arts-only	1	4.5116206E-8
arts-section	1	4.5116206E-8
arts-service	1	4.5116206E-8
artsier	1	4.5116206E-8
artstrings	1	4.5116206E-8
artsy	12	5.4139446E-7
artsy-craftsy	1	4.5116206E-8
artsy-fartsies	2	9.023241E-8
artsy-fartsy	3	1.3534861E-7
artur	3	1.3534861E-7
arturo	6	2.7069723E-7
artwork	57	2.5716238E-6
artworks	21	9.4744036E-7
arty	22	9.925566E-7
artystyczna	1	4.5116206E-8
artà	6	2.7069723E-7
aru	1	4.5116206E-8
arub	2	9.023241E-8
aruba	5	2.2558103E-7
arucas	2	9.023241E-8
arugula	19	8.572079E-7
arukeba	1	4.5116206E-8
aruldhas	1	4.5116206E-8
aruldhases	1	4.5116206E-8
arum	1	4.5116206E-8
arun	2	9.023241E-8
arunachal	1	4.5116206E-8
arundel	6	2.7069723E-7
arundhati	11	4.962783E-7
arup	1	4.5116206E-8
arure	2	9.023241E-8
arusha	3	1.3534861E-7
arv	32	1.4437186E-6
arv-implementation	1	4.5116206E-8
arvada	1	4.5116206E-8
arvato	1	4.5116206E-8
arvensis	1	4.5116206E-8
arvey	1	4.5116206E-8
arvigarus	1	4.5116206E-8
arvin	3	1.3534861E-7
arvind	1	4.5116206E-8
arvo	6	2.7069723E-7
arvs	54	2.436275E-6
arvydas	1	4.5116206E-8
arway	1	4.5116206E-8
arwen	9	4.0604587E-7
ary	2	9.023241E-8
aryabhatt	1	4.5116206E-8
aryan	20	9.0232413E-7
aryans	14	6.316269E-7
aryeh	3	1.3534861E-7
aryl	11	4.962783E-7
arylacetamide	2	9.023241E-8
aryland	1	4.5116206E-8
arz	1	4.5116206E-8
arzey-garzeys	2	9.023241E-8
arzú	1	4.5116206E-8
arènes	5	2.2558103E-7
as	125442	0.005659467
as-excellent	1	4.5116206E-8
as-hell	1	4.5116206E-8
as-if	1	4.5116206E-8
as-is	1	4.5116206E-8
as-long-as-it	1	4.5116206E-8
as-needed	1	4.5116206E-8
as-of-yet	1	4.5116206E-8
as-one	1	4.5116206E-8
as-promised	1	4.5116206E-8
as-specific	3	1.3534861E-7
as-sukuut	1	4.5116206E-8
as-told-to	1	4.5116206E-8
as-treated	3	1.3534861E-7
as-yet	8	3.6092965E-7
as-yet-unborn	1	4.5116206E-8
as-yet-uncommitted	1	4.5116206E-8
as-yet-undescribed	1	4.5116206E-8
as-yet-undetermined	1	4.5116206E-8
as-yet-undiscovered	1	4.5116206E-8
as-yet-unexplored	1	4.5116206E-8
as-yet-ungentrified	1	4.5116206E-8
as-yet-unheard	1	4.5116206E-8
as-yet-unidentified	1	4.5116206E-8
as-yet-unknown	2	9.023241E-8
as-yet-untold	2	9.023241E-8
as-yet-untouched	1	4.5116206E-8
as-yet-unwritten	1	4.5116206E-8
as-you-go	1	4.5116206E-8
asa	32	1.4437186E-6
asa-pilot	2	9.023241E-8
asada	1	4.5116206E-8
asado	1	4.5116206E-8
asaf	1	4.5116206E-8
asah	1	4.5116206E-8
asahi	47	2.1204617E-6
asaichi	1	4.5116206E-8
asakura	1	4.5116206E-8
asakusa	12	5.4139446E-7
asal	1	4.5116206E-8
asalto	1	4.5116206E-8
asamblea	1	4.5116206E-8
asamoah	1	4.5116206E-8
asan	6	2.7069723E-7
asano	6	2.7069723E-7
asante	1	4.5116206E-8
asantes	1	4.5116206E-8
asap	48	2.1655778E-6
asappropriate	1	4.5116206E-8
asb	1	4.5116206E-8
asbestos	57	2.5716238E-6
asbestos-related	2	9.023241E-8
asbetsos	1	4.5116206E-8
asbhy	1	4.5116206E-8
asbt	52	2.3460427E-6
asbury	13	5.865107E-7
asc	2	9.023241E-8
ascain	1	4.5116206E-8
ascap	1	4.5116206E-8
ascared	2	9.023241E-8
ascarid	3	1.3534861E-7
ascaris	8	3.6092965E-7
ascend	38	1.7144158E-6
ascendance	13	5.865107E-7
ascendancy	30	1.3534863E-6
ascendant	4	1.8046482E-7
ascended	43	1.939997E-6
ascendent	3	1.3534861E-7
ascending	71	3.2032506E-6
ascending-bid	2	9.023241E-8
ascends	12	5.4139446E-7
ascendy	2	9.023241E-8
ascension	33	1.4888349E-6
ascent	63	2.842321E-6
ascents	7	3.1581345E-7
ascertain	74	3.3385993E-6
ascertainable	1	4.5116206E-8
ascertained	47	2.1204617E-6
ascertaining	7	3.1581345E-7
ascertainment	22	9.925566E-7
ascesis	1	4.5116206E-8
ascetic	20	9.0232413E-7
asceticism	8	3.6092965E-7
ascetics	1	4.5116206E-8
asch	6	2.7069723E-7
aschatz	3	1.3534861E-7
aschenbrenner	3	1.3534861E-7
ascher	9	4.0604587E-7
aschoffs	1	4.5116206E-8
aschroft	1	4.5116206E-8
asci	21	9.4744036E-7
ascidians	2	9.023241E-8
ascii	16	7.218593E-7
ascii-based	2	9.023241E-8
ascites	12	5.4139446E-7
ascitic	8	3.6092965E-7
asclepieion	1	4.5116206E-8
asclepion	3	1.3534861E-7
asclepium	1	4.5116206E-8
asclepius	1	4.5116206E-8
asco	1	4.5116206E-8
ascomycetes	4	1.8046482E-7
ascomycota	3	1.3534861E-7
ascorbate	5	2.2558103E-7
ascorbic	34	1.533951E-6
ascot	6	2.7069723E-7
ascovirus	1	4.5116206E-8
ascr	13	5.865107E-7
ascribable	4	1.8046482E-7
ascribe	25	1.1279052E-6
ascribed	54	2.436275E-6
ascribes	5	2.2558103E-7
ascribing	6	2.7069723E-7
ascription	3	1.3534861E-7
ascus	2	9.023241E-8
ascvd	4	1.8046482E-7
asd	8	3.6092965E-7
asdlkjd	1	4.5116206E-8
ase	56	2.5265076E-6
ase-vacuolar	1	4.5116206E-8
asebogenin	2	9.023241E-8
asec	1	4.5116206E-8
asecond	2	9.023241E-8
asee	1	4.5116206E-8
aseem	1	4.5116206E-8
asefi	1	4.5116206E-8
aseida	3	1.3534861E-7
aseltine	1	4.5116206E-8
asemissions	1	4.5116206E-8
asenali	1	4.5116206E-8
asending	1	4.5116206E-8
aseparate	1	4.5116206E-8
aseptic	6	2.7069723E-7
aseptically	4	1.8046482E-7
ases	9	4.0604587E-7
asexual	53	2.391159E-6
asexuality	3	1.3534861E-7
asexually	8	3.6092965E-7
asexually-produced	2	9.023241E-8
asexuals	1	4.5116206E-8
aseyi	1	4.5116206E-8
asf	5	2.2558103E-7
asfar	1	4.5116206E-8
asfarviruses	1	4.5116206E-8
asfendiou	1	4.5116206E-8
asgods	2	9.023241E-8
ash	211	9.51952E-6
ash-covered	3	1.3534861E-7
ash-filled	1	4.5116206E-8
ash-swept	1	4.5116206E-8
ash-tree	1	4.5116206E-8
asha	2	9.023241E-8
ashall	1	4.5116206E-8
asham	1	4.5116206E-8
ashamed	120	5.413945E-6
ashanti	8	3.6092965E-7
asharq	14	6.316269E-7
ashbery	6	2.7069723E-7
ashbrook	1	4.5116206E-8
ashburn	2	9.023241E-8
ashburner	1	4.5116206E-8
ashbury	9	4.0604587E-7
ashby	35	1.5790672E-6
ashcroft	304	1.37153265E-5
ashcroft-guns	1	4.5116206E-8
ashcroft-ian	1	4.5116206E-8
ashdown	1	4.5116206E-8
ashe	13	5.865107E-7
asheim	2	9.023241E-8
ashen	7	3.1581345E-7
ashen-faced	1	4.5116206E-8
ashenfelter	4	1.8046482E-7
asher	17	7.669755E-7
ashes	98	4.4213884E-6
asheville	8	3.6092965E-7
ashford	11	4.962783E-7
ashforth	1	4.5116206E-8
ashi	3	1.3534861E-7
ashif	1	4.5116206E-8
ashikaga	6	2.7069723E-7
ashing	1	4.5116206E-8
ashinstitute	1	4.5116206E-8
ashish	3	1.3534861E-7
ashitaka	6	2.7069723E-7
ashkanazi	1	4.5116206E-8
ashkelon	1	4.5116206E-8
ashkenaz	4	1.8046482E-7
ashkenazi	10	4.5116207E-7
ashkenazic	2	9.023241E-8
ashkenazim	3	1.3534861E-7
ashkenazy	1	4.5116206E-8
ashkhabad	1	4.5116206E-8
ashkin	3	1.3534861E-7
ashland	3	1.3534861E-7
ashlars	3	1.3534861E-7
ashleighs	1	4.5116206E-8
ashley	73	3.2934831E-6
ashleyism	1	4.5116206E-8
ashleys	1	4.5116206E-8
ashman	1	4.5116206E-8
ashmeadi	1	4.5116206E-8
ashmolean	2	9.023241E-8
ashness	2	9.023241E-8
ashok	2	9.023241E-8
ashoka	27	1.2181375E-6
ashord	1	4.5116206E-8
ashore	46	2.0753455E-6
ashores	1	4.5116206E-8
ashour	1	4.5116206E-8
ashowed	1	4.5116206E-8
ashows	61	2.7520887E-6
ashrae	3	1.3534861E-7
ashraf	4	1.8046482E-7
ashram	3	1.3534861E-7
ashrams	1	4.5116206E-8
ashrawi	1	4.5116206E-8
ashtabula	1	4.5116206E-8
ashtanga	2	9.023241E-8
ashtareth	6	2.7069723E-7
ashton	24	1.0827889E-6
ashtown	1	4.5116206E-8
ashtray	16	7.218593E-7
ashtrays	2	9.023241E-8
ashutosh	1	4.5116206E-8
ashville	1	4.5116206E-8
ashwander	1	4.5116206E-8
ashy	5	2.2558103E-7
asi	6	2.7069723E-7
asia	747	3.3701806E-5
asia-focused	1	4.5116206E-8
asia-including	1	4.5116206E-8
asia-specific	1	4.5116206E-8
asiadontic	1	4.5116206E-8
asiago	1	4.5116206E-8
asialo	2	9.023241E-8
asian	778	3.510041E-5
asian-americans	2	9.023241E-8
asian-built	2	9.023241E-8
asian-plurality	1	4.5116206E-8
asian-style	2	9.023241E-8
asianlens	1	4.5116206E-8
asians	106	4.782318E-6
asiarch	1	4.5116206E-8
asiatic	11	4.962783E-7
asics	2	9.023241E-8
asida	1	4.5116206E-8
aside	986	4.448458E-5
asides	24	1.0827889E-6
asile	1	4.5116206E-8
asilidae	1	4.5116206E-8
asimakis	2	9.023241E-8
asimilar	1	4.5116206E-8
asimov	50	2.2558104E-6
asimplified	1	4.5116206E-8
asin	2	9.023241E-8
asinara	1	4.5116206E-8
asinelli	1	4.5116206E-8
asingleaddress	1	4.5116206E-8
asingsing	1	4.5116206E-8
asinine	10	4.5116207E-7
asinus	1	4.5116206E-8
asir	1	4.5116206E-8
ask	3069	1.3846163E-4
ask-ee	1	4.5116206E-8
ask-notting	1	4.5116206E-8
askance	15	6.767431E-7
askanischer	1	4.5116206E-8
askar	5	2.2558103E-7
asked	4326	1.9517272E-4
asked-for	1	4.5116206E-8
asked-or	1	4.5116206E-8
asked-whether	1	4.5116206E-8
askedtenet	1	4.5116206E-8
askeeeeert	3	1.3534861E-7
askeered	1	4.5116206E-8
askeert	1	4.5116206E-8
askeri	1	4.5116206E-8
askes	1	4.5116206E-8
askew	14	6.316269E-7
askey	1	4.5116206E-8
askeye	1	4.5116206E-8
askham	3	1.3534861E-7
askign	1	4.5116206E-8
askin	2	9.023241E-8
asking	1376	6.2079904E-5
askjeeves	2	9.023241E-8
askl	1	4.5116206E-8
asklepios	1	4.5116206E-8
askme	4	1.8046482E-7
asko	1	4.5116206E-8
askomantoura	1	4.5116206E-8
asks	608	2.7430653E-5
askthem	1	4.5116206E-8
askye	66	2.9776697E-6
askyefic	1	4.5116206E-8
asl	4	1.8046482E-7
aslakhanov	1	4.5116206E-8
aslam	1	4.5116206E-8
aslama	2	9.023241E-8
aslan	4	1.8046482E-7
aslanbek	1	4.5116206E-8
asleep	243	1.0963238E-5
asleeponthesofa	1	4.5116206E-8
asli	4	1.8046482E-7
aslihan	1	4.5116206E-8
aslippage	1	4.5116206E-8
aslund	1	4.5116206E-8
asm	2	9.023241E-8
asma	10	4.5116207E-7
asme	2	9.023241E-8
asmurai	2	9.023241E-8
asmussen	4	1.8046482E-7
asn	43	1.939997E-6
asnd	1	4.5116206E-8
asner	2	9.023241E-8
asnrs	2	9.023241E-8
asns	1	4.5116206E-8
aso	10	4.5116207E-7
asocial	1	4.5116206E-8
asokan	1	4.5116206E-8
asomáton	1	4.5116206E-8
asp	98	4.4213884E-6
asp-fluoromethyl	2	9.023241E-8
asp-fluromethyl-ketone	1	4.5116206E-8
asp-fluromethylketone	1	4.5116206E-8
asp-t	1	4.5116206E-8
asparagine	21	9.4744036E-7
asparagines	2	9.023241E-8
asparagines-linked	1	4.5116206E-8
asparaginyl-t	2	9.023241E-8
asparagus	43	1.939997E-6
asparagus-face	1	4.5116206E-8
aspargus	1	4.5116206E-8
aspart	1	4.5116206E-8
aspartame	2	9.023241E-8
aspartataminotransferase	1	4.5116206E-8
aspartate	50	2.2558104E-6
aspartate-glutamate	1	4.5116206E-8
aspartate-glutamate-rich	1	4.5116206E-8
aspartates	2	9.023241E-8
aspartic	27	1.2181375E-6
aspartokinase	4	1.8046482E-7
aspartyl	7	3.1581345E-7
aspartyl-glycine	1	4.5116206E-8
aspartyl-t	1	4.5116206E-8
aspasia	1	4.5116206E-8
aspc	5	2.2558103E-7
aspca	4	1.8046482E-7
aspdin	1	4.5116206E-8
aspe	1	4.5116206E-8
aspect	552	2.4904146E-5
aspectos	1	4.5116206E-8
aspects	695	3.1355765E-5
aspen	55	2.4813914E-6
aspens	2	9.023241E-8
asper	1	4.5116206E-8
asperger	3	1.3534861E-7
aspergillis	1	4.5116206E-8
aspergillosis	1	4.5116206E-8
aspergillus	6	2.7069723E-7
asperity	2	9.023241E-8
aspermont	1	4.5116206E-8
aspersion	6	2.7069723E-7
aspersions	11	4.962783E-7
aspesi	1	4.5116206E-8
aspex	1	4.5116206E-8
asphalt	57	2.5716238E-6
asphyxia	2	9.023241E-8
asphyxiate	3	1.3534861E-7
asphyxiated	4	1.8046482E-7
asphyxiation	8	3.6092965E-7
aspidistra	1	4.5116206E-8
aspin	1	4.5116206E-8
aspirant	5	2.2558103E-7
aspirants	3	1.3534861E-7
aspirate	9	4.0604587E-7
aspirated	28	1.2632538E-6
aspirates	5	2.2558103E-7
aspiration	75	3.3837155E-6
aspirational	8	3.6092965E-7
aspirationally	1	4.5116206E-8
aspirations	81	3.6544127E-6
aspire	47	2.1204617E-6
aspired	17	7.669755E-7
aspires	24	1.0827889E-6
aspirin	200	9.023242E-6
aspirin-treated	7	3.1581345E-7
aspiring	55	2.4813914E-6
aspiring-to-gentility	1	4.5116206E-8
asplin	1	4.5116206E-8
asplund	1	4.5116206E-8
aspm	5	2.2558103E-7
aspma	2	9.023241E-8
asprin	1	4.5116206E-8
asprin-y	1	4.5116206E-8
asps	8	3.6092965E-7
aspweb	1	4.5116206E-8
asqc	2	9.023241E-8
asquith	1	4.5116206E-8
asra	1	4.5116206E-8
asrequired	4	1.8046482E-7
asrna	6	2.7069723E-7
asrv	8	3.6092965E-7
ass	953	4.2995744E-5
ass-backward	2	9.023241E-8
ass-backwards	1	4.5116206E-8
ass-carressing	1	4.5116206E-8
ass-coverage	1	4.5116206E-8
ass-face	2	9.023241E-8
ass-fat	1	4.5116206E-8
ass-happy	1	4.5116206E-8
ass-head	1	4.5116206E-8
ass-kicking	7	3.1581345E-7
ass-kickingness	1	4.5116206E-8
ass-kissy	1	4.5116206E-8
ass-over-teakettle	1	4.5116206E-8
ass-play	1	4.5116206E-8
ass-pull	4	1.8046482E-7
ass-pully	2	9.023241E-8
ass-ramming	1	4.5116206E-8
ass-stompin	1	4.5116206E-8
ass-talking	1	4.5116206E-8
ass-ticks	2	9.023241E-8
ass-whipping	1	4.5116206E-8
ass-whuppin	1	4.5116206E-8
ass-wiggling	1	4.5116206E-8
assad	24	1.0827889E-6
assail	6	2.7069723E-7
assailant	15	6.767431E-7
assailants	14	6.316269E-7
assailed	34	1.533951E-6
assailing	8	3.6092965E-7
assails	7	3.1581345E-7
assam	8	3.6092965E-7
assamese	1	4.5116206E-8
assanine	2	9.023241E-8
assante	4	1.8046482E-7
assart	1	4.5116206E-8
assasinated	1	4.5116206E-8
assasination	8	3.6092965E-7
assasinations	3	1.3534861E-7
assassin	55	2.4813914E-6
assassinate	34	1.533951E-6
assassinated	71	3.2032506E-6
assassinating	14	6.316269E-7
assassination	209	9.429287E-6
assassination-was	1	4.5116206E-8
assassinations	26	1.1730214E-6
assassines	1	4.5116206E-8
assassinologists	1	4.5116206E-8
assassins	28	1.2632538E-6
assassins-then	1	4.5116206E-8
assata	2	9.023241E-8
assault	363	1.6377184E-5
assault-type	1	4.5116206E-8
assault-weapon	1	4.5116206E-8
assault-weapons	2	9.023241E-8
assault-with-a-deadly-weapon	2	9.023241E-8
assaulted	41	1.8497644E-6
assaulting	18	8.1209174E-7
assaultive	1	4.5116206E-8
assaults	86	3.879994E-6
assay	1255	5.662084E-5
assayas	1	4.5116206E-8
assayed	210	9.474404E-6
assaying	11	4.962783E-7
assays	719	3.243855E-5
asscap	5	2.2558103E-7
asscapitude	1	4.5116206E-8
asscappage	2	9.023241E-8
asscaps	22	9.925566E-7
assclown	5	2.2558103E-7
asscrack	1	4.5116206E-8
asscroft	1	4.5116206E-8
assed	5	2.2558103E-7
assemblage	20	9.0232413E-7
assemblages	2	9.023241E-8
assemble	138	6.2260365E-6
assemble-arms	1	4.5116206E-8
assembled	341	1.5384627E-5
assembler	16	7.218593E-7
assemblers	5	2.2558103E-7
assembles	14	6.316269E-7
assemblesubclone	2	9.023241E-8
assemblies	123	5.5492933E-6
assembling	65	2.9325533E-6
assembly	829	3.7401336E-5
assembly-corrected	3	1.3534861E-7
assembly-line	12	5.4139446E-7
assembly-room	1	4.5116206E-8
assembly-state	1	4.5116206E-8
assemblyman	10	4.5116207E-7
assemblywoman	2	9.023241E-8
assemblée	3	1.3534861E-7
assemby	1	4.5116206E-8
assen	1	4.5116206E-8
assend	1	4.5116206E-8
assension	1	4.5116206E-8
assent	20	9.0232413E-7
assented	8	3.6092965E-7
assenting	1	4.5116206E-8
assers	1	4.5116206E-8
assersohn	1	4.5116206E-8
assert	134	6.045572E-6
asserted	135	6.0906877E-6
assertibility	1	4.5116206E-8
asserting	75	3.3837155E-6
assertion	215	9.699985E-6
assertions	97	4.376272E-6
assertive	29	1.30837E-6
assertively	3	1.3534861E-7
assertiveness	11	4.962783E-7
asserts	146	6.5869663E-6
asses	61	2.7520887E-6
assess	820	3.699529E-5
assess-or	1	4.5116206E-8
assess-roll	1	4.5116206E-8
assessable	1	4.5116206E-8
assessed	598	2.6979491E-5
assesses	57	2.5716238E-6
assessible	2	9.023241E-8
assessing	356	1.6061369E-5
assessingrisksandreturns	1	4.5116206E-8
assessment	1154	5.2064104E-5
assessment-and	1	4.5116206E-8
assessment-performing	1	4.5116206E-8
assessments	215	9.699985E-6
assessor	6	2.7069723E-7
assessors	3	1.3534861E-7
asset	269	1.213626E-5
asset-building	1	4.5116206E-8
asset-intensive	1	4.5116206E-8
asset-its	1	4.5116206E-8
asset-market	1	4.5116206E-8
asset-our	1	4.5116206E-8
asset-public	1	4.5116206E-8
asset-two-thirds	1	4.5116206E-8
asseth	1	4.5116206E-8
assets	816	3.6814825E-5
assets-has	1	4.5116206E-8
assets-have	1	4.5116206E-8
assets-particularly	1	4.5116206E-8
assets-that	1	4.5116206E-8
assets-the	1	4.5116206E-8
asseverating	1	4.5116206E-8
assface	8	3.6092965E-7
asshat	9	4.0604587E-7
asshats	2	9.023241E-8
assheads	3	1.3534861E-7
asshole	77	3.473948E-6
asshole-junkie	1	4.5116206E-8
assholemoronbastard	1	4.5116206E-8
assholery	2	9.023241E-8
assholes	29	1.30837E-6
assholetude	1	4.5116206E-8
assholish	3	1.3534861E-7
assholishness	1	4.5116206E-8
assia	1	4.5116206E-8
assicot	1	4.5116206E-8
assiduous	10	4.5116207E-7
assiduously	24	1.0827889E-6
assign	192	8.662311E-6
assignable	4	1.8046482E-7
assignation	1	4.5116206E-8
assignations	3	1.3534861E-7
assigned	764	3.4468783E-5
assignees	1	4.5116206E-8
assigner	1	4.5116206E-8
assigning	97	4.376272E-6
assignment	360	1.6241835E-5
assignments	212	9.564636E-6
assigns	47	2.1204617E-6
assim	1	4.5116206E-8
assimilable	2	9.023241E-8
assimilate	22	9.925566E-7
assimilated	37	1.6692996E-6
assimilates	2	9.023241E-8
assimilating	8	3.6092965E-7
assimilation	45	2.0302293E-6
assimilationist	2	9.023241E-8
assimliate	1	4.5116206E-8
assiniboin	1	4.5116206E-8
assiniboine	3	1.3534861E-7
assisant	1	4.5116206E-8
assisi	27	1.2181375E-6
assissi	1	4.5116206E-8
assist	328	1.4798115E-5
assist-turnover	1	4.5116206E-8
assistance	1219	5.4996657E-5
assistances	1	4.5116206E-8
assistant	684	3.0859486E-5
assistantfiscal	1	4.5116206E-8
assistants	99	4.4665044E-6
assistantship	4	1.8046482E-7
assistantships	3	1.3534861E-7
assisted	227	1.0241379E-5
assisted-care	1	4.5116206E-8
assisted-conception	1	4.5116206E-8
assisted-living	3	1.3534861E-7
assisted-suicide	3	1.3534861E-7
assisting	84	3.7897614E-6
assistive	3	1.3534861E-7
assists	64	2.8874372E-6
assiter	2	9.023241E-8
assitsant	1	4.5116206E-8
assiyasi	1	4.5116206E-8
asskicking	4	1.8046482E-7
asskickingly	1	4.5116206E-8
assless	1	4.5116206E-8
asslicks	1	4.5116206E-8
assload	8	3.6092965E-7
assloads	2	9.023241E-8
asslot	1	4.5116206E-8
assma	2	9.023241E-8
assmeat	1	4.5116206E-8
assn	8	3.6092965E-7
assnref	2	9.023241E-8
asso	1	4.5116206E-8
asso-ciated	1	4.5116206E-8
assoc	3	1.3534861E-7
assocation	1	4.5116206E-8
assocdb	1	4.5116206E-8
associació	1	4.5116206E-8
associate	519	2.3415312E-5
associate-type	1	4.5116206E-8
associated	3748	1.6909554E-4
associates	332	1.4978581E-5
associating	40	1.8046483E-6
association	2628	1.1856539E-4
association-supported	1	4.5116206E-8
association-was	1	4.5116206E-8
association-wide	1	4.5116206E-8
associational	2	9.023241E-8
associationalism	1	4.5116206E-8
associations	558	2.5174842E-5
associative	10	4.5116207E-7
associação	1	4.5116206E-8
assoillyng	1	4.5116206E-8
assonance	2	9.023241E-8
assort	3	1.3534861E-7
assorted	69	3.1130182E-6
assortment	68	3.067902E-6
assortments	1	4.5116206E-8
assouline	6	2.7069723E-7
assp	2	9.023241E-8
asspipe	1	4.5116206E-8
asspull	26	1.1730214E-6
asspulled	1	4.5116206E-8
asspullery	1	4.5116206E-8
asspulls	4	1.8046482E-7
asspully	9	4.0604587E-7
asssayed	1	4.5116206E-8
asssume	1	4.5116206E-8
asssumed	1	4.5116206E-8
asst	14	6.316269E-7
assu	2	9.023241E-8
assuage	29	1.30837E-6
assuaged	10	4.5116207E-7
assuages	1	4.5116206E-8
assuaging	3	1.3534861E-7
assult	2	9.023241E-8
assulted	2	9.023241E-8
assum	1	4.5116206E-8
assume	1143	5.1567826E-5
assume-the	1	4.5116206E-8
assumed	895	4.0379004E-5
assumed-in	1	4.5116206E-8
assumedly	1	4.5116206E-8
assumers	1	4.5116206E-8
assumes	272	1.2271608E-5
assuming	667	3.009251E-5
assumingly	1	4.5116206E-8
assummed	1	4.5116206E-8
assumption	711	3.2077623E-5
assumptions	529	2.3866472E-5
assumptive	1	4.5116206E-8
assuncao	2	9.023241E-8
assunder	1	4.5116206E-8
assuning	1	4.5116206E-8
assunpink	1	4.5116206E-8
assunta	1	4.5116206E-8
assunção	4	1.8046482E-7
assupmtion	1	4.5116206E-8
assurance	258	1.16399815E-5
assurances	69	3.1130182E-6
assure	244	1.1008355E-5
assured	217	9.790217E-6
assuredly	13	5.865107E-7
assures	59	2.6618561E-6
assuring	63	2.842321E-6
assurèd	1	4.5116206E-8
asswipe	4	1.8046482E-7
asswipes	4	1.8046482E-7
assy	2	9.023241E-8
assykeen	1	4.5116206E-8
assymetrical	2	9.023241E-8
assyrian	7	3.1581345E-7
assyrians	3	1.3534861E-7
assézat	2	9.023241E-8
ast	21	9.4744036E-7
asta	3	1.3534861E-7
astacio	7	3.1581345E-7
astaire	18	8.1209174E-7
astaire-style	1	4.5116206E-8
astana	4	1.8046482E-7
astarte	8	3.6092965E-7
astataries	1	4.5116206E-8
astate	2	9.023241E-8
astaxanthin	10	4.5116207E-7
astbury	1	4.5116206E-8
astekar	1	4.5116206E-8
asteraceae	4	1.8046482E-7
asterik	1	4.5116206E-8
asterisk	26	1.1730214E-6
asterisked	1	4.5116206E-8
asterisks	16	7.218593E-7
asterix	3	1.3534861E-7
astern	1	4.5116206E-8
asteroid	36	1.6241835E-6
asteroid-sized	1	4.5116206E-8
asteroides	1	4.5116206E-8
asteroids	8	3.6092965E-7
asteroússia	1	4.5116206E-8
asters	9	4.0604587E-7
astert	1	4.5116206E-8
asterte	1	4.5116206E-8
asterted	2	9.023241E-8
asthiswastherestingplaceofthegodamun	1	4.5116206E-8
asthma	334	1.5068813E-5
asthma-associated	2	9.023241E-8
asthma-related	2	9.023241E-8
asthma-specific	1	4.5116206E-8
asthma-susceptibility	1	4.5116206E-8
asthmatic	18	8.1209174E-7
asthmatics	10	4.5116207E-7
asthmaticus	2	9.023241E-8
astigmatics	1	4.5116206E-8
astigmatism	4	1.8046482E-7
astin	10	4.5116207E-7
astir	2	9.023241E-8
astm	1	4.5116206E-8
aston	10	4.5116207E-7
aston-hotels	1	4.5116206E-8
astoned	2	9.023241E-8
astonia	1	4.5116206E-8
astonish	2	9.023241E-8
astonished	57	2.5716238E-6
astonishes	7	3.1581345E-7
astonishing	173	7.805103E-6
astonishingly	48	2.1655778E-6
astonishment	20	9.0232413E-7
astor	20	9.0232413E-7
astoria	16	7.218593E-7
astors	7	3.1581345E-7
astory	1	4.5116206E-8
astound	3	1.3534861E-7
astounded	26	1.1730214E-6
astounding	66	2.9776697E-6
astoundingly	13	5.865107E-7
astounds	3	1.3534861E-7
astra	4	1.8046482E-7
astrachan	4	1.8046482E-7
astragal	1	4.5116206E-8
astragalin	1	4.5116206E-8
astragalomancy	1	4.5116206E-8
astragalus	2	9.023241E-8
astrakhan	1	4.5116206E-8
astral	11	4.962783E-7
astralwerks	2	9.023241E-8
astramuchur	2	9.023241E-8
astramuphar	2	9.023241E-8
astrantia	1	4.5116206E-8
astray	25	1.1279052E-6
astrazeneca	10	4.5116207E-7
astride	17	7.669755E-7
astringence	1	4.5116206E-8
astringent	4	1.8046482E-7
astringently	1	4.5116206E-8
astrionics	2	9.023241E-8
astro	13	5.865107E-7
astro-man	1	4.5116206E-8
astro-turf	1	4.5116206E-8
astrobiology	6	2.7069723E-7
astrocam	1	4.5116206E-8
astrocyte	11	4.962783E-7
astrocyte-specific	1	4.5116206E-8
astrocytes	19	8.572079E-7
astrocytic	1	4.5116206E-8
astrocytomas	5	2.2558103E-7
astrodome	11	4.962783E-7
astrofísica	1	4.5116206E-8
astrogator	1	4.5116206E-8
astroglia	1	4.5116206E-8
astroglial	1	4.5116206E-8
astroglide	3	1.3534861E-7
astrogliosis	4	1.8046482E-7
astrogliotic	1	4.5116206E-8
astrojets	1	4.5116206E-8
astrolabe	2	9.023241E-8
astrolabes	1	4.5116206E-8
astrologer	13	5.865107E-7
astrologers	4	1.8046482E-7
astrological	5	2.2558103E-7
astrologico	1	4.5116206E-8
astrologist	1	4.5116206E-8
astrologists	1	4.5116206E-8
astrology	24	1.0827889E-6
astrom	2	9.023241E-8
astroman	1	4.5116206E-8
astronaut	82	3.6995289E-6
astronaute	1	4.5116206E-8
astronauts	34	1.533951E-6
astrong	1	4.5116206E-8
astronomer	29	1.30837E-6
astronomers	55	2.4813914E-6
astronomical	54	2.436275E-6
astronomically	1	4.5116206E-8
astronomy	56	2.5265076E-6
astronomy-altering	1	4.5116206E-8
astronomy-based	1	4.5116206E-8
astronouts	1	4.5116206E-8
astrophysical	1	4.5116206E-8
astrophysicist	3	1.3534861E-7
astrophysics	4	1.8046482E-7
astros	133	6.0004554E-6
astrospores	1	4.5116206E-8
astroturf	17	7.669755E-7
astrov	1	4.5116206E-8
astro­no­mique	1	4.5116206E-8
astrud	5	2.2558103E-7
astudy	1	4.5116206E-8
astumor	1	4.5116206E-8
asturias	2	9.023241E-8
astute	37	1.6692996E-6
astutely	4	1.8046482E-7
astuteness	2	9.023241E-8
astygmatism	1	4.5116206E-8
astérix	3	1.3534861E-7
asu	3	1.3534861E-7
asume	2	9.023241E-8
asummary	1	4.5116206E-8
asuncion	4	1.8046482E-7
asunción	4	1.8046482E-7
asunder	11	4.962783E-7
asusie	1	4.5116206E-8
asw	45	2.0302293E-6
asw-overexpressing	1	4.5116206E-8
aswaguschwadic	1	4.5116206E-8
aswan	28	1.2632538E-6
aswaq	1	4.5116206E-8
aswarm	1	4.5116206E-8
aswat	1	4.5116206E-8
aswell	2	9.023241E-8
aswooned	2	9.023241E-8
aswowne	2	9.023241E-8
asy	3	1.3534861E-7
asychronous	1	4.5116206E-8
asylees	2	9.023241E-8
asylum	117	5.2785963E-6
asylum-seeker	1	4.5116206E-8
asylum-seekers	4	1.8046482E-7
asylums	9	4.0604587E-7
asymbolic	1	4.5116206E-8
asymmeticral	1	4.5116206E-8
asymmetric	56	2.5265076E-6
asymmetrical	23	1.0376727E-6
asymmetrically	10	4.5116207E-7
asymmetries	18	8.1209174E-7
asymmetrix	1	4.5116206E-8
asymmetry	32	1.4437186E-6
asymptomatic	66	2.9776697E-6
asymptomatically	2	9.023241E-8
asymptomatics	1	4.5116206E-8
asymptote	3	1.3534861E-7
asymptotic	12	5.4139446E-7
asymptotically	2	9.023241E-8
asymptotics	2	9.023241E-8
asynaptic	1	4.5116206E-8
asynchronic	1	4.5116206E-8
asynchronous	14	6.316269E-7
asynchronously	7	3.1581345E-7
asynchrony	3	1.3534861E-7
asyrinsure	1	4.5116206E-8
as­tu­rias	1	4.5116206E-8
así	1	4.5116206E-8
asís	3	1.3534861E-7
at	101139	0.004563008
at-a-glance	1	4.5116206E-8
at-bat	35	1.5790672E-6
at-bats	61	2.7520887E-6
at-home	8	3.6092965E-7
at-homeness	1	4.5116206E-8
at-hook	5	2.2558103E-7
at-hook-like	3	1.3534861E-7
at-hooks	1	4.5116206E-8
at-large	2	9.023241E-8
at-long-last	1	4.5116206E-8
at-rich	15	6.767431E-7
at-risk	52	2.3460427E-6
at-risks	1	4.5116206E-8
at-sea	1	4.5116206E-8
at-tariiq	1	4.5116206E-8
at-the-break	1	4.5116206E-8
at-the-movies	2	9.023241E-8
at-will	1	4.5116206E-8
at-work	1	4.5116206E-8
at-ya	1	4.5116206E-8
ata	20	9.0232413E-7
ataaacagagcagagcagagc	1	4.5116206E-8
ataaagcccgaggtgttgttgc	1	4.5116206E-8
ataaatggaccgcatattga	2	9.023241E-8
ataatgtgtgtagccaagtggggt	1	4.5116206E-8
atac	1	4.5116206E-8
atacagcgtcacgactcccaccaatactagtgacacagacagtgaggtgctggggccagggttggactcgac	1	4.5116206E-8
atactc	1	4.5116206E-8
atactgcgtaactgactata	1	4.5116206E-8
atag	1	4.5116206E-8
atagtaacgaacaggatg	3	1.3534861E-7
atai	1	4.5116206E-8
ataka	1	4.5116206E-8
atakapa	1	4.5116206E-8
ataköy	2	9.023241E-8
atal	7	3.1581345E-7
atala	2	9.023241E-8
atalaia	1	4.5116206E-8
atalaya	3	1.3534861E-7
atall	1	4.5116206E-8
atami	2	9.023241E-8
atanarjuat	8	3.6092965E-7
atanatiya	3	1.3534861E-7
atanta	1	4.5116206E-8
atapi	1	4.5116206E-8
atarazanas	1	4.5116206E-8
atari	3	1.3534861E-7
ataru	1	4.5116206E-8
atas	1	4.5116206E-8
atascosa	1	4.5116206E-8
atassi	1	4.5116206E-8
atattgtccagtgc	1	4.5116206E-8
atatttgctagctgatagtgacc	2	9.023241E-8
ataturk	4	1.8046482E-7
atatürk	18	8.1209174E-7
atavistic	11	4.962783E-7
ataw	1	4.5116206E-8
ataxia	20	9.0232413E-7
ataxia-oculomotor	1	4.5116206E-8
ataxic	1	4.5116206E-8
ataxin	5	2.2558103E-7
atays	1	4.5116206E-8
atb	1	4.5116206E-8
atbc	2	9.023241E-8
atc	58	2.61674E-6
atcaa	1	4.5116206E-8
atcagcggccgcgatcc	1	4.5116206E-8
atcatctgtggctcagagtcg	1	4.5116206E-8
atcattatgctgaatccaacagtgatggcgttccatttaccacacgtaacatgagagtgatggggatcaggaag	1	4.5116206E-8
atcc	101	4.5567367E-6
atcc-na	1	4.5116206E-8
atccatgccatccacgtcaag	1	4.5116206E-8
atccgtaccagtggctaaaagg	1	4.5116206E-8
atcctaa	1	4.5116206E-8
atcctcaaagatgtctccttgtac	1	4.5116206E-8
atcctcgccgtcgggcatgc	1	4.5116206E-8
atcctgaccctgaagtaccc	1	4.5116206E-8
atcgaactggtgtgtcgaagg	1	4.5116206E-8
atcha	10	4.5116207E-7
atchafalaya	4	1.8046482E-7
atchison	1	4.5116206E-8
atchugarry	1	4.5116206E-8
atcisdb	11	4.962783E-7
atclo	1	4.5116206E-8
atcop	37	1.6692996E-6
atcost	2	9.023241E-8
atcp	3	1.3534861E-7
atct	1	4.5116206E-8
atctcctcttcttgctctgg	1	4.5116206E-8
atctcgaaggagattgttatagg	1	4.5116206E-8
atctgaggtcctctgaaagtg	1	4.5116206E-8
atdb	1	4.5116206E-8
atdm	1	4.5116206E-8
ate	408	1.8407412E-5
ateandateandate	1	4.5116206E-8
atee	2	9.023241E-8
atef	64	2.8874372E-6
atelectasis	5	2.2558103E-7
atelectatic	1	4.5116206E-8
atelier	4	1.8046482E-7
ateliers	1	4.5116206E-8
ateltisate	1	4.5116206E-8
aten	2	9.023241E-8
atenas	1	4.5116206E-8
atención	1	4.5116206E-8
atenco	12	5.4139446E-7
ateneo	1	4.5116206E-8
atenolol	4	1.8046482E-7
atenveldt	1	4.5116206E-8
aterror	1	4.5116206E-8
aterson	1	4.5116206E-8
ates	2	9.023241E-8
atesgay	1	4.5116206E-8
atevery	1	4.5116206E-8
atf	69	3.1130182E-6
atf-bpti	27	1.2181375E-6
atfalati	1	4.5116206E-8
atfim	4	1.8046482E-7
atfpp	27	1.2181375E-6
atfpps	2	9.023241E-8
atg	73	3.2934831E-6
atgaactccttctc	1	4.5116206E-8
atgaatatctagaccagggtgcc	1	4.5116206E-8
atgaattttactggctattc	1	4.5116206E-8
atgacaaggtagcgctggggg	1	4.5116206E-8
atgagctgcatgatgagct	1	4.5116206E-8
atgagttaattcaaaccccacggacat	1	4.5116206E-8
atgatgaaataacataaggtggtcccg	1	4.5116206E-8
atgatgaaggcttctc	1	4.5116206E-8
atgattcaggttctcacgtccg	1	4.5116206E-8
atgctaactgtccaagtcta	1	4.5116206E-8
atgctgttcagatgtttcaccatg	1	4.5116206E-8
atget	3	1.3534861E-7
atggaaacaccttgcttcttctccctc	1	4.5116206E-8
atggatccttctcaacgaagagcagtg	1	4.5116206E-8
atggcattagaaatagatatagataatg	1	4.5116206E-8
atggcggcgggtgggagcggcgggcgtgcgtcgtg	2	9.023241E-8
atggctaagtttgcttccat	1	4.5116206E-8
atgggcaagaacaagcagccacg	1	4.5116206E-8
atgggctggcaacatacaaca	1	4.5116206E-8
atggtgtgggcgaaagatga	1	4.5116206E-8
atgs	1	4.5116206E-8
atgtcaacacccacagcagcagat	1	4.5116206E-8
atgtggcgtcaaatcctg	1	4.5116206E-8
atgtgttgtgtattgtgtgggg	1	4.5116206E-8
atgttacacaaccatgatgtagaagaag	1	4.5116206E-8
atgttcaacgggggaatggccacaacatc	1	4.5116206E-8
atgttccactgcat	1	4.5116206E-8
atgttctaatatagtcacattttc	1	4.5116206E-8
ath	15	6.767431E-7
atha	1	4.5116206E-8
athabasca	3	1.3534861E-7
athan	1	4.5116206E-8
athanaric	1	4.5116206E-8
athanasian	2	9.023241E-8
athanasius	2	9.023241E-8
athapaskan	2	9.023241E-8
athe	2	9.023241E-8
atheism	11	4.962783E-7
atheist	45	2.0302293E-6
atheistic	3	1.3534861E-7
atheists	43	1.939997E-6
athelete	1	4.5116206E-8
athelstan	1	4.5116206E-8
athema	1	4.5116206E-8
athen	1	4.5116206E-8
athena	37	1.6692996E-6
athenaeum	1	4.5116206E-8
athenaeus	1	4.5116206E-8
athene	2	9.023241E-8
athenee	1	4.5116206E-8
atheneneum	1	4.5116206E-8
atheneum	5	2.2558103E-7
athenian	16	7.218593E-7
athenians	27	1.2181375E-6
athenry	1	4.5116206E-8
athens	280	1.2632538E-5
athenscope	1	4.5116206E-8
athenæum	1	4.5116206E-8
atherectomy	1	4.5116206E-8
atherogenesis	5	2.2558103E-7
atherogenic	4	1.8046482E-7
atherogenicity	1	4.5116206E-8
atheromatous	3	1.3534861E-7
atherosclerosis	55	2.4813914E-6
atherosclerotic	29	1.30837E-6
atherton	2	9.023241E-8
athiest	2	9.023241E-8
athiests	1	4.5116206E-8
athila	2	9.023241E-8
athina	2	9.023241E-8
athinas	1	4.5116206E-8
athinios	2	9.023241E-8
athlete	145	6.54185E-6
athlete-comedians	1	4.5116206E-8
athletes	253	1.14144E-5
athletes-turned-politicians	1	4.5116206E-8
athletes­	1	4.5116206E-8
athletic	221	9.970681E-6
athletic-wear	1	4.5116206E-8
athletically	5	2.2558103E-7
athleticism	15	6.767431E-7
athleticize	1	4.5116206E-8
athletics	91	4.1055746E-6
athlon	3	1.3534861E-7
athnee	1	4.5116206E-8
athol	1	4.5116206E-8
athon	11	4.962783E-7
athoninators	1	4.5116206E-8
athos	4	1.8046482E-7
athough	1	4.5116206E-8
athttp	1	4.5116206E-8
athwart	3	1.3534861E-7
athways	3	1.3534861E-7
athwri	1	4.5116206E-8
athy	2	9.023241E-8
athymia	2	9.023241E-8
athymic	17	7.669755E-7
ati	8	3.6092965E-7
atick	1	4.5116206E-8
atif	1	4.5116206E-8
atiii	1	4.5116206E-8
atikokan	1	4.5116206E-8
atilde	1	4.5116206E-8
atilla	2	9.023241E-8
ating	3	1.3534861E-7
ation	3	1.3534861E-7
ations	3	1.3534861E-7
atipamezole	2	9.023241E-8
atipemazole	1	4.5116206E-8
atircm	14	6.316269E-7
atircms	2	9.023241E-8
atissue	1	4.5116206E-8
atitude	1	4.5116206E-8
ativan	1	4.5116206E-8
ative	1	4.5116206E-8
atj	6	2.7069723E-7
atk	4	1.8046482E-7
atkatd	2	9.023241E-8
atkcbp	2	9.023241E-8
atkin	2	9.023241E-8
atkins	158	7.1283607E-6
atkins-like	4	1.8046482E-7
atkinson	29	1.30837E-6
atkrp	5	2.2558103E-7
atl	6	2.7069723E-7
atlanimated	1	4.5116206E-8
atlanta	1779	8.026173E-5
atlanta-area	2	9.023241E-8
atlanta-based	34	1.533951E-6
atlanta-tourism	4	1.8046482E-7
atlantan	4	1.8046482E-7
atlantans	14	6.316269E-7
atlanteans	1	4.5116206E-8
atlantic	583	2.6302749E-5
atlanticism	1	4.5116206E-8
atlantico	1	4.5116206E-8
atlantics	1	4.5116206E-8
atlantik	1	4.5116206E-8
atlantique	1	4.5116206E-8
atlantis	37	1.6692996E-6
atlanto-occipital	3	1.3534861E-7
atlas	106	4.782318E-6
atlases	3	1.3534861E-7
atlasimage	3	1.3534861E-7
atlatnic	1	4.5116206E-8
atlg	2	9.023241E-8
atlit	1	4.5116206E-8
atlprov	2	9.023241E-8
atls	1	4.5116206E-8
atlus	4	1.8046482E-7
atm	137	6.1809205E-6
atm-fee	1	4.5116206E-8
atm-independent	1	4.5116206E-8
atm-like	1	4.5116206E-8
atmaa	6	2.7069723E-7
atmaf	3	1.3534861E-7
atman	1	4.5116206E-8
atmca	1	4.5116206E-8
atmel	1	4.5116206E-8
atmgd	1	4.5116206E-8
atmgl	1	4.5116206E-8
atmidometry	1	4.5116206E-8
atmosphere	632	2.8513443E-5
atmospheres	5	2.2558103E-7
atmospherewise	1	4.5116206E-8
atmospheric	115	5.188364E-6
atmospherically	1	4.5116206E-8
atmosphericdeposition	1	4.5116206E-8
atmospherics	2	9.023241E-8
atmro	1	4.5116206E-8
atms	18	8.1209174E-7
atmyb	7	3.1581345E-7
atn	29	1.30837E-6
atneave	1	4.5116206E-8
ato	5	2.2558103E-7
atoa	1	4.5116206E-8
atocha	4	1.8046482E-7
atoll	3	1.3534861E-7
atolls	1	4.5116206E-8
atom	102	4.601853E-6
atom-atom	1	4.5116206E-8
atom-based	2	9.023241E-8
atom-splitting	3	1.3534861E-7
atombombpocketknife	1	4.5116206E-8
atomfilms	1	4.5116206E-8
atomic	153	6.9027797E-6
atomic-bomb	1	4.5116206E-8
atomic-level	1	4.5116206E-8
atomic-mutated	1	4.5116206E-8
atomic-powered	1	4.5116206E-8
atomic-scaled	4	1.8046482E-7
atomically	1	4.5116206E-8
atomics	1	4.5116206E-8
atomictangerine	2	9.023241E-8
atomism	7	3.1581345E-7
atomistic	4	1.8046482E-7
atomized	3	1.3534861E-7
atomosphere	1	4.5116206E-8
atoms	138	6.2260365E-6
atonal	7	3.1581345E-7
atonality	1	4.5116206E-8
atone	27	1.2181375E-6
atoned	3	1.3534861E-7
atonement	27	1.2181375E-6
atones	4	1.8046482E-7
atoning	4	1.8046482E-7
atop	185	8.346498E-6
atopic	9	4.0604587E-7
atopy	1	4.5116206E-8
ator	2	9.023241E-8
ators	1	4.5116206E-8
atorvastatin	40	1.8046483E-6
atorvastatin-mediated	1	4.5116206E-8
atorvastatin-treated	2	9.023241E-8
atotally	1	4.5116206E-8
atotonilco	1	4.5116206E-8
atp	441	1.9896248E-5
atp-analog	1	4.5116206E-8
atp-binding	21	9.4744036E-7
atp-dependent	14	6.316269E-7
atp-disodium	1	4.5116206E-8
atp-dnaa	1	4.5116206E-8
atp-driven	1	4.5116206E-8
atp-grasp	22	9.925566E-7
atp-independent	1	4.5116206E-8
atp-induced	2	9.023241E-8
atp-inhibitory	1	4.5116206E-8
atp-insensitive	1	4.5116206E-8
atp-sensitive	5	2.2558103E-7
atp-sulfurylase	1	4.5116206E-8
atp?	1	4.5116206E-8
atp?s	5	2.2558103E-7
atpactivity	2	9.023241E-8
atpakrp	1	4.5116206E-8
atpase	179	8.075801E-6
atpase-proton	1	4.5116206E-8
atpase-specfic	1	4.5116206E-8
atpases	25	1.1279052E-6
atpip	7	3.1581345E-7
atplc	7	3.1581345E-7
atpsynthase	3	1.3534861E-7
atpsynthases	1	4.5116206E-8
atr	21	9.4744036E-7
atra	1	4.5116206E-8
atraccions	2	9.023241E-8
atraditional	1	4.5116206E-8
atrangap	1	4.5116206E-8
atransgenic	1	4.5116206E-8
atrazine	2	9.023241E-8
atreides	1	4.5116206E-8
atremble	1	4.5116206E-8
atrep-base	1	4.5116206E-8
atrepbase	2	9.023241E-8
atresia	20	9.0232413E-7
atretic	14	6.316269E-7
atreus	10	4.5116207E-7
atria	4	1.8046482E-7
atrial	111	5.007899E-6
atriedes	2	9.023241E-8
atrioventricular	4	1.8046482E-7
atrip	5	2.2558103E-7
atrisk	4	1.8046482E-7
atriss	17	7.669755E-7
atrium	32	1.4437186E-6
atriums	3	1.3534861E-7
atroce	1	4.5116206E-8
atrocious	25	1.1279052E-6
atrociously	3	1.3534861E-7
atrocities	111	5.007899E-6
atrocity	29	1.30837E-6
atrojan	1	4.5116206E-8
atrophic	6	2.7069723E-7
atrophicae	1	4.5116206E-8
atrophied	5	2.2558103E-7
atrophin	1	4.5116206E-8
atrophy	40	1.8046483E-6
atrophying	5	2.2558103E-7
atropine	13	5.865107E-7
atropurpurea	1	4.5116206E-8
atrox	6	2.7069723E-7
atrusted	1	4.5116206E-8
atry	1	4.5116206E-8
ats	137	6.1809205E-6
atsb	2	9.023241E-8
atsina	1	4.5116206E-8
atstours	1	4.5116206E-8
atsuta	1	4.5116206E-8
att	214	9.654868E-6
att-comcast	2	9.023241E-8
att-earnings	2	9.023241E-8
atta	355	1.6016253E-5
atta-the	1	4.5116206E-8
attaaa	1	4.5116206E-8
attach	132	5.9553395E-6
attache	6	2.7069723E-7
attached	599	2.7024607E-5
attaches	27	1.2181375E-6
attaching	29	1.30837E-6
attachment	228	1.0286495E-5
attachments	39	1.7595321E-6
attaché	5	2.2558103E-7
attacin	1	4.5116206E-8
attack	2069	9.334543E-5
attack-and	1	4.5116206E-8
attack-dog	2	9.023241E-8
attack-hekmatyar	1	4.5116206E-8
attack-how	1	4.5116206E-8
attack-marines	1	4.5116206E-8
attack-repeatedly	1	4.5116206E-8
attack-sailors	1	4.5116206E-8
attacked	374	1.687346E-5
attacked-on-sight	1	4.5116206E-8
attacker	35	1.5790672E-6
attackers	26	1.1730214E-6
attacking	221	9.970681E-6
attacks	1630	7.353942E-5
attacks-it	1	4.5116206E-8
attacks-possibly	1	4.5116206E-8
attacks-that	1	4.5116206E-8
attact	1	4.5116206E-8
attactive	1	4.5116206E-8
attagirl	2	9.023241E-8
attain	83	3.7446453E-6
attainable	19	8.572079E-7
attainder	8	3.6092965E-7
attained	93	4.1958074E-6
attaining	33	1.4888349E-6
attainment	58	2.61674E-6
attainments	1	4.5116206E-8
attains	3	1.3534861E-7
attal	13	5.865107E-7
attali	2	9.023241E-8
attalid	3	1.3534861E-7
attalos	3	1.3534861E-7
attalus	2	9.023241E-8
attanasio	5	2.2558103E-7
attar	1	4.5116206E-8
attarin	1	4.5116206E-8
attas	8	3.6092965E-7
attash	6	2.7069723E-7
attatchment	3	1.3534861E-7
attaway	1	4.5116206E-8
attawhid	5	2.2558103E-7
attb	1	4.5116206E-8
attcgatcggggcggggcgagc	1	4.5116206E-8
attcgtcatatcgccatt	1	4.5116206E-8
atte	1	4.5116206E-8
atteck	1	4.5116206E-8
attemped	3	1.3534861E-7
attempt	1414	6.3794316E-5
attempted	495	2.2332522E-5
attempting	329	1.4843232E-5
attempts	656	2.959623E-5
attenborough	8	3.6092965E-7
attence	1	4.5116206E-8
attend	474	2.1385082E-5
attendance	225	1.0151147E-5
attendances	1	4.5116206E-8
attendant	149	6.722315E-6
attendants	102	4.601853E-6
attended	462	2.0843687E-5
attendee	12	5.4139446E-7
attendees	45	2.0302293E-6
attendence	4	1.8046482E-7
attendent	2	9.023241E-8
attendents	1	4.5116206E-8
attendez	1	4.5116206E-8
attending	278	1.2542306E-5
attendings	1	4.5116206E-8
attends	45	2.0302293E-6
attention	2731	1.2321236E-4
attention-deficit	6	2.7069723E-7
attention-getting	16	7.218593E-7
attention-grabbing	4	1.8046482E-7
attention-happy	1	4.5116206E-8
attention-seeking	2	9.023241E-8
attention-starved	2	9.023241E-8
attention-switching	2	9.023241E-8
attentional	16	7.218593E-7
attentionest	1	4.5116206E-8
attentionl	1	4.5116206E-8
attentions	19	8.572079E-7
attentive	58	2.61674E-6
attentively	9	4.0604587E-7
attentiveness	3	1.3534861E-7
attentuation	1	4.5116206E-8
attenuance	1	4.5116206E-8
attenuate	26	1.1730214E-6
attenuated	76	3.4288316E-6
attenuates	11	4.962783E-7
attenuating	9	4.0604587E-7
attenuation	33	1.4888349E-6
attenuations	2	9.023241E-8
attenuators	1	4.5116206E-8
atterrissage	1	4.5116206E-8
attest	60	2.7069725E-6
attestation	166	7.4892905E-6
attestations	9	4.0604587E-7
attested	23	1.0376727E-6
attesting	7	3.1581345E-7
attests	13	5.865107E-7
attfdb	12	5.4139446E-7
attgtctgttgtgcccagtcata	1	4.5116206E-8
atthat	1	4.5116206E-8
atthe	3	1.3534861E-7
atti	1	4.5116206E-8
attibutable	1	4.5116206E-8
attic	80	3.6092965E-6
attica	17	7.669755E-7
attics	7	3.1581345E-7
atticus	11	4.962783E-7
atticwall	1	4.5116206E-8
attila	15	6.767431E-7
attilla	2	9.023241E-8
attip	3	1.3534861E-7
attire	41	1.8497644E-6
attired	15	6.767431E-7
attitude	702	3.1671578E-5
attitude-based	2	9.023241E-8
attitude-besotted	1	4.5116206E-8
attitude-bound	1	4.5116206E-8
attitudes	370	1.6692997E-5
attitudinal	10	4.5116207E-7
attitudinally	1	4.5116206E-8
attitudinizing	1	4.5116206E-8
attiya	1	4.5116206E-8
attleboro	16	7.218593E-7
attlee	2	9.023241E-8
attmepts	1	4.5116206E-8
attn	11	4.962783E-7
attnben	1	4.5116206E-8
attndce	1	4.5116206E-8
attneave	3	1.3534861E-7
attolia	2	9.023241E-8
attone	2	9.023241E-8
attorney	1507	6.799012E-5
attorney-at	1	4.5116206E-8
attorney-client	40	1.8046483E-6
attorney-general	2	9.023241E-8
attorneyclient	1	4.5116206E-8
attorneys	568	2.5626005E-5
attorneyto	1	4.5116206E-8
attp	3	1.3534861E-7
attracrtive	1	4.5116206E-8
attract	393	1.7730668E-5
attractant	3	1.3534861E-7
attractants	1	4.5116206E-8
attracted	344	1.5519976E-5
attracting	140	6.316269E-6
attraction	373	1.6828346E-5
attraction-filled	1	4.5116206E-8
attraction-relationship	1	4.5116206E-8
attractions	317	1.4301838E-5
attractive	720	3.248367E-5
attractively	18	8.1209174E-7
attractiveness	24	1.0827889E-6
attractivness	1	4.5116206E-8
attractor	11	4.962783E-7
attractors	14	6.316269E-7
attracts	130	5.8651067E-6
attrib	1	4.5116206E-8
attribu	1	4.5116206E-8
attributable	186	8.391615E-6
attribute	165	7.444174E-6
attributed	441	1.9896248E-5
attributes	242	1.0918122E-5
attributing	32	1.4437186E-6
attribution	40	1.8046483E-6
attribution-based	1	4.5116206E-8
attributions	7	3.1581345E-7
attributive	1	4.5116206E-8
attributively	1	4.5116206E-8
attrit	2	9.023241E-8
attrition	47	2.1204617E-6
attrition-and	1	4.5116206E-8
attrubutive	2	9.023241E-8
attss	1	4.5116206E-8
atttaggtgacactatag	1	4.5116206E-8
atttgctgggttgaaaaatg	1	4.5116206E-8
atttt	1	4.5116206E-8
attttgtgg	1	4.5116206E-8
atttttggaacctaggaaagactcggggcttgctccgactttccaagggtcgtcccggcg	1	4.5116206E-8
atttttggaacctagggaagactcggggcttgctccgacttcccaagggtcgtcctggcg	1	4.5116206E-8
attu	1	4.5116206E-8
attucks	2	9.023241E-8
attuned	24	1.0827889E-6
attunement	1	4.5116206E-8
attwater	1	4.5116206E-8
atty	1	4.5116206E-8
atu	2	9.023241E-8
atuat	2	9.023241E-8
atul	12	5.4139446E-7
atv	4	1.8046482E-7
atvbvs	1	4.5116206E-8
atvisit	1	4.5116206E-8
atw	3	1.3534861E-7
atwan	5	2.2558103E-7
atwater	13	5.865107E-7
atwitter	2	9.023241E-8
atwood	14	6.316269E-7
atwt	4	1.8046482E-7
atxgxxxx	1	4.5116206E-8
atypia	18	8.1209174E-7
atypical	75	3.3837155E-6
atypically	6	2.7069723E-7
atyraü	1	4.5116206E-8
atzcf	1	4.5116206E-8
atâwe	1	4.5116206E-8
atâweu	1	4.5116206E-8
atúntunny	2	9.023241E-8
au	135	6.0906877E-6
au-kbc	2	9.023241E-8
au-rich	4	1.8046482E-7
aua	2	9.023241E-8
auau	1	4.5116206E-8
auayled	1	4.5116206E-8
aub	2	9.023241E-8
aub-uitlijn	2	9.023241E-8
aubade	1	4.5116206E-8
auberge	3	1.3534861E-7
auberges	1	4.5116206E-8
aubergine	7	3.1581345E-7
aubergines	2	9.023241E-8
auberon	3	1.3534861E-7
aubert	1	4.5116206E-8
aubisque	3	1.3534861E-7
aubrey	13	5.865107E-7
aubriot	1	4.5116206E-8
auburn	79	3.5641804E-6
auburn-haired	1	4.5116206E-8
auburndale	1	4.5116206E-8
aubusson	1	4.5116206E-8
auc	48	2.1655778E-6
auc-dbp	5	2.2558103E-7
auc-hr	4	1.8046482E-7
auc-sbp	5	2.2558103E-7
auchincloss	2	9.023241E-8
auchtermuchty	1	4.5116206E-8
auckerman	2	9.023241E-8
auckland	10	4.5116207E-7
aucoin	6	2.7069723E-7
aucoustic	1	4.5116206E-8
aucs	1	4.5116206E-8
auction	380	1.7144159E-5
auctionconducted	1	4.5116206E-8
auctioned	65	2.9325533E-6
auctioneer	6	2.7069723E-7
auctioning	28	1.2632538E-6
auctions	133	6.0004554E-6
auctions-econscene	1	4.5116206E-8
auctionshall	1	4.5116206E-8
auctionsubaccount	1	4.5116206E-8
auctionweb	3	1.3534861E-7
aud	6	2.7069723E-7
audacious	31	1.3986024E-6
audaciously	4	1.8046482E-7
audacities	1	4.5116206E-8
audacity	21	9.4744036E-7
audelia	1	4.5116206E-8
auden	17	7.669755E-7
audette	1	4.5116206E-8
audi	27	1.2181375E-6
audiac	2	9.023241E-8
audiard	3	1.3534861E-7
audibility	2	9.023241E-8
audible	40	1.8046483E-6
audibly	6	2.7069723E-7
audience	1377	6.2125015E-5
audience-meld	1	4.5116206E-8
audienceless	1	4.5116206E-8
audiences	302	1.3625095E-5
audiencia	1	4.5116206E-8
audienzzimmer	1	4.5116206E-8
audigy	1	4.5116206E-8
audin	1	4.5116206E-8
audio	243	1.0963238E-5
audio-book	1	4.5116206E-8
audio-fanatic	1	4.5116206E-8
audio-review	1	4.5116206E-8
audio-reviews	9	4.0604587E-7
audio-taped	2	9.023241E-8
audio-taping	1	4.5116206E-8
audio-video	1	4.5116206E-8
audio-visual	23	1.0376727E-6
audio-visuals	1	4.5116206E-8
audiobook	5	2.2558103E-7
audiobooks	5	2.2558103E-7
audiocasette	1	4.5116206E-8
audiogalaxy	1	4.5116206E-8
audiologic	1	4.5116206E-8
audiological	2	9.023241E-8
audiologist	1	4.5116206E-8
audiologists	1	4.5116206E-8
audiology	2	9.023241E-8
audiometric	2	9.023241E-8
audiophile	5	2.2558103E-7
audiophiles	2	9.023241E-8
audiopollution	1	4.5116206E-8
audiotape	6	2.7069723E-7
audiotaped	1	4.5116206E-8
audiotapes	13	5.865107E-7
audiotypist	2	9.023241E-8
audiovisual	15	6.767431E-7
audis	3	1.3534861E-7
audit	1083	4.8860853E-5
audit-consulting	1	4.5116206E-8
audit-econscene	1	4.5116206E-8
audit-independence	1	4.5116206E-8
audit-reporting	1	4.5116206E-8
auditable	2	9.023241E-8
audited	148	6.6771986E-6
auditee	1	4.5116206E-8
auditing	255	1.1504632E-5
auditing-oversight	2	9.023241E-8
audition	39	1.7595321E-6
auditioned	7	3.1581345E-7
auditioners	1	4.5116206E-8
auditioning	4	1.8046482E-7
auditions	17	7.669755E-7
auditnet	2	9.023241E-8
audito	1	4.5116206E-8
auditor	184	8.301382E-6
auditori	1	4.5116206E-8
auditoria	2	9.023241E-8
auditorium	76	3.4288316E-6
auditoriums	4	1.8046482E-7
auditors	858	3.8709706E-5
auditors-www	1	4.5116206E-8
auditory	57	2.5716238E-6
auditory-only	1	4.5116206E-8
audits	294	1.3264164E-5
audoen	6	2.7069723E-7
audouin	2	9.023241E-8
audra	5	2.2558103E-7
audran	1	4.5116206E-8
audre	1	4.5116206E-8
audrey	40	1.8046483E-6
audubon	48	2.1655778E-6
auel	1	4.5116206E-8
auent	1	4.5116206E-8
auer	3	1.3534861E-7
auerbach	14	6.316269E-7
auerswald	1	4.5116206E-8
auf	13	5.865107E-7
aufait	1	4.5116206E-8
auferre	1	4.5116206E-8
aufhauser	3	1.3534861E-7
aufraeumarbeiten	1	4.5116206E-8
aufs	2	9.023241E-8
aufschnaiter	2	9.023241E-8
aug	874	3.9431565E-5
auga	1	4.5116206E-8
augabrún	1	4.5116206E-8
augaitis	1	4.5116206E-8
auge	5	2.2558103E-7
augean	4	1.8046482E-7
augenblick	2	9.023241E-8
augenbraue	2	9.023241E-8
augendre	1	4.5116206E-8
augenlid	1	4.5116206E-8
augenwimper	2	9.023241E-8
augered	1	4.5116206E-8
augggichkkh	1	4.5116206E-8
augh	11	4.962783E-7
aught	3	1.3534861E-7
aughter	1	4.5116206E-8
augie	1	4.5116206E-8
augment	51	2.3009266E-6
augment-efforts	1	4.5116206E-8
augmentation	18	8.1209174E-7
augmentations	2	9.023241E-8
augmentative	6	2.7069723E-7
augmentatives	1	4.5116206E-8
augmented	77	3.473948E-6
augmenteth	1	4.5116206E-8
augmentin	6	2.7069723E-7
augmenting	9	4.0604587E-7
augments	7	3.1581345E-7
augmon	2	9.023241E-8
augnahár	1	4.5116206E-8
augs	1	4.5116206E-8
augsburg	3	1.3534861E-7
augur	3	1.3534861E-7
augured	2	9.023241E-8
auguring	2	9.023241E-8
augurs	3	1.3534861E-7
august	1228	5.5402703E-5
augusta	109	4.9176665E-6
augustan	1	4.5116206E-8
auguste	11	4.962783E-7
augustin	2	9.023241E-8
augustine	62	2.7972048E-6
augustinian	4	1.8046482E-7
augustinians	1	4.5116206E-8
augustins	2	9.023241E-8
augusto	42	1.8948807E-6
augustus	26	1.1730214E-6
augustí	1	4.5116206E-8
auiar	1	4.5116206E-8
aujourd	2	9.023241E-8
auken	3	1.3534861E-7
aukofer	1	4.5116206E-8
auks	1	4.5116206E-8
aul	70	3.1581344E-6
aula	3	1.3534861E-7
aulaqi	29	1.30837E-6
auld	15	6.767431E-7
aulenti	2	9.023241E-8
auler	1	4.5116206E-8
auletta	3	1.3534861E-7
auli	1	4.5116206E-8
aulin	3	1.3534861E-7
ault	2	9.023241E-8
aum	9	4.0604587E-7
aumale	1	4.5116206E-8
aumann	9	4.0604587E-7
aumc	2	9.023241E-8
aumone	1	4.5116206E-8
aun	1	4.5116206E-8
aunched	1	4.5116206E-8
aundience	1	4.5116206E-8
aung	30	1.3534863E-6
aunified	1	4.5116206E-8
aunt	327	1.4753E-5
auntie	18	8.1209174E-7
aunties	4	1.8046482E-7
auntly	1	4.5116206E-8
aunts	71	3.2032506E-6
auntum	1	4.5116206E-8
auotradiography	1	4.5116206E-8
aupeix	1	4.5116206E-8
aura	90	4.0604587E-6
auraient	1	4.5116206E-8
aural	13	5.865107E-7
aurally	3	1.3534861E-7
aurangabad	1	4.5116206E-8
aurangzeb	9	4.0604587E-7
aurantiacus	1	4.5116206E-8
aurantium	13	5.865107E-7
auraptene	1	4.5116206E-8
auras	4	1.8046482E-7
auratus	3	1.3534861E-7
aurea	1	4.5116206E-8
aureli	1	4.5116206E-8
aurelia	62	2.7972048E-6
aurelian	1	4.5116206E-8
aurelio	9	4.0604587E-7
aurelius	12	5.4139446E-7
aurengzeb	2	9.023241E-8
aureole	1	4.5116206E-8
aureoumbra	1	4.5116206E-8
aureus	154	6.947896E-6
aureusand	1	4.5116206E-8
aureusinduces	1	4.5116206E-8
aureusinfections	1	4.5116206E-8
aureusrequires	1	4.5116206E-8
aurevilly	2	9.023241E-8
auriculatum	1	4.5116206E-8
auriga	2	9.023241E-8
aurilia	5	2.2558103E-7
aurion	6	2.7069723E-7
auriongold	4	1.8046482E-7
auritum	4	1.8046482E-7
aurobindo	1	4.5116206E-8
aurora	18	8.1209174E-7
auroville	1	4.5116206E-8
aurthur	1	4.5116206E-8
aurturo	1	4.5116206E-8
aurum	3	1.3534861E-7
aus	10	4.5116207E-7
ausbildung	1	4.5116206E-8
ausbrook	1	4.5116206E-8
auschwitz	40	1.8046483E-6
auscultation	1	4.5116206E-8
auseful	1	4.5116206E-8
ausing	2	9.023241E-8
auskeper	1	4.5116206E-8
ausmus	25	1.1279052E-6
auso	1	4.5116206E-8
auspices	21	9.4744036E-7
auspicious	15	6.767431E-7
auspiciously	2	9.023241E-8
ausser	1	4.5116206E-8
aussi	2	9.023241E-8
aussie	42	1.8948807E-6
aussie-talk	1	4.5116206E-8
aussieinamerica	2	9.023241E-8
aussies	9	4.0604587E-7
ausstellung	1	4.5116206E-8
ausstellungsgelände	1	4.5116206E-8
aust	5	2.2558103E-7
austell	1	4.5116206E-8
austen	42	1.8948807E-6
austenlike	1	4.5116206E-8
auster	2	9.023241E-8
austere	82	3.6995289E-6
austerely	2	9.023241E-8
austerities	3	1.3534861E-7
austerity	41	1.8497644E-6
austerlitz	4	1.8046482E-7
austin	863	3.8935286E-5
austin-based	4	1.8046482E-7
austin-film-review	3	1.3534861E-7
austinite	3	1.3534861E-7
austinpowers	1	4.5116206E-8
austintatiously	1	4.5116206E-8
austrailia	1	4.5116206E-8
austrailian	3	1.3534861E-7
austral	3	1.3534861E-7
australasian	3	1.3534861E-7
australia	470	2.1204618E-5
australian	380	1.7144159E-5
australian-built	1	4.5116206E-8
australian-edition	1	4.5116206E-8
australian-led	3	1.3534861E-7
australian-style	1	4.5116206E-8
australianism	1	4.5116206E-8
australianisms	3	1.3534861E-7
australians	44	1.9851132E-6
australo	1	4.5116206E-8
australoids	2	9.023241E-8
australopithecine	1	4.5116206E-8
australopithecus	2	9.023241E-8
austria	100	4.511621E-6
austrialian	1	4.5116206E-8
austrian	64	2.8874372E-6
austrian-held	1	4.5116206E-8
austrian-part	1	4.5116206E-8
austrians	19	8.572079E-7
austro	10	4.5116207E-7
austroicetes	1	4.5116206E-8
austrolopithecus	1	4.5116206E-8
ausubel	1	4.5116206E-8
aus­trians	1	4.5116206E-8
aut	1	4.5116206E-8
autapomorphies	3	1.3534861E-7
autditorium	1	4.5116206E-8
autem	3	1.3534861E-7
auterist	2	9.023241E-8
auters	1	4.5116206E-8
auteuil	2	9.023241E-8
auteur	16	7.218593E-7
auteuristic	1	4.5116206E-8
auteurs	12	5.4139446E-7
auth	1	4.5116206E-8
authenic	1	4.5116206E-8
authenicity	1	4.5116206E-8
authentic	257	1.1594865E-5
authentic-feeling	1	4.5116206E-8
authentic-sounding	1	4.5116206E-8
authentically	18	8.1209174E-7
authenticate	10	4.5116207E-7
authenticated	9	4.0604587E-7
authenticates	3	1.3534861E-7
authenticating	1	4.5116206E-8
authentication	12	5.4139446E-7
authenticities	1	4.5116206E-8
authenticity	100	4.511621E-6
authentick	1	4.5116206E-8
authenticode	1	4.5116206E-8
authenticy	1	4.5116206E-8
authie	1	4.5116206E-8
author	1706	7.696825E-5
author-side	1	4.5116206E-8
authored	21	9.4744036E-7
authoredbyralphs	1	4.5116206E-8
authoress	2	9.023241E-8
authorial	10	4.5116207E-7
authorially	2	9.023241E-8
authoring	2	9.023241E-8
authorisation	1	4.5116206E-8
authorised	1	4.5116206E-8
authorit-ahy	1	4.5116206E-8
authoritarian	68	3.067902E-6
authoritarian-moral	1	4.5116206E-8
authoritarianism	18	8.1209174E-7
authoritarians	6	2.7069723E-7
authoritative	80	3.6092965E-6
authoritatively	10	4.5116207E-7
authoritativeness	1	4.5116206E-8
authoritay	1	4.5116206E-8
authorities	875	3.947668E-5
authorities-a	1	4.5116206E-8
authority	1752	7.9043595E-5
authority-resistant	1	4.5116206E-8
authority-the	1	4.5116206E-8
authorization	200	9.023242E-6
authorizations	11	4.962783E-7
authorize	71	3.2032506E-6
authorized	264	1.1910679E-5
authorizes	25	1.1279052E-6
authorizing	68	3.067902E-6
authors	1470	6.632083E-5
authorship	29	1.30837E-6
authorsontheweb	1	4.5116206E-8
authour	1	4.5116206E-8
autin	6	2.7069723E-7
autiorium	1	4.5116206E-8
autism	54	2.436275E-6
autism-associated	1	4.5116206E-8
autistic	48	2.1655778E-6
autists	1	4.5116206E-8
autito	1	4.5116206E-8
auto	311	1.403114E-5
auto-accident	1	4.5116206E-8
auto-activation	1	4.5116206E-8
auto-answer	1	4.5116206E-8
auto-antibodies	2	9.023241E-8
auto-antigen	1	4.5116206E-8
auto-anything	1	4.5116206E-8
auto-archive	1	4.5116206E-8
auto-archiving	1	4.5116206E-8
auto-associative	3	1.3534861E-7
auto-blood-letting	1	4.5116206E-8
auto-bmw-m	1	4.5116206E-8
auto-briefs	1	4.5116206E-8
auto-by	1	4.5116206E-8
auto-catalytic	1	4.5116206E-8
auto-commentary	1	4.5116206E-8
auto-commotion	1	4.5116206E-8
auto-correct	1	4.5116206E-8
auto-da-f	1	4.5116206E-8
auto-deliveries	1	4.5116206E-8
auto-dimming	2	9.023241E-8
auto-ellipsis	1	4.5116206E-8
auto-emissions	1	4.5116206E-8
auto-emissions-review	1	4.5116206E-8
auto-erotic	1	4.5116206E-8
auto-eroticism	2	9.023241E-8
auto-flagellate	1	4.5116206E-8
auto-fluorescence	4	1.8046482E-7
auto-focusing	1	4.5116206E-8
auto-gamma	1	4.5116206E-8
auto-immune	2	9.023241E-8
auto-inhibition	2	9.023241E-8
auto-inhibitory	4	1.8046482E-7
auto-injector	1	4.5116206E-8
auto-insurance	2	9.023241E-8
auto-level	1	4.5116206E-8
auto-lexus	1	4.5116206E-8
auto-makers	2	9.023241E-8
auto-manacles	1	4.5116206E-8
auto-museum	1	4.5116206E-8
auto-nissan	1	4.5116206E-8
auto-oldsmobile	1	4.5116206E-8
auto-parts	1	4.5116206E-8
auto-pilot	1	4.5116206E-8
auto-piloting	1	4.5116206E-8
auto-record	1	4.5116206E-8
auto-related	1	4.5116206E-8
auto-repair	1	4.5116206E-8
auto-rescue-systems	1	4.5116206E-8
auto-response	1	4.5116206E-8
auto-rickshaws	1	4.5116206E-8
auto-safety	2	9.023241E-8
auto-scan	1	4.5116206E-8
auto-suggestion	1	4.5116206E-8
auto-synchronizes	1	4.5116206E-8
auto-theft	4	1.8046482E-7
auto-translate	1	4.5116206E-8
auto-tuning	1	4.5116206E-8
auto-watering	1	4.5116206E-8
autoaligned	1	4.5116206E-8
autoanalyzer	1	4.5116206E-8
autoantibodies	67	3.022786E-6
autoantibody	19	8.572079E-7
autoantigen	17	7.669755E-7
autoantigenic	2	9.023241E-8
autoantigens	41	1.8497644E-6
autoassembler	3	1.3534861E-7
autobahn	9	4.0604587E-7
autobahn-style	1	4.5116206E-8
autobio	4	1.8046482E-7
autobiographical	51	2.3009266E-6
autobiographies	12	5.4139446E-7
autobiography	147	6.632082E-6
autobiography-as-get-out-of	1	4.5116206E-8
autobots	2	9.023241E-8
autobús	1	4.5116206E-8
autocad	1	4.5116206E-8
autocares	1	4.5116206E-8
autocatalysis	4	1.8046482E-7
autocatalytic	54	2.436275E-6
autocatalytically	1	4.5116206E-8
autoclaved	4	1.8046482E-7
autoclaving	1	4.5116206E-8
autocomplete	1	4.5116206E-8
autocondimentation	1	4.5116206E-8
autocontrast	1	4.5116206E-8
autocorrect	2	9.023241E-8
autocorrecting	3	1.3534861E-7
autocorrection	1	4.5116206E-8
autocorrects	2	9.023241E-8
autocorrelation	35	1.5790672E-6
autocovariance	1	4.5116206E-8
autocracies	3	1.3534861E-7
autocracy	3	1.3534861E-7
autocrat	6	2.7069723E-7
autocratic	23	1.0376727E-6
autocrats	5	2.2558103E-7
autocrine	16	7.218593E-7
autocue	1	4.5116206E-8
autodecay	1	4.5116206E-8
autodefensas	1	4.5116206E-8
autodesk	1	4.5116206E-8
autodialed	1	4.5116206E-8
autodidact	3	1.3534861E-7
autodidacts	3	1.3534861E-7
autodock	6	2.7069723E-7
autodrome	2	9.023241E-8
autoerotic	5	2.2558103E-7
autoeroticism	1	4.5116206E-8
autoeurope	1	4.5116206E-8
autofeatures	1	4.5116206E-8
autofinish	9	4.0604587E-7
autofluorescence	14	6.316269E-7
autofluorescent	4	1.8046482E-7
autogene	24	1.0827889E-6
autogestion	1	4.5116206E-8
autograph	37	1.6692996E-6
autograph-model	1	4.5116206E-8
autograph-seekers	1	4.5116206E-8
autographa	2	9.023241E-8
autographable	1	4.5116206E-8
autographed	15	6.767431E-7
autographing	4	1.8046482E-7
autographs	33	1.4888349E-6
autogrid	1	4.5116206E-8
autogrills	1	4.5116206E-8
autogynephiles	1	4.5116206E-8
autogynephilia	1	4.5116206E-8
autohagiography	1	4.5116206E-8
autoharp	1	4.5116206E-8
autoim-mune	1	4.5116206E-8
autoimmune	180	8.120917E-6
autoimmune-prone	1	4.5116206E-8
autoimmunity	47	2.1204617E-6
autoimmunity-prone	1	4.5116206E-8
autoimmunization	1	4.5116206E-8
autoinhibited	1	4.5116206E-8
autoinhibition	4	1.8046482E-7
autoinhibitory	5	2.2558103E-7
autolevels	1	4.5116206E-8
autolinee	1	4.5116206E-8
autologous	9	4.0604587E-7
autolysins	2	9.023241E-8
autolyzed	1	4.5116206E-8
automa	1	4.5116206E-8
automacs	2	9.023241E-8
automagical	1	4.5116206E-8
automagically	1	4.5116206E-8
automaker	16	7.218593E-7
automakers	63	2.842321E-6
automaking	1	4.5116206E-8
automata	2	9.023241E-8
automatable	1	4.5116206E-8
automate	19	8.572079E-7
automated	401	1.80916E-5
automated-cutting	1	4.5116206E-8
automates	3	1.3534861E-7
automatic	357	1.6106485E-5
automatic-cutting	4	1.8046482E-7
automatic-elevator	1	4.5116206E-8
automatic-shift	1	4.5116206E-8
automatic-teller	1	4.5116206E-8
automatic-transmission	1	4.5116206E-8
automatic-weapons	1	4.5116206E-8
automatical	1	4.5116206E-8
automatically	398	1.795625E-5
automatics	4	1.8046482E-7
automating	8	3.6092965E-7
automation	59	2.6618561E-6
automatiste	1	4.5116206E-8
automatistes	1	4.5116206E-8
automaton	5	2.2558103E-7
automaton-like	1	4.5116206E-8
automatons	3	1.3534861E-7
automats	1	4.5116206E-8
autometer	1	4.5116206E-8
automne	3	1.3534861E-7
automobile	195	8.7976605E-6
automobile-manual	1	4.5116206E-8
automobile-product	1	4.5116206E-8
automobiles	124	5.5944097E-6
automobilist	1	4.5116206E-8
automobilists	1	4.5116206E-8
automotive	75	3.3837155E-6
automotives	2	9.023241E-8
autonation	1	4.5116206E-8
autonomic	14	6.316269E-7
autonomist	1	4.5116206E-8
autonomists	2	9.023241E-8
autonomous	361	1.6286951E-5
autonomous-agent	3	1.3534861E-7
autonomously	11	4.962783E-7
autonomy	162	7.3088254E-6
autoparser	3	1.3534861E-7
autopenectomy	1	4.5116206E-8
autophagic	5	2.2558103E-7
autophagosome	1	4.5116206E-8
autophagosome-lysosome	1	4.5116206E-8
autophagosomes	1	4.5116206E-8
autophagy	8	3.6092965E-7
autophosphorylated	1	4.5116206E-8
autophosphorylates	1	4.5116206E-8
autophosphorylation	34	1.533951E-6
autopilot	32	1.4437186E-6
autopilots	6	2.7069723E-7
autopista	4	1.8046482E-7
autoplay	4	1.8046482E-7
autopo	1	4.5116206E-8
autopol	1	4.5116206E-8
autopolis	1	4.5116206E-8
autopolyploid	3	1.3534861E-7
autopolyploidy	11	4.962783E-7
autoprocess	1	4.5116206E-8
autopromote	3	1.3534861E-7
autopromoted	1	4.5116206E-8
autopromotion	2	9.023241E-8
autopsie	1	4.5116206E-8
autopsied	1	4.5116206E-8
autopsies	30	1.3534863E-6
autopsy	86	3.879994E-6
autopurge	1	4.5116206E-8
autoquant	1	4.5116206E-8
autor	1	4.5116206E-8
autoradiogaphy	2	9.023241E-8
autoradiogram	3	1.3534861E-7
autoradiograms	5	2.2558103E-7
autoradiograph	3	1.3534861E-7
autoradiographed	6	2.7069723E-7
autoradiographic	4	1.8046482E-7
autoradiographs	3	1.3534861E-7
autoradiography	40	1.8046483E-6
autoreactive	13	5.865107E-7
autoreactivity	1	4.5116206E-8
autoreceptors	1	4.5116206E-8
autoregressive	9	4.0604587E-7
autoregu-lation	1	4.5116206E-8
autoregulate	1	4.5116206E-8
autoregulation	3	1.3534861E-7
autoregulatory	11	4.962783E-7
autoreparaturwerkstatt	2	9.023241E-8
autoreplies	2	9.023241E-8
autoreply	1	4.5116206E-8
autoroute	16	7.218593E-7
autoroutes	1	4.5116206E-8
autos	14	6.316269E-7
autos-bmw-m	2	9.023241E-8
autos-bmw-z	1	4.5116206E-8
autos-column	2	9.023241E-8
autos-landrover-freelander	4	1.8046482E-7
autos-mercedes-sl	1	4.5116206E-8
autos-review	2	9.023241E-8
autosamdri	1	4.5116206E-8
autosampler	1	4.5116206E-8
autoscan	1	4.5116206E-8
autoschediastic	1	4.5116206E-8
autoscopes	1	4.5116206E-8
autosegmental	1	4.5116206E-8
autosomal	57	2.5716238E-6
autosomal-dominant	1	4.5116206E-8
autosomally	1	4.5116206E-8
autosome	1	4.5116206E-8
autosomes	16	7.218593E-7
autostick	2	9.023241E-8
autostrada	4	1.8046482E-7
autostrade	2	9.023241E-8
autosummarize	16	7.218593E-7
autothrottle	2	9.023241E-8
autotors	2	9.023241E-8
autotrader	2	9.023241E-8
autotrends	1	4.5116206E-8
autotroph	1	4.5116206E-8
autotrophically	1	4.5116206E-8
autoworkers	1	4.5116206E-8
autozooids	1	4.5116206E-8
autralian	1	4.5116206E-8
autre	2	9.023241E-8
autrum	1	4.5116206E-8
autry	10	4.5116207E-7
autsaid	1	4.5116206E-8
autumn	156	7.0381284E-6
autumnal	5	2.2558103E-7
autumny	1	4.5116206E-8
autun	4	1.8046482E-7
auu	2	9.023241E-8
auuua	5	2.2558103E-7
auuuuuugh	1	4.5116206E-8
auuuuuuuugh	1	4.5116206E-8
auvergnat	1	4.5116206E-8
auvergne	1	4.5116206E-8
auvers	8	3.6092965E-7
auvers-sur	4	1.8046482E-7
auvil	3	1.3534861E-7
auw	2	9.023241E-8
aux	32	1.4437186E-6
auxerre	2	9.023241E-8
auxerrois	1	4.5116206E-8
auxiliary	45	2.0302293E-6
auxin	17	7.669755E-7
auxin-induced	3	1.3534861E-7
auxin-regulated	1	4.5116206E-8
auxin-response	1	4.5116206E-8
auxin-responsive	1	4.5116206E-8
auxin-upregulated	1	4.5116206E-8
auxotroph	2	9.023241E-8
auxotrophic	6	2.7069723E-7
auxotrophs	5	2.2558103E-7
auxotrophy	4	1.8046482E-7
auyuittuq	3	1.3534861E-7
av	52	2.3460427E-6
ava	16	7.218593E-7
avac	3	1.3534861E-7
avaii	3	1.3534861E-7
avail	36	1.6241835E-6
availabilities	1	4.5116206E-8
availability	488	2.201671E-5
availability-based	3	1.3534861E-7
availabl	1	4.5116206E-8
available	4711	2.1254245E-4
available-anywhere	1	4.5116206E-8
availableto	1	4.5116206E-8
availed	2	9.023241E-8
availiable	1	4.5116206E-8
availing	1	4.5116206E-8
availresponses	1	4.5116206E-8
avalance	1	4.5116206E-8
avalanche	61	2.7520887E-6
avalanche-prone	1	4.5116206E-8
avalanches	67	3.022786E-6
avalanching	1	4.5116206E-8
avaler	2	9.023241E-8
avaliabel	1	4.5116206E-8
avaliable	3	1.3534861E-7
avallon	1	4.5116206E-8
avalokitesvara	1	4.5116206E-8
avalon	16	7.218593E-7
avaluacio	1	4.5116206E-8
avanesyan	1	4.5116206E-8
avant	11	4.962783E-7
avant-funk	1	4.5116206E-8
avant-garde	85	3.8348776E-6
avant-gardish	1	4.5116206E-8
avant-gardist	2	9.023241E-8
avant-gardists	2	9.023241E-8
avantazhiya	1	4.5116206E-8
avantgarde	1	4.5116206E-8
avantgo	2	9.023241E-8
avanti	3	1.3534861E-7
avanzino	1	4.5116206E-8
avarice	17	7.669755E-7
avaricious	14	6.316269E-7
avars	1	4.5116206E-8
avast	2	9.023241E-8
avatar	22	9.925566E-7
avatars	18	8.1209174E-7
avaya	1	4.5116206E-8
avco	1	4.5116206E-8
avda	13	5.865107E-7
avdat	1	4.5116206E-8
ave	75	3.3837155E-6
avebury	1	4.5116206E-8
avec	12	5.4139446E-7
avected	1	4.5116206E-8
aveda	10	4.5116207E-7
avedon	32	1.4437186E-6
aveeno	4	1.8046482E-7
aveenoed	1	4.5116206E-8
aveiro	4	1.8046482E-7
aveline	2	9.023241E-8
avelino	4	1.8046482E-7
avelok	1	4.5116206E-8
aven	6	2.7069723E-7
avena	2	9.023241E-8
avenage	1	4.5116206E-8
avenge	23	1.0376727E-6
avenged	6	2.7069723E-7
avenger	176	7.940453E-6
avengers	66	2.9776697E-6
avenges	1	4.5116206E-8
avenging	14	6.316269E-7
avengings	1	4.5116206E-8
avenida	43	1.939997E-6
avenin	1	4.5116206E-8
aventine	2	9.023241E-8
aventis	19	8.572079E-7
aventura	4	1.8046482E-7
aventuras	6	2.7069723E-7
aventures	1	4.5116206E-8
avenue	524	2.3640892E-5
avenues	107	4.827434E-6
aver	1	4.5116206E-8
avera	1	4.5116206E-8
average	3639	1.6417788E-4
average-distance	1	4.5116206E-8
average-income	1	4.5116206E-8
average-linkage	1	4.5116206E-8
average-looking	1	4.5116206E-8
average-or-better	1	4.5116206E-8
average-priced	1	4.5116206E-8
average-risk	4	1.8046482E-7
average-size	2	9.023241E-8
average-sized	1	4.5116206E-8
average-type	1	4.5116206E-8
average??ct	1	4.5116206E-8
averageclassification	1	4.5116206E-8
averaged	262	1.1820446E-5
averageness	2	9.023241E-8
averages	133	6.0004554E-6
averagesa	1	4.5116206E-8
averaging	116	5.23348E-6
averbukh	2	9.023241E-8
averell	1	4.5116206E-8
averett	2	9.023241E-8
averetts	1	4.5116206E-8
averil	1	4.5116206E-8
averitt	1	4.5116206E-8
avermectin	1	4.5116206E-8
averred	2	9.023241E-8
avers	10	4.5116207E-7
averse	25	1.1279052E-6
aversion	68	3.067902E-6
aversions	1	4.5116206E-8
aversive	2	9.023241E-8
avert	65	2.9325533E-6
averted	83	3.7446453E-6
averter	1	4.5116206E-8
avertin	2	9.023241E-8
averting	19	8.572079E-7
averts	5	2.2558103E-7
avertv	1	4.5116206E-8
avery	34	1.533951E-6
aves	2	9.023241E-8
avetz	1	4.5116206E-8
avez	1	4.5116206E-8
avezzano	9	4.0604587E-7
avg	1	4.5116206E-8
avgoustou	1	4.5116206E-8
avi	23	1.0376727E-6
avia	1	4.5116206E-8
avian	27	1.2181375E-6
aviand	1	4.5116206E-8
aviano	6	2.7069723E-7
aviaries	2	9.023241E-8
aviary	19	8.572079E-7
aviation	398	1.795625E-5
aviation-security-review	1	4.5116206E-8
aviation-to	1	4.5116206E-8
aviator	9	4.0604587E-7
aviatorka	1	4.5116206E-8
aviators	10	4.5116207E-7
aviatrix	2	9.023241E-8
aviatrixes	1	4.5116206E-8
avici	2	9.023241E-8
avid	104	4.6920854E-6
avid-vista	1	4.5116206E-8
avidin	23	1.0376727E-6
avidin-biotin	9	4.0604587E-7
avidin-biotin-horseradish	1	4.5116206E-8
avidin-biotin-peroxidase	6	2.7069723E-7
avidin-coated	1	4.5116206E-8
avidin-fluorophore	1	4.5116206E-8
avidin-peroxidase	1	4.5116206E-8
avidin-peroxidase-complex	1	4.5116206E-8
avidity	10	4.5116207E-7
avidly	21	9.4744036E-7
avifauna	1	4.5116206E-8
avigdor	1	4.5116206E-8
avignon	16	7.218593E-7
avila	36	1.6241835E-6
avildsen	1	4.5116206E-8
aviles	1	4.5116206E-8
avin	1	4.5116206E-8
avinash	1	4.5116206E-8
avineri	2	9.023241E-8
avinguda	11	4.962783E-7
avinoam	1	4.5116206E-8
aviod	1	4.5116206E-8
aviodome	2	9.023241E-8
avionics	10	4.5116207E-7
avirulence	2	9.023241E-8
avirulent	20	9.0232413E-7
avis	72	3.248367E-6
avise	3	1.3534861E-7
avishai	1	4.5116206E-8
avital	15	6.767431E-7
avium	77	3.473948E-6
aviuminfection	1	4.5116206E-8
aviv	156	7.0381284E-6
aviva	1	4.5116206E-8
avivah	1	4.5116206E-8
aviz	1	4.5116206E-8
avl	1	4.5116206E-8
avm	5	2.2558103E-7
avms	4	1.8046482E-7
avnet	4	1.8046482E-7
avo	1	4.5116206E-8
avoca	4	1.8046482E-7
avocado	31	1.3986024E-6
avocadoes	1	4.5116206E-8
avocados	9	4.0604587E-7
avocat	1	4.5116206E-8
avocation	3	1.3534861E-7
avocational	2	9.023241E-8
avocations	1	4.5116206E-8
avocet	1	4.5116206E-8
avogadro	2	9.023241E-8
avoid	1619	7.304314E-5
avoid-the-elephant	1	4.5116206E-8
avoid-y	3	1.3534861E-7
avoidable	16	7.218593E-7
avoidance	99	4.4665044E-6
avoidances	1	4.5116206E-8
avoidant	6	2.7069723E-7
avoide	1	4.5116206E-8
avoided	375	1.6918577E-5
avoider	1	4.5116206E-8
avoidest	1	4.5116206E-8
avoiding	297	1.3399514E-5
avoids	97	4.376272E-6
avoir	4	1.8046482E-7
avon	40	1.8046483E-6
avondale	1	4.5116206E-8
avonex	8	3.6092965E-7
avons	1	4.5116206E-8
avoparcin	10	4.5116207E-7
avord	2	9.023241E-8
avorded	1	4.5116206E-8
avoriaz	1	4.5116206E-8
avow	2	9.023241E-8
avowal	4	1.8046482E-7
avowed	19	8.572079E-7
avowedly	3	1.3534861E-7
avowing	2	9.023241E-8
avows	1	4.5116206E-8
avowtier	2	9.023241E-8
avp	31	1.3986024E-6
avp-induced	8	3.6092965E-7
avp-stimulated	1	4.5116206E-8
avpv	1	4.5116206E-8
avr	9	4.0604587E-7
avraham	2	9.023241E-8
avram	1	4.5116206E-8
avranches	6	2.7069723E-7
avrb	22	9.925566E-7
avrband	2	9.023241E-8
avril	11	4.962783E-7
avrpphb	1	4.5116206E-8
avrrpm	3	1.3534861E-7
avrrps	1	4.5116206E-8
avrrpt	38	1.7144158E-6
avs	5	2.2558103E-7
avsp	1	4.5116206E-8
avulsed	1	4.5116206E-8
avulsion	22	9.925566E-7
avuncular	12	5.4139446E-7
avus	1	4.5116206E-8
avvenire	1	4.5116206E-8
avvocato	1	4.5116206E-8
avß	6	2.7069723E-7
aw	184	8.301382E-6
aw-cgi	1	4.5116206E-8
aw-shucks	11	4.962783E-7
awacs	2	9.023241E-8
awadallah	7	3.1581345E-7
awadly	3	1.3534861E-7
awady	3	1.3534861E-7
awaii	4	1.8046482E-7
await	89	4.0153423E-6
awaited	32	1.4437186E-6
awaiting	142	6.406501E-6
awaits	63	2.842321E-6
awaji	4	1.8046482E-7
awake	186	8.391615E-6
awaked	1	4.5116206E-8
awaken	23	1.0376727E-6
awakened	38	1.7144158E-6
awakening	64	2.8874372E-6
awakenings	11	4.962783E-7
awakens	8	3.6092965E-7
awakes	3	1.3534861E-7
awaking	1	4.5116206E-8
awalt	2	9.023241E-8
awana	1	4.5116206E-8
awara	2	9.023241E-8
award	586	2.6438098E-5
award-giving	1	4.5116206E-8
award-ignorer	1	4.5116206E-8
award-nominated	2	9.023241E-8
award-show	1	4.5116206E-8
award-wining	2	9.023241E-8
award-winner	5	2.2558103E-7
award-winning	45	2.0302293E-6
award-worthy	2	9.023241E-8
awarded	227	1.0241379E-5
awardee	1	4.5116206E-8
awardees	2	9.023241E-8
awarding	50	2.2558104E-6
awards	454	2.0482757E-5
awards-watching	1	4.5116206E-8
aware	1147	5.1748288E-5
awareness	421	1.8993924E-5
awarenesses	1	4.5116206E-8
awas	4	1.8046482E-7
awash	37	1.6692996E-6
away	7012	3.1635485E-4
away-from-home	1	4.5116206E-8
away-where	1	4.5116206E-8
awayafter	1	4.5116206E-8
awayas	1	4.5116206E-8
awaypuff	1	4.5116206E-8
aways	2	9.023241E-8
awayyyy	1	4.5116206E-8
awb	1	4.5116206E-8
awda	1	4.5116206E-8
awe	126	5.684642E-6
awe-full	1	4.5116206E-8
awe-inspiring	23	1.0376727E-6
awe-struck	1	4.5116206E-8
awed	27	1.2181375E-6
aweek	1	4.5116206E-8
aweful	1	4.5116206E-8
aweight	1	4.5116206E-8
awere	2	9.023241E-8
awes	1	4.5116206E-8
awesome	343	1.547486E-5
awesome-ness	1	4.5116206E-8
awesomely	4	1.8046482E-7
awesomer	1	4.5116206E-8
awestruck	15	6.767431E-7
awful	738	3.329576E-5
awfulize	1	4.5116206E-8
awfully	135	6.0906877E-6
awfulness	8	3.6092965E-7
awg	1	4.5116206E-8
awhile	238	1.0737657E-5
awile	1	4.5116206E-8
awith	3	1.3534861E-7
awk	4	1.8046482E-7
awkward	250	1.1279051E-5
awkward-and	1	4.5116206E-8
awkward-embarassment	1	4.5116206E-8
awkward-sized	2	9.023241E-8
awkward-sounding	2	9.023241E-8
awkwardly	25	1.1279052E-6
awkwardness	33	1.4888349E-6
awkwardnessand	1	4.5116206E-8
awkwardnesses	1	4.5116206E-8
awl	2	9.023241E-8
awma	2	9.023241E-8
awni	1	4.5116206E-8
awning	11	4.962783E-7
awning-like	1	4.5116206E-8
awnings	4	1.8046482E-7
awo	13	5.865107E-7
awoke	27	1.2181375E-6
awoken	3	1.3534861E-7
awol	16	7.218593E-7
awolow	1	4.5116206E-8
awolowo	1	4.5116206E-8
awols	1	4.5116206E-8
awomanscorned	1	4.5116206E-8
awook	1	4.5116206E-8
awoooo	1	4.5116206E-8
awright	1	4.5116206E-8
awritten	1	4.5116206E-8
awry	41	1.8497644E-6
aws	2	9.023241E-8
awsat	14	6.316269E-7
awsome	1	4.5116206E-8
awverlooked	1	4.5116206E-8
aww	87	3.92511E-6
awww	59	2.6618561E-6
awwww	21	9.4744036E-7
awwwww	9	4.0604587E-7
awwwwww	3	1.3534861E-7
awwwwwww	1	4.5116206E-8
awwwwwwww	1	4.5116206E-8
awwwwwwwww	1	4.5116206E-8
awwwwwwwwwwwwwwwww	1	4.5116206E-8
awwwwwwwwwwwwwwwwww	1	4.5116206E-8
awzalagh	1	4.5116206E-8
ax	120	5.413945E-6
ax-grinders	1	4.5116206E-8
axa	13	5.865107E-7
axarquía	1	4.5116206E-8
axb	32	1.4437186E-6
axb-bxa	3	1.3534861E-7
axcalibur	1	4.5116206E-8
axe	106	4.782318E-6
axe-kick	1	4.5116206E-8
axe-man	1	4.5116206E-8
axe-murderer	2	9.023241E-8
axe-murderess	1	4.5116206E-8
axe-murdering	1	4.5116206E-8
axe-thing	1	4.5116206E-8
axecaliber	1	4.5116206E-8
axecalibre	1	4.5116206E-8
axecalibur	1	4.5116206E-8
axed	10	4.5116207E-7
axel	15	6.767431E-7
axelrod	5	2.2558103E-7
axels	2	9.023241E-8
axemen	1	4.5116206E-8
axenfeld	4	1.8046482E-7
axenic	14	6.316269E-7
axenically	5	2.2558103E-7
axercalibur	1	4.5116206E-8
axes	64	2.8874372E-6
axheads	1	4.5116206E-8
axi	2	9.023241E-8
axial	45	2.0302293E-6
axially	1	4.5116206E-8
axidental	1	4.5116206E-8
axilla	12	5.4139446E-7
axillae	2	9.023241E-8
axillary	69	3.1130182E-6
axin	12	5.4139446E-7
axing	1	4.5116206E-8
axinomancy	1	4.5116206E-8
axiocam	1	4.5116206E-8
axiom	60	2.7069725E-6
axiomated	1	4.5116206E-8
axiomatic	12	5.4139446E-7
axioms	52	2.3460427E-6
axiophot	9	4.0604587E-7
axioplan	3	1.3534861E-7
axioskop	5	2.2558103E-7
axiovert	6	2.7069723E-7
axiovision	1	4.5116206E-8
axis	261	1.177533E-5
axl	3	1.3534861E-7
axle	16	7.218593E-7
axle-deep	1	4.5116206E-8
axles	4	1.8046482E-7
axletrees	1	4.5116206E-8
axmaker	2	9.023241E-8
axminster	1	4.5116206E-8
axo-axonic	1	4.5116206E-8
axo-dendritic	2	9.023241E-8
axoclamp	1	4.5116206E-8
axogenesis	2	9.023241E-8
axol	1	4.5116206E-8
axon	67	3.022786E-6
axon-growth	1	4.5116206E-8
axonal	80	3.6092965E-6
axonemal	1	4.5116206E-8
axonin	1	4.5116206E-8
axonogenesis	3	1.3534861E-7
axonopodis	1	4.5116206E-8
axons	76	3.4288316E-6
axopatch	8	3.6092965E-7
axoplasm	1	4.5116206E-8
axotomy	21	9.4744036E-7
axotomy-induced	1	4.5116206E-8
axpression	1	4.5116206E-8
axuve	1	4.5116206E-8
axxon	3	1.3534861E-7
axxora	1	4.5116206E-8
axxw	1	4.5116206E-8
axyb	1	4.5116206E-8
axénique	1	4.5116206E-8
ay	338	1.5249278E-5
ay-sis	1	4.5116206E-8
aya	2	9.023241E-8
ayaat	1	4.5116206E-8
ayah	1	4.5116206E-8
ayala	2	9.023241E-8
ayalon	2	9.023241E-8
ayamonte	4	1.8046482E-7
ayant	1	4.5116206E-8
ayasofya	2	9.023241E-8
ayasuluk	1	4.5116206E-8
ayatollah	28	1.2632538E-6
ayatollahed	1	4.5116206E-8
ayatollahs	10	4.5116207E-7
ayazma	1	4.5116206E-8
aybak	2	9.023241E-8
aybar	1	4.5116206E-8
ayckbourn	1	4.5116206E-8
aycock	1	4.5116206E-8
aye	51	2.3009266E-6
aye-aye	1	4.5116206E-8
aye-yup	1	4.5116206E-8
ayemenem	2	9.023241E-8
ayer	6	2.7069723E-7
ayers	7	3.1581345E-7
ayerst	8	3.6092965E-7
ayes	3	1.3534861E-7
aygepong	2	9.023241E-8
ayi	1	4.5116206E-8
ayin	1	4.5116206E-8
aying	2	9.023241E-8
ayinger	2	9.023241E-8
ayios	6	2.7069723E-7
aykohyeb	2	9.023241E-8
aykroyd	5	2.2558103E-7
aylee	1	4.5116206E-8
aylene	1	4.5116206E-8
aylesbury	6	2.7069723E-7
aylward	8	3.6092965E-7
aym	2	9.023241E-8
ayman	11	4.962783E-7
aymara	6	2.7069723E-7
aymetrix	1	4.5116206E-8
ayn	34	1.533951E-6
aynak	6	2.7069723E-7
ayne	2	9.023241E-8
aynity	3	1.3534861E-7
aynohteb	1	4.5116206E-8
aynohyeb	13	5.865107E-7
aynohyeb-to-reunion	1	4.5116206E-8
ayodhya	2	9.023241E-8
ayran	1	4.5116206E-8
ayres	28	1.2632538E-6
ayrshire	1	4.5116206E-8
ayrton	1	4.5116206E-8
ays	2	9.023241E-8
aysel	6	2.7069723E-7
aytch	1	4.5116206E-8
ayto	10	4.5116207E-7
ayton	1	4.5116206E-8
ayub	1	4.5116206E-8
ayuhwa	1	4.5116206E-8
ayumi	2	9.023241E-8
ayun	1	4.5116206E-8
ayung	3	1.3534861E-7
ayuntamiento	12	5.4139446E-7
ayup	23	1.0376727E-6
ayurveda	1	4.5116206E-8
ayurveda-film-review	1	4.5116206E-8
ayvazian	2	9.023241E-8
ayvilik	1	4.5116206E-8
ayw	33	1.4888349E-6
ayway	1	4.5116206E-8
ayya	1	4.5116206E-8
ayyad	3	1.3534861E-7
ayyagari	1	4.5116206E-8
ayyam	2	9.023241E-8
ayyar	1	4.5116206E-8
ayyash	4	1.8046482E-7
ayyubid	2	9.023241E-8
ayyy	1	4.5116206E-8
ayyyyyy	1	4.5116206E-8
ayía	1	4.5116206E-8
az	111	5.007899E-6
az-bound	1	4.5116206E-8
az-dependent	1	4.5116206E-8
az-involved	1	4.5116206E-8
az?	1	4.5116206E-8
aza	31	1.3986024E-6
azac	1	4.5116206E-8
azacytidine	7	3.1581345E-7
azad	1	4.5116206E-8
azafrán	1	4.5116206E-8
azahara	2	9.023241E-8
azalea	5	2.2558103E-7
azaleas	19	8.572079E-7
azam	1	4.5116206E-8
azamehr	4	1.8046482E-7
azania	2	9.023241E-8
azar	2	9.023241E-8
azarchs	1	4.5116206E-8
azaria	6	2.7069723E-7
azathioprine	1	4.5116206E-8
azay	1	4.5116206E-8
azay-le	2	9.023241E-8
azazel	5	2.2558103E-7
azcan	2	9.023241E-8
azcentral	1	4.5116206E-8
azcárraga	1	4.5116206E-8
azdi	3	1.3534861E-7
azeglio	1	4.5116206E-8
azelaic	1	4.5116206E-8
azelaoyl	3	1.3534861E-7
azerbaijan	31	1.3986024E-6
azerbaijani	1	4.5116206E-8
azerbaijanis	4	1.8046482E-7
azeri	2	9.023241E-8
azevedo	5	2.2558103E-7
azhar	6	2.7069723E-7
azide	17	7.669755E-7
azido	2	9.023241E-8
azienda	1	4.5116206E-8
azimuth	1	4.5116206E-8
azincourt	3	1.3534861E-7
azing	1	4.5116206E-8
azinger	1	4.5116206E-8
azino-di	1	4.5116206E-8
azir	1	4.5116206E-8
aziz	251	1.1324168E-5
aziz-that	1	4.5116206E-8
aziza	3	1.3534861E-7
azizah	10	4.5116207E-7
azizia	4	1.8046482E-7
azkaban	12	5.4139446E-7
azköy	1	4.5116206E-8
azlan	1	4.5116206E-8
azle	1	4.5116206E-8
azmi	2	9.023241E-8
aznar	11	4.962783E-7
azo	1	4.5116206E-8
azoarcus	1	4.5116206E-8
azole	3	1.3534861E-7
azoles	2	9.023241E-8
azoospermia	2	9.023241E-8
azoreans	1	4.5116206E-8
azores	6	2.7069723E-7
azorín	1	4.5116206E-8
azospirillum	2	9.023241E-8
azotemia	8	3.6092965E-7
azotofixans	1	4.5116206E-8
azouga	1	4.5116206E-8
azoulay	4	1.8046482E-7
azoxymethane	1	4.5116206E-8
azoxymethane-induced	1	4.5116206E-8
azr	11	4.962783E-7
azraq	1	4.5116206E-8
azrou	57	2.5716238E-6
azt	37	1.6692996E-6
aztec	76	3.4288316E-6
azteca	1	4.5116206E-8
aztecas	1	4.5116206E-8
aztecs	28	1.2632538E-6
aztlan	3	1.3534861E-7
aztlán	25	1.1279052E-6
azul	6	2.7069723E-7
azulejo	18	8.1209174E-7
azulejo-covered	1	4.5116206E-8
azulejos	30	1.3534863E-6
azumano	1	4.5116206E-8
azur	11	4.962783E-7
azura	6	2.7069723E-7
azure	18	8.1209174E-7
azure-blue	1	4.5116206E-8
azurest	9	4.0604587E-7
azurite	1	4.5116206E-8
azusa	3	1.3534861E-7
azz	1	4.5116206E-8
azz-wee	1	4.5116206E-8
azzalat	1	4.5116206E-8
azzam	17	7.669755E-7
azzazzay	2	9.023241E-8
azzedine	2	9.023241E-8
azziz	1	4.5116206E-8
azzo	1	4.5116206E-8
azzurra	2	9.023241E-8
azzy-gazzies	1	4.5116206E-8
a­	1	4.5116206E-8
aß	7	3.1581345E-7
aäronkerk	1	4.5116206E-8
açoeitas	2	9.023241E-8
aétmis	2	9.023241E-8
aéã	3	1.3534861E-7
aìé	1	4.5116206E-8
aìê	2	9.023241E-8
aïnhoa	1	4.5116206E-8
aïtone	2	9.023241E-8
añejo	1	4.5116206E-8
añera	1	4.5116206E-8
añtakis	1	4.5116206E-8
aý	3	1.3534861E-7
a–	4	1.8046482E-7
a–a	1	4.5116206E-8
a–c	3	1.3534861E-7
b	10038	4.5287647E-4
b-b	2	9.023241E-8
b-b-bye	1	4.5116206E-8
b-b-c	1	4.5116206E-8
b-b-s	1	4.5116206E-8
b-ball	4	1.8046482E-7
b-based	1	4.5116206E-8
b-binding	1	4.5116206E-8
b-boys	2	9.023241E-8
b-c	9	4.0604587E-7
b-cll	3	1.3534861E-7
b-d	8	3.6092965E-7
b-day	11	4.962783E-7
b-dna	8	3.6092965E-7
b-duplicate	1	4.5116206E-8
b-expressing	2	9.023241E-8
b-f	2	9.023241E-8
b-fast	1	4.5116206E-8
b-i-g	1	4.5116206E-8
b-l-a-a-a-n-d	1	4.5116206E-8
b-m	3	1.3534861E-7
b-m-i	1	4.5116206E-8
b-mediated	1	4.5116206E-8
b-mercaptoethanol	1	4.5116206E-8
b-o	9	4.0604587E-7
b-p	1	4.5116206E-8
b-r	5	2.2558103E-7
b-r-e-a-s-t-s	1	4.5116206E-8
b-r-o-i-l-e-r	2	9.023241E-8
b-roll	1	4.5116206E-8
b-s	9	4.0604587E-7
b-s-e	11	4.962783E-7
b-school	1	4.5116206E-8
b-side	6	2.7069723E-7
b-sides	3	1.3534861E-7
b-skp	1	4.5116206E-8
b-spline	1	4.5116206E-8
b-sulfur	1	4.5116206E-8
b-t	2	9.023241E-8
b-u-f-f-y	1	4.5116206E-8
b-w	1	4.5116206E-8
b-x	1	4.5116206E-8
b-y	4	1.8046482E-7
b-y-b-x	1	4.5116206E-8
b-z	1	4.5116206E-8
b?dn?s	1	4.5116206E-8
b?gédá	1	4.5116206E-8
b?ij?ng	1	4.5116206E-8
b?k	2	9.023241E-8
b?l?	1	4.5116206E-8
b?lí	2	9.023241E-8
b?ngd?o	1	4.5116206E-8
b?s	1	4.5116206E-8
b?twulf	1	4.5116206E-8
ba	89	4.0153423E-6
ba-a-a-a-a-a-a-d	1	4.5116206E-8
ba-aa	1	4.5116206E-8
ba-con-an-eh-guh-zuh	1	4.5116206E-8
baa	8	3.6092965E-7
baaaaaaaaaaaack	1	4.5116206E-8
baaaaaaaaaad	1	4.5116206E-8
baaaaaaaaack	1	4.5116206E-8
baaaaaaad	1	4.5116206E-8
baaaaaay	1	4.5116206E-8
baaaaad	2	9.023241E-8
baaaacckkkkk	1	4.5116206E-8
baaaad	1	4.5116206E-8
baaaasil	1	4.5116206E-8
baaack	1	4.5116206E-8
baaad	2	9.023241E-8
baaah	1	4.5116206E-8
baaas	1	4.5116206E-8
baad	1	4.5116206E-8
baade	1	4.5116206E-8
baader	3	1.3534861E-7
baal	6	2.7069723E-7
baalbek	1	4.5116206E-8
baar	2	9.023241E-8
baath	3	1.3534861E-7
baathists	1	4.5116206E-8
bab	14	6.316269E-7
baba	25	1.1279052E-6
babababababa	1	4.5116206E-8
babaganoush	1	4.5116206E-8
babalicious	1	4.5116206E-8
babaloo	1	4.5116206E-8
babar	4	1.8046482E-7
babas	23	1.0376727E-6
babas-limoncello	1	4.5116206E-8
babb	3	1.3534861E-7
babbage	1	4.5116206E-8
babbidge	1	4.5116206E-8
babbitt	33	1.4888349E-6
babble	29	1.30837E-6
babble-on-ion	1	4.5116206E-8
babble-y	1	4.5116206E-8
babblebabble	1	4.5116206E-8
babbled	2	9.023241E-8
babblefish	1	4.5116206E-8
babbler	1	4.5116206E-8
babblers	2	9.023241E-8
babbles	8	3.6092965E-7
babbling	32	1.4437186E-6
babbly	2	9.023241E-8
babbo	1	4.5116206E-8
babby	4	1.8046482E-7
babco	3	1.3534861E-7
babcock	20	9.0232413E-7
babcocks	1	4.5116206E-8
babe	145	6.54185E-6
babel	11	4.962783E-7
babeland	2	9.023241E-8
babelard	1	4.5116206E-8
babelfish	7	3.1581345E-7
babelian	2	9.023241E-8
babelicious	2	9.023241E-8
babeling	1	4.5116206E-8
babelon	1	4.5116206E-8
babelsberg	4	1.8046482E-7
babely	1	4.5116206E-8
babeness	1	4.5116206E-8
babers	1	4.5116206E-8
babes	26	1.1730214E-6
babes-dancing-on-bars	1	4.5116206E-8
babied	2	9.023241E-8
babies	521	2.3505543E-5
babies-to-be	1	4.5116206E-8
babij	6	2.7069723E-7
babillard	1	4.5116206E-8
babington	1	4.5116206E-8
babitch	3	1.3534861E-7
bablok	1	4.5116206E-8
baboia	1	4.5116206E-8
baboon	27	1.2181375E-6
baboons	29	1.30837E-6
babor	7	3.1581345E-7
babs	5	2.2558103E-7
babsitting	1	4.5116206E-8
babson	5	2.2558103E-7
babu	3	1.3534861E-7
babuino	2	9.023241E-8
babur	6	2.7069723E-7
babus	2	9.023241E-8
babushkaphobia	1	4.5116206E-8
babushkas	3	1.3534861E-7
baby	2137	9.6413336E-5
baby-back	1	4.5116206E-8
baby-blue	2	9.023241E-8
baby-boom	1	4.5116206E-8
baby-boomer	7	3.1581345E-7
baby-boomers	2	9.023241E-8
baby-child	1	4.5116206E-8
baby-death	1	4.5116206E-8
baby-dyke	1	4.5116206E-8
baby-eater	1	4.5116206E-8
baby-eating	1	4.5116206E-8
baby-faced	4	1.8046482E-7
baby-fat	2	9.023241E-8
baby-fucker	2	9.023241E-8
baby-having	1	4.5116206E-8
baby-killer	2	9.023241E-8
baby-killing	1	4.5116206E-8
baby-making	2	9.023241E-8
baby-murder	1	4.5116206E-8
baby-name	1	4.5116206E-8
baby-naming	1	4.5116206E-8
baby-related	1	4.5116206E-8
baby-sat	1	4.5116206E-8
baby-seal	1	4.5116206E-8
baby-seat	1	4.5116206E-8
baby-seatwith	1	4.5116206E-8
baby-shit	1	4.5116206E-8
baby-sit	8	3.6092965E-7
baby-sits	2	9.023241E-8
baby-sitter	1	4.5116206E-8
baby-sitting	21	9.4744036E-7
baby-sittingism	1	4.5116206E-8
baby-sized	1	4.5116206E-8
baby-slayers	1	4.5116206E-8
baby-smooth	1	4.5116206E-8
baby-snatching	1	4.5116206E-8
baby-talk	2	9.023241E-8
baby-talking	2	9.023241E-8
baby-thieves	1	4.5116206E-8
baby-to-be	1	4.5116206E-8
babybel	3	1.3534861E-7
babybitches	1	4.5116206E-8
babybjorn	1	4.5116206E-8
babyboom	1	4.5116206E-8
babycake	1	4.5116206E-8
babycakes	7	3.1581345E-7
babycenter	1	4.5116206E-8
babycheeks	1	4.5116206E-8
babyface	7	3.1581345E-7
babyface-style	1	4.5116206E-8
babyfaced	1	4.5116206E-8
babyfaces	1	4.5116206E-8
babyfeeding	1	4.5116206E-8
babyfood	1	4.5116206E-8
babyhood	4	1.8046482E-7
babyish	5	2.2558103E-7
babyista	1	4.5116206E-8
babykristen	1	4.5116206E-8
babyland	3	1.3534861E-7
babylon	39	1.7595321E-6
babylone	1	4.5116206E-8
babylonia	1	4.5116206E-8
babylonian	20	9.0232413E-7
babylonians	4	1.8046482E-7
babylons	1	4.5116206E-8
babymaybe	1	4.5116206E-8
babyname	1	4.5116206E-8
babynap	1	4.5116206E-8
babyraper	1	4.5116206E-8
babyrs	2	9.023241E-8
babysat	12	5.4139446E-7
babyshit	4	1.8046482E-7
babysit	42	1.8948807E-6
babysitter	58	2.61674E-6
babysitters	22	9.925566E-7
babysitting	48	2.1655778E-6
babysittingwise	1	4.5116206E-8
babyslings	1	4.5116206E-8
babysnatching	1	4.5116206E-8
babysteps	1	4.5116206E-8
babystuff	2	9.023241E-8
babytalk	5	2.2558103E-7
babywise	2	9.023241E-8
bac	282	1.272277E-5
bac-ac	1	4.5116206E-8
bac-based	8	3.6092965E-7
bac-by-bac	1	4.5116206E-8
bac-derived	2	9.023241E-8
bac-end	5	2.2558103E-7
bac-sized	1	4.5116206E-8
bac-to	1	4.5116206E-8
baca	27	1.2181375E-6
bacah	1	4.5116206E-8
bacalaocodfishmelocotónpeach	1	4.5116206E-8
bacalaocodfishnaranjaorange	1	4.5116206E-8
bacalhao	1	4.5116206E-8
bacalhau	2	9.023241E-8
bacall	13	5.865107E-7
bacall-like	1	4.5116206E-8
bacanovic	18	8.1209174E-7
bacardi	6	2.7069723E-7
bacardí	4	1.8046482E-7
baccalaureat	2	9.023241E-8
baccanal	1	4.5116206E-8
baccarat	14	6.316269E-7
baccaro	1	4.5116206E-8
bacchae	1	4.5116206E-8
bacchanal	2	9.023241E-8
bacchanale	1	4.5116206E-8
bacchanalia	2	9.023241E-8
bacchanalian	1	4.5116206E-8
bacchanals	1	4.5116206E-8
bacchants	1	4.5116206E-8
bacchetta	3	1.3534861E-7
bacchus	9	4.0604587E-7
bace	1	4.5116206E-8
bacgtgkm	1	4.5116206E-8
bach	58	2.61674E-6
bacha	1	4.5116206E-8
bacharach	9	4.0604587E-7
bachaxichuch	1	4.5116206E-8
bachelard	2	9.023241E-8
bachellier	1	4.5116206E-8
bachelor	134	6.045572E-6
bachelorette	9	4.0604587E-7
bachelorettes	1	4.5116206E-8
bachelorhood	5	2.2558103E-7
bachelors	16	7.218593E-7
bachem	2	9.023241E-8
bachir	1	4.5116206E-8
bachl	1	4.5116206E-8
bachman	5	2.2558103E-7
bachofen	1	4.5116206E-8
bachs	1	4.5116206E-8
bachula	2	9.023241E-8
bacilli	22	9.925566E-7
bacillus	88	3.9702263E-6
bacilluscultures	1	4.5116206E-8
bacino	1	4.5116206E-8
bacio	1	4.5116206E-8
bacitracin	3	1.3534861E-7
back	17572	7.92782E-4
back-against-the-wall	1	4.5116206E-8
back-alley	1	4.5116206E-8
back-among-the-white-hats	1	4.5116206E-8
back-and-forth	16	7.218593E-7
back-and-forths	2	9.023241E-8
back-ansa	1	4.5116206E-8
back-axle	4	1.8046482E-7
back-bench	1	4.5116206E-8
back-bencher	2	9.023241E-8
back-bone	1	4.5116206E-8
back-bounce	1	4.5116206E-8
back-breaking	2	9.023241E-8
back-burnered	1	4.5116206E-8
back-clapping	1	4.5116206E-8
back-country	3	1.3534861E-7
back-cover	1	4.5116206E-8
back-cross	1	4.5116206E-8
back-door	2	9.023241E-8
back-end	3	1.3534861E-7
back-firing	1	4.5116206E-8
back-formation	5	2.2558103E-7
back-formed	6	2.7069723E-7
back-from-the-dead	1	4.5116206E-8
back-hall	1	4.5116206E-8
back-handed	2	9.023241E-8
back-heeled	1	4.5116206E-8
back-holler	1	4.5116206E-8
back-home	1	4.5116206E-8
back-kick	1	4.5116206E-8
back-leak	2	9.023241E-8
back-lighted	1	4.5116206E-8
back-lit	1	4.5116206E-8
back-locked	2	9.023241E-8
back-lot	1	4.5116206E-8
back-lots	1	4.5116206E-8
back-ma	1	4.5116206E-8
back-nine	1	4.5116206E-8
back-of-envelope	1	4.5116206E-8
back-of-the-envelope	2	9.023241E-8
back-of-the-front-section	1	4.5116206E-8
back-ordered	1	4.5116206E-8
back-page	5	2.2558103E-7
back-pat	2	9.023241E-8
back-patting	2	9.023241E-8
back-phosphorylated	1	4.5116206E-8
back-reading	1	4.5116206E-8
back-related	1	4.5116206E-8
back-riding	1	4.5116206E-8
back-road	1	4.5116206E-8
back-room	8	3.6092965E-7
back-ruffle	1	4.5116206E-8
back-runs	1	4.5116206E-8
back-scratcher	1	4.5116206E-8
back-scratchers	1	4.5116206E-8
back-scratching	1	4.5116206E-8
back-seat	4	1.8046482E-7
back-selection	1	4.5116206E-8
back-shooters	1	4.5116206E-8
back-size	1	4.5116206E-8
back-slapping	2	9.023241E-8
back-stabbers	1	4.5116206E-8
back-stabbing	6	2.7069723E-7
back-stage	1	4.5116206E-8
back-stop	3	1.3534861E-7
back-story	2	9.023241E-8
back-street	1	4.5116206E-8
back-talking	1	4.5116206E-8
back-to	2	9.023241E-8
back-to-back	51	2.3009266E-6
back-to-basics	2	9.023241E-8
back-to-nature	1	4.5116206E-8
back-to-school	7	3.1581345E-7
back-to-school-shopping	1	4.5116206E-8
back-to-the-future	1	4.5116206E-8
back-to-the-wall	1	4.5116206E-8
back-to-work	2	9.023241E-8
back-tracking	1	4.5116206E-8
back-transformed	1	4.5116206E-8
back-translated	1	4.5116206E-8
back-up	18	8.1209174E-7
back-ups	4	1.8046482E-7
back-wards	1	4.5116206E-8
back-while-dead	1	4.5116206E-8
back-window	1	4.5116206E-8
back-yard	1	4.5116206E-8
backache	2	9.023241E-8
backaches	4	1.8046482E-7
backbay	1	4.5116206E-8
backbeat	8	3.6092965E-7
backbeats	1	4.5116206E-8
backbencher	3	1.3534861E-7
backbenchers	1	4.5116206E-8
backbiting	1	4.5116206E-8
backboard	3	1.3534861E-7
backbone	155	6.993012E-6
backbone-specific	2	9.023241E-8
backbones	9	4.0604587E-7
backbreaking	4	1.8046482E-7
backcast	1	4.5116206E-8
backchannel	1	4.5116206E-8
backcloth	1	4.5116206E-8
backcountry	1	4.5116206E-8
backcourt	6	2.7069723E-7
backcourts	1	4.5116206E-8
backcross	16	7.218593E-7
backcrossed	11	4.962783E-7
backcrosses	5	2.2558103E-7
backcrossing	2	9.023241E-8
backcrosssing	1	4.5116206E-8
backdated	1	4.5116206E-8
backdating	1	4.5116206E-8
backdoor	17	7.669755E-7
backdown	1	4.5116206E-8
backdraft	5	2.2558103E-7
backdrop	135	6.0906877E-6
backdropped	2	9.023241E-8
backdrops	10	4.5116207E-7
backe	2	9.023241E-8
backed	368	1.6602764E-5
backed-into-a-corner	1	4.5116206E-8
backed-up	2	9.023241E-8
backend	1	4.5116206E-8
backer	16	7.218593E-7
backers	47	2.1204617E-6
backfield	3	1.3534861E-7
backfill	3	1.3534861E-7
backfilling	1	4.5116206E-8
backfin	2	9.023241E-8
backfire	29	1.30837E-6
backfired	24	1.0827889E-6
backfires	5	2.2558103E-7
backfiring	8	3.6092965E-7
backfist	1	4.5116206E-8
backflip	1	4.5116206E-8
backflips	3	1.3534861E-7
backflung	1	4.5116206E-8
backgammon	9	4.0604587E-7
backgound	1	4.5116206E-8
backgro	1	4.5116206E-8
background	2253	1.01646816E-4
background-color	1	4.5116206E-8
background-corrected	11	4.962783E-7
background-dependent	1	4.5116206E-8
background-foreground	1	4.5116206E-8
background-free	2	9.023241E-8
background-leveled	1	4.5116206E-8
background-leveling	1	4.5116206E-8
background-staining	1	4.5116206E-8
background-subtracted	14	6.316269E-7
backgrounder	9	4.0604587E-7
backgrounders	2	9.023241E-8
backgrounds	139	6.271153E-6
backgrounds-such	1	4.5116206E-8
backguard	1	4.5116206E-8
backhand	18	8.1209174E-7
backhanded	20	9.0232413E-7
backhandedly	1	4.5116206E-8
backhands	2	9.023241E-8
backheel	1	4.5116206E-8
backhendl	1	4.5116206E-8
backhoe	2	9.023241E-8
backhoes	2	9.023241E-8
backing	243	1.0963238E-5
backing-and-forthing	1	4.5116206E-8
backing-up	1	4.5116206E-8
backing-vocals-less	1	4.5116206E-8
backlands	1	4.5116206E-8
backlash	156	7.0381284E-6
backlashed	1	4.5116206E-8
backlashes	1	4.5116206E-8
backless	5	2.2558103E-7
backlighting	2	9.023241E-8
backlist	4	1.8046482E-7
backlit	5	2.2558103E-7
backlog	54	2.436275E-6
backlogged	4	1.8046482E-7
backlogs	7	3.1581345E-7
backlot	1	4.5116206E-8
backlund	1	4.5116206E-8
backma	3	1.3534861E-7
backness	1	4.5116206E-8
backoff	1	4.5116206E-8
backolog	1	4.5116206E-8
backordered	1	4.5116206E-8
backpack	37	1.6692996E-6
backpacked	2	9.023241E-8
backpacker	5	2.2558103E-7
backpackers	11	4.962783E-7
backpacking	27	1.2181375E-6
backpacks	26	1.1730214E-6
backpedal	1	4.5116206E-8
backpedaled	1	4.5116206E-8
backpedaling	7	3.1581345E-7
backpedalling	1	4.5116206E-8
backpeddalling	1	4.5116206E-8
backpropagation	2	9.023241E-8
backrest	1	4.5116206E-8
backroad	1	4.5116206E-8
backroads	2	9.023241E-8
backroom	11	4.962783E-7
backrooms	2	9.023241E-8
backrub	2	9.023241E-8
backrubbing	1	4.5116206E-8
backs	228	1.0286495E-5
backscattered	4	1.8046482E-7
backseat	31	1.3986024E-6
backseats	3	1.3534861E-7
backsent	1	4.5116206E-8
backshadowing	1	4.5116206E-8
backshops	1	4.5116206E-8
backside	14	6.316269E-7
backside-to	1	4.5116206E-8
backsides	5	2.2558103E-7
backslapping	5	2.2558103E-7
backslappy	1	4.5116206E-8
backslash-column	1	4.5116206E-8
backslid	3	1.3534861E-7
backslid-smoking	1	4.5116206E-8
backslide	1	4.5116206E-8
backsliding	8	3.6092965E-7
backsolver	1	4.5116206E-8
backspace	1	4.5116206E-8
backspin	7	3.1581345E-7
backspins	1	4.5116206E-8
backstabbage	1	4.5116206E-8
backstabbing	5	2.2558103E-7
backstage	53	2.391159E-6
backstitch	1	4.5116206E-8
backstitches	1	4.5116206E-8
backstop	7	3.1581345E-7
backstories	1	4.5116206E-8
backstory	45	2.0302293E-6
backstreet	19	8.572079E-7
backstreets	5	2.2558103E-7
backstretch	8	3.6092965E-7
backswamp	7	3.1581345E-7
backswamps	1	4.5116206E-8
backswing	4	1.8046482E-7
backto	1	4.5116206E-8
backtrack	10	4.5116207E-7
backtracked	4	1.8046482E-7
backtracking	13	5.865107E-7
backtracks	1	4.5116206E-8
backup	162	7.3088254E-6
backups	17	7.669755E-7
backus	14	6.316269E-7
backward	199	8.978125E-6
backward-beating	1	4.5116206E-8
backward-facing	1	4.5116206E-8
backward-looking	2	9.023241E-8
backward-pivot	1	4.5116206E-8
backward-slanted	1	4.5116206E-8
backwardness	4	1.8046482E-7
backwards	144	6.496734E-6
backwash	3	1.3534861E-7
backwater	36	1.6241835E-6
backwaters	7	3.1581345E-7
backwith	1	4.5116206E-8
backwoods	9	4.0604587E-7
backword	6	2.7069723E-7
backwords	16	7.218593E-7
backyard	180	8.120917E-6
backyard-vehicles	1	4.5116206E-8
backyards	11	4.962783E-7
baclofen	9	4.0604587E-7
bacome	1	4.5116206E-8
bacon	186	8.391615E-6
bacon-and-cheese	1	4.5116206E-8
baconao	2	9.023241E-8
baconburgare	1	4.5116206E-8
baconwhores	2	9.023241E-8
bacopa	1	4.5116206E-8
bacpac	3	1.3534861E-7
bacr	6	2.7069723E-7
bacronyms	1	4.5116206E-8
bacs	84	3.7897614E-6
bacsik	9	4.0604587E-7
bacstitcher	2	9.023241E-8
bacsu	1	4.5116206E-8
bact	21	9.4744036E-7
bactalert	1	4.5116206E-8
bactec	1	4.5116206E-8
bacteremia	35	1.5790672E-6
bacteremias	5	2.2558103E-7
bacteremic	1	4.5116206E-8
bacteria	1213	5.472596E-5
bacteria-containing	1	4.5116206E-8
bacteria-eating	1	4.5116206E-8
bacteria-laden	1	4.5116206E-8
bacteria-like	2	9.023241E-8
bacteria-specific	2	9.023241E-8
bacterial	777	3.505529E-5
bacterial-specific	3	1.3534861E-7
bacterial-type	1	4.5116206E-8
bacterially	14	6.316269E-7
bacterially-derived	2	9.023241E-8
bacterially-expressed	1	4.5116206E-8
bacterial–insect	1	4.5116206E-8
bactericidal	15	6.767431E-7
bacteriochlorophyll	1	4.5116206E-8
bacteriocide	1	4.5116206E-8
bacteriocytes	2	9.023241E-8
bacteriologic	1	4.5116206E-8
bacteriological	6	2.7069723E-7
bacteriologically	1	4.5116206E-8
bacteriologist	2	9.023241E-8
bacteriologists	2	9.023241E-8
bacteriology	3	1.3534861E-7
bacteriolytic	2	9.023241E-8
bacteriome	19	8.572079E-7
bacteriomes	4	1.8046482E-7
bacteriophage	56	2.5265076E-6
bacteriophages	18	8.1209174E-7
bacteriorhodopsin	2	9.023241E-8
bacteriostatic	2	9.023241E-8
bacterium	118	5.3237122E-6
bacteroides	1	4.5116206E-8
bacteroidetes	1	4.5116206E-8
bactine	1	4.5116206E-8
bacto	3	1.3534861E-7
bacto-agar	1	4.5116206E-8
bacto-peptone	2	9.023241E-8
bacto-tryptone	1	4.5116206E-8
bactopeptone	1	4.5116206E-8
bactria	1	4.5116206E-8
bactrian	1	4.5116206E-8
baculogold	1	4.5116206E-8
baculometry	2	9.023241E-8
baculoviral	1	4.5116206E-8
baculoviridae	1	4.5116206E-8
baculovirus	63	2.842321E-6
baculovirus-derived	1	4.5116206E-8
baculovirus-infected	2	9.023241E-8
baculoviruses	17	7.669755E-7
bad	7109	3.207311E-4
bad-address	2	9.023241E-8
bad-arrest	1	4.5116206E-8
bad-ass	18	8.1209174E-7
bad-behaviour	1	4.5116206E-8
bad-boy	7	3.1581345E-7
bad-boy-meets-good-girl	1	4.5116206E-8
bad-breathed	1	4.5116206E-8
bad-brother	1	4.5116206E-8
bad-clothes	1	4.5116206E-8
bad-cockney-accent	2	9.023241E-8
bad-day	1	4.5116206E-8
bad-day-having	1	4.5116206E-8
bad-dream	1	4.5116206E-8
bad-egg	1	4.5116206E-8
bad-fan-fic-a-licious	1	4.5116206E-8
bad-food	1	4.5116206E-8
bad-for-me	1	4.5116206E-8
bad-for-you	1	4.5116206E-8
bad-girl	1	4.5116206E-8
bad-guy	3	1.3534861E-7
bad-guys	2	9.023241E-8
bad-habit	1	4.5116206E-8
bad-hop	1	4.5116206E-8
bad-influence	1	4.5116206E-8
bad-info	1	4.5116206E-8
bad-job	1	4.5116206E-8
bad-mannered	2	9.023241E-8
bad-mouthed	1	4.5116206E-8
bad-mouthing	4	1.8046482E-7
bad-mouths	1	4.5116206E-8
bad-news	2	9.023241E-8
bad-novel	1	4.5116206E-8
bad-smelling	1	4.5116206E-8
bad-teeth	1	4.5116206E-8
bad-tempered	3	1.3534861E-7
bad-tv	1	4.5116206E-8
bad-tv-that	1	4.5116206E-8
bad-writing	1	4.5116206E-8
bad-writing-contest	1	4.5116206E-8
bada	6	2.7069723E-7
badaccent	1	4.5116206E-8
badacsony	4	1.8046482E-7
badae	1	4.5116206E-8
badaguan	1	4.5116206E-8
badain	1	4.5116206E-8
badalamenti	1	4.5116206E-8
badaling	13	5.865107E-7
badalucco	2	9.023241E-8
badang	2	9.023241E-8
badar	1	4.5116206E-8
badaracco	2	9.023241E-8
badareeen	1	4.5116206E-8
badass	31	1.3986024E-6
badassed	2	9.023241E-8
badasses	1	4.5116206E-8
badassitude	1	4.5116206E-8
badassness	1	4.5116206E-8
badasswes	1	4.5116206E-8
badawi	10	4.5116207E-7
badbert	1	4.5116206E-8
badboy	1	4.5116206E-8
baddeck	3	1.3534861E-7
baddeley	2	9.023241E-8
badder	2	9.023241E-8
baddest	6	2.7069723E-7
baddie	13	5.865107E-7
baddies	22	9.925566E-7
baddy	2	9.023241E-8
bade	8	3.6092965E-7
badel	1	4.5116206E-8
badella	2	9.023241E-8
badelt	1	4.5116206E-8
baden	8	3.6092965E-7
badenheim	1	4.5116206E-8
badeparadies	1	4.5116206E-8
bader	12	5.4139446E-7
badesch	3	1.3534861E-7
badfic	24	1.0827889E-6
badfics	2	9.023241E-8
badge	57	2.5716238E-6
badge-carrying	1	4.5116206E-8
badge-wearing	1	4.5116206E-8
badger	26	1.1730214E-6
badgered	5	2.2558103E-7
badgering	9	4.0604587E-7
badgers	11	4.962783E-7
badges	29	1.30837E-6
badgett	2	9.023241E-8
badging	2	9.023241E-8
badgir	1	4.5116206E-8
badgley	1	4.5116206E-8
badgoodbad	1	4.5116206E-8
badia	3	1.3534861E-7
badiale	1	4.5116206E-8
badie	2	9.023241E-8
badillo	1	4.5116206E-8
badinage	6	2.7069723E-7
badlaa	1	4.5116206E-8
badlands	9	4.0604587E-7
badler	1	4.5116206E-8
badly	553	2.4949262E-5
badly-coifed	1	4.5116206E-8
badly-fitting	1	4.5116206E-8
badly-spelled	1	4.5116206E-8
badlys	1	4.5116206E-8
badminton	8	3.6092965E-7
badminton-set-size	1	4.5116206E-8
badmouth	2	9.023241E-8
badmouthing	6	2.7069723E-7
badness	18	8.1209174E-7
badrakkhan	1	4.5116206E-8
badran	2	9.023241E-8
badre	1	4.5116206E-8
bads	11	4.962783E-7
badtrip	1	4.5116206E-8
badtv	2	9.023241E-8
badtz-maru	1	4.5116206E-8
badtzmaru	2	9.023241E-8
badtzmobile	2	9.023241E-8
badu	4	1.8046482E-7
baduizm	1	4.5116206E-8
badump-bump	1	4.5116206E-8
badung	5	2.2558103E-7
badwagon	1	4.5116206E-8
badwater	1	4.5116206E-8
bae	3	1.3534861E-7
baebe	2	9.023241E-8
baebes	5	2.2558103E-7
baec	1	4.5116206E-8
baecs	52	2.3460427E-6
baed	1	4.5116206E-8
baedeker	2	9.023241E-8
baen	1	4.5116206E-8
baenen	4	1.8046482E-7
baeomyces	3	1.3534861E-7
baer	8	3.6092965E-7
baerga	7	3.1581345E-7
baerlestraat	2	9.023241E-8
baerlstraat	1	4.5116206E-8
baesler	1	4.5116206E-8
baetica	3	1.3534861E-7
baez	10	4.5116207E-7
baf	2	9.023241E-8
baff	1	4.5116206E-8
baffert	24	1.0827889E-6
baffin	4	1.8046482E-7
baffle	13	5.865107E-7
baffled	88	3.9702263E-6
bafflement	9	4.0604587E-7
bafflements	1	4.5116206E-8
baffler	6	2.7069723E-7
baffles	20	9.0232413E-7
baffling	28	1.2632538E-6
baffoonish	1	4.5116206E-8
bag	733	3.307018E-5
bag-blind	1	4.5116206E-8
bag-lady	2	9.023241E-8
bag-of-blood-girl	3	1.3534861E-7
bag-snatchers	1	4.5116206E-8
bagain	1	4.5116206E-8
baganoff	1	4.5116206E-8
bagatelle	2	9.023241E-8
bagatellelike	1	4.5116206E-8
bagbalm	1	4.5116206E-8
bagbound	2	9.023241E-8
bagby	1	4.5116206E-8
bagdad	3	1.3534861E-7
bagdikian	3	1.3534861E-7
bagdogra	1	4.5116206E-8
bage	2	9.023241E-8
bagehot	3	1.3534861E-7
bagel	84	3.7897614E-6
bagel-munching	1	4.5116206E-8
bagel-shaped	1	4.5116206E-8
bagels	68	3.067902E-6
bagemihl	13	5.865107E-7
bagful	1	4.5116206E-8
baggage	127	5.7297584E-6
baggage-check	1	4.5116206E-8
baggage-handling	1	4.5116206E-8
baggage-screening	2	9.023241E-8
baggages	1	4.5116206E-8
bagge	4	1.8046482E-7
bagged	20	9.0232413E-7
bagger	2	9.023241E-8
baggerly	1	4.5116206E-8
baggers	1	4.5116206E-8
baggie	4	1.8046482E-7
baggie-full	1	4.5116206E-8
baggies	2	9.023241E-8
bagging	12	5.4139446E-7
baggins	8	3.6092965E-7
baggio	1	4.5116206E-8
baggot	7	3.1581345E-7
baggotrath	1	4.5116206E-8
baggy	30	1.3534863E-6
bagh	8	3.6092965E-7
baghdad	145	6.54185E-6
baghdad-based	1	4.5116206E-8
baghdad-by-the	1	4.5116206E-8
baghdadi	1	4.5116206E-8
bagheera	1	4.5116206E-8
bagilishema	2	9.023241E-8
baginski	1	4.5116206E-8
bagless	1	4.5116206E-8
bagli	1	4.5116206E-8
bagmati	4	1.8046482E-7
bagnoles	1	4.5116206E-8
bago	1	4.5116206E-8
bagos	1	4.5116206E-8
bagpipe	3	1.3534861E-7
bagpipe-playing	1	4.5116206E-8
bagpipean	1	4.5116206E-8
bagpipelike	1	4.5116206E-8
bagpipes	14	6.316269E-7
bagram	5	2.2558103E-7
bagru	1	4.5116206E-8
bags	585	2.6392981E-5
bagso	1	4.5116206E-8
baguette	8	3.6092965E-7
baguettes	5	2.2558103E-7
bagunça	1	4.5116206E-8
bagutta	1	4.5116206E-8
bagwell	30	1.3534863E-6
bah	50	2.2558104E-6
bah-bah	1	4.5116206E-8
bah-cah-rah	1	4.5116206E-8
bah-humbug	1	4.5116206E-8
bah-humbugging	1	4.5116206E-8
baha	6	2.7069723E-7
bahadur	6	2.7069723E-7
bahah	1	4.5116206E-8
bahahah	1	4.5116206E-8
bahaji	29	1.30837E-6
bahal	4	1.8046482E-7
baham	1	4.5116206E-8
bahama	30	1.3534863E-6
bahamas	146	6.5869663E-6
bahamian	51	2.3009266E-6
bahamians	12	5.4139446E-7
bahamian–	1	4.5116206E-8
bahang	4	1.8046482E-7
bahara	1	4.5116206E-8
baharian	1	4.5116206E-8
baharians	1	4.5116206E-8
bahasa	7	3.1581345E-7
bahbuh	1	4.5116206E-8
bahceli	4	1.8046482E-7
bahera	1	4.5116206E-8
bahia	24	1.0827889E-6
bahler	1	4.5116206E-8
bahn	3	1.3534861E-7
bahnhof	8	3.6092965E-7
bahnhofstraße	1	4.5116206E-8
bahor	2	9.023241E-8
bahr	2	9.023241E-8
bahrain	36	1.6241835E-6
bahraini	1	4.5116206E-8
bahre	26	1.1730214E-6
bahres	4	1.8046482E-7
bahri	2	9.023241E-8
bahru	14	6.316269E-7
baht	9	4.0604587E-7
bahtulism	1	4.5116206E-8
bahutiers	1	4.5116206E-8
bahuvrihi	2	9.023241E-8
bahía	10	4.5116207E-7
bahú	1	4.5116206E-8
bai	16	7.218593E-7
bai-nara	1	4.5116206E-8
baia	1	4.5116206E-8
baiada	4	1.8046482E-7
baiae	3	1.3534861E-7
baibu	1	4.5116206E-8
baidi	1	4.5116206E-8
baie	4	1.8046482E-7
baier	3	1.3534861E-7
baigent	1	4.5116206E-8
baijuyi	1	4.5116206E-8
baikingu	1	4.5116206E-8
bail	136	6.135804E-6
bail-bond	1	4.5116206E-8
bail-bondsman	2	9.023241E-8
bail-bondsmen	4	1.8046482E-7
bail-jumper	1	4.5116206E-8
bail-jumpers	2	9.023241E-8
bail-out	1	4.5116206E-8
bail-outs	1	4.5116206E-8
baila	2	9.023241E-8
bailando	3	1.3534861E-7
bailar	1	4.5116206E-8
baile	12	5.4139446E-7
bailed	23	1.0376727E-6
bailee	1	4.5116206E-8
bailes	1	4.5116206E-8
bailey	134	6.045572E-6
bailey-like	1	4.5116206E-8
baileys	2	9.023241E-8
bailie	2	9.023241E-8
bailiff	3	1.3534861E-7
bailiffs	1	4.5116206E-8
bailing	20	9.0232413E-7
bailiwick	5	2.2558103E-7
bailiwicky	1	4.5116206E-8
baillie	1	4.5116206E-8
baillif	1	4.5116206E-8
bailly	2	9.023241E-8
bailor	1	4.5116206E-8
bailout	56	2.5265076E-6
bailouts	6	2.7069723E-7
bails	3	1.3534861E-7
bailén	1	4.5116206E-8
baimasi	1	4.5116206E-8
bain	21	9.4744036E-7
bain-aux	1	4.5116206E-8
bainbridge	3	1.3534861E-7
bainchoooch	1	4.5116206E-8
baine	4	1.8046482E-7
baines	2	9.023241E-8
bains	4	1.8046482E-7
baio	2	9.023241E-8
bair	1	4.5116206E-8
bairam	2	9.023241E-8
baird	6	2.7069723E-7
bairn	5	2.2558103E-7
bairro	10	4.5116207E-7
bairstow	2	9.023241E-8
baisch	2	9.023241E-8
baiser	1	4.5116206E-8
baishi	1	4.5116206E-8
baisho	1	4.5116206E-8
bait	128	5.7748744E-6
bait-and-switch	3	1.3534861E-7
bait-and-tackle	1	4.5116206E-8
baita	1	4.5116206E-8
baitashan	1	4.5116206E-8
baitasi	1	4.5116206E-8
baite	1	4.5116206E-8
baited	23	1.0376727E-6
baiter	1	4.5116206E-8
baitfish	1	4.5116206E-8
baitgate	2	9.023241E-8
baith	2	9.023241E-8
baiting	11	4.962783E-7
baits	8	3.6092965E-7
baituo	2	9.023241E-8
baitz	1	4.5116206E-8
baiul	2	9.023241E-8
baix	1	4.5116206E-8
baixa	12	5.4139446E-7
baixada	2	9.023241E-8
baixo	3	1.3534861E-7
baiyuanguan	1	4.5116206E-8
baiyunguan	2	9.023241E-8
baiza	1	4.5116206E-8
baize	1	4.5116206E-8
baj	3	1.3534861E-7
baj-csy	1	4.5116206E-8
baja	17	7.669755E-7
bajada	1	4.5116206E-8
bajaing	1	4.5116206E-8
bajang	1	4.5116206E-8
bajara	1	4.5116206E-8
bajau	2	9.023241E-8
bajcsy	1	4.5116206E-8
bajillion	4	1.8046482E-7
bajillionth	1	4.5116206E-8
bajillo	1	4.5116206E-8
bajo	2	9.023241E-8
bajob	1	4.5116206E-8
bajondillo	1	4.5116206E-8
bajra	2	9.023241E-8
bajrami	1	4.5116206E-8
bak	27	1.2181375E-6
bak?rc?lar	1	4.5116206E-8
bak?rköy	1	4.5116206E-8
baka	3	1.3534861E-7
bakaly	11	4.962783E-7
bakar	5	2.2558103E-7
bakarbashat	6	2.7069723E-7
bakaxichuch	1	4.5116206E-8
bake	118	5.3237122E-6
bake-off	6	2.7069723E-7
baked	150	6.767431E-6
baked-on	2	9.023241E-8
bakelite	1	4.5116206E-8
bakeoff	3	1.3534861E-7
baker	292	1.31739325E-5
bakeries	14	6.316269E-7
bakers	17	7.669755E-7
bakersfield	9	4.0604587E-7
bakery	55	2.4813914E-6
bakes	15	6.767431E-7
bakesale	1	4.5116206E-8
baketball	1	4.5116206E-8
bakewell	1	4.5116206E-8
bakhru	1	4.5116206E-8
bakhtar	1	4.5116206E-8
bakhtin	2	9.023241E-8
bakija	1	4.5116206E-8
bakila	1	4.5116206E-8
bakili	2	9.023241E-8
baking	173	7.805103E-6
baking-powder	1	4.5116206E-8
bakis	2	9.023241E-8
bakke	7	3.1581345E-7
bakker	8	3.6092965E-7
bakkumira	1	4.5116206E-8
bakkungan	1	4.5116206E-8
baklava	1	4.5116206E-8
bako	11	4.962783E-7
bakouris	1	4.5116206E-8
bakr	3	1.3534861E-7
bakri	2	9.023241E-8
baksait	1	4.5116206E-8
baksheesh	2	9.023241E-8
bakshi	3	1.3534861E-7
baku	7	3.1581345E-7
bakufu	1	4.5116206E-8
bakula	4	1.8046482E-7
bak­lava	1	4.5116206E-8
bakócz-kápolna	1	4.5116206E-8
bal	103	4.6469695E-6
bal?ienas	1	4.5116206E-8
bal?k	1	4.5116206E-8
bala	2	9.023241E-8
balaban	3	1.3534861E-7
balabanov	1	4.5116206E-8
balaclava	2	9.023241E-8
baladeur	1	4.5116206E-8
balady	1	4.5116206E-8
balaff	1	4.5116206E-8
balafi	1	4.5116206E-8
balafkan	1	4.5116206E-8
balagan	25	1.1279052E-6
balagan-like	1	4.5116206E-8
balaghat	1	4.5116206E-8
balahana	3	1.3534861E-7
balahi	1	4.5116206E-8
balai	6	2.7069723E-7
balaia	2	9.023241E-8
balalaikas	1	4.5116206E-8
balallythrough	1	4.5116206E-8
balamúr	1	4.5116206E-8
balamúrnik	1	4.5116206E-8
balancanché	2	9.023241E-8
balance	1122	5.0620383E-5
balance-of-payments	3	1.3534861E-7
balance-sheet	1	4.5116206E-8
balance-wise	1	4.5116206E-8
balanced	368	1.6602764E-5
balanced-budget	26	1.1730214E-6
balancedscorecard	1	4.5116206E-8
balancer	4	1.8046482E-7
balancers	1	4.5116206E-8
balances	128	5.7748744E-6
balancey-invested-demony	3	1.3534861E-7
balanchine	10	4.5116207E-7
balancing	127	5.7297584E-6
balancingly	1	4.5116206E-8
balanini	1	4.5116206E-8
balanzat	1	4.5116206E-8
balart	1	4.5116206E-8
balasubramanian	1	4.5116206E-8
balat	1	4.5116206E-8
balata	2	9.023241E-8
balaton	15	6.767431E-7
balatonalmádi	1	4.5116206E-8
balatonföldvár	1	4.5116206E-8
balatonfüred	3	1.3534861E-7
balb	72	3.248367E-6
balboa	15	6.767431E-7
balbuena	1	4.5116206E-8
balc	1	4.5116206E-8
balcho	1	4.5116206E-8
balck	2	9.023241E-8
balclutha	1	4.5116206E-8
balcon	2	9.023241E-8
balcone	2	9.023241E-8
balcones	2	9.023241E-8
balconied	2	9.023241E-8
balconies	70	3.1581344E-6
balcony	105	4.737202E-6
balconye	1	4.5116206E-8
balcón	1	4.5116206E-8
balcões	1	4.5116206E-8
bald	116	5.23348E-6
bald-eagle	1	4.5116206E-8
bald-faced	1	4.5116206E-8
bald-headed	4	1.8046482E-7
baldacchino	1	4.5116206E-8
baldacci	2	9.023241E-8
baldachin	1	4.5116206E-8
baldachino	1	4.5116206E-8
baldaquin	1	4.5116206E-8
baldassare	2	9.023241E-8
baldensberger	1	4.5116206E-8
balderdash	9	4.0604587E-7
baldessare	1	4.5116206E-8
baldfaced	4	1.8046482E-7
baldi	2	9.023241E-8
balding	11	4.962783E-7
baldly	6	2.7069723E-7
baldness	15	6.767431E-7
baldomero	1	4.5116206E-8
baldr	1	4.5116206E-8
baldric	1	4.5116206E-8
baldrick	1	4.5116206E-8
baldridge	7	3.1581345E-7
baldung	3	1.3534861E-7
baldwin	125	5.6395256E-6
baldwinian	1	4.5116206E-8
baldwins	6	2.7069723E-7
baldy	2	9.023241E-8
bale	59	2.6618561E-6
bale-fire	1	4.5116206E-8
bale-heads	1	4.5116206E-8
balear	1	4.5116206E-8
baleares	3	1.3534861E-7
balearic	16	7.218593E-7
balearics	35	1.5790672E-6
balearis	2	9.023241E-8
baleen	1	4.5116206E-8
baleful	10	4.5116207E-7
balefully	4	1.8046482E-7
baleia	3	1.3534861E-7
baleine	3	1.3534861E-7
baleines	1	4.5116206E-8
baleira	4	1.8046482E-7
balenced	1	4.5116206E-8
balentine	2	9.023241E-8
baler	1	4.5116206E-8
bales	6	2.7069723E-7
balestier	1	4.5116206E-8
balestrari	1	4.5116206E-8
bale­aric	1	4.5116206E-8
balfour	11	4.962783E-7
bali	148	6.6771986E-6
bali-style	1	4.5116206E-8
balian	1	4.5116206E-8
balin	1	4.5116206E-8
balina	1	4.5116206E-8
balinese	51	2.3009266E-6
balinese-looking	1	4.5116206E-8
baling	3	1.3534861E-7
balint	4	1.8046482E-7
balisaur	1	4.5116206E-8
balistic	1	4.5116206E-8
balitrade	1	4.5116206E-8
balk	46	2.0753455E-6
balkan	43	1.939997E-6
balkanization	7	3.1581345E-7
balkanized	3	1.3534861E-7
balkanizing	1	4.5116206E-8
balkans	90	4.0604587E-6
balkans-bound	1	4.5116206E-8
balkaria	1	4.5116206E-8
balke	2	9.023241E-8
balked	42	1.8948807E-6
balkind	7	3.1581345E-7
balkiness	1	4.5116206E-8
balking	13	5.865107E-7
balkon	2	9.023241E-8
balks	1	4.5116206E-8
balky	9	4.0604587E-7
ball	1394	6.2891995E-5
ball-and-chain	1	4.5116206E-8
ball-and-cup	1	4.5116206E-8
ball-and-strike	2	9.023241E-8
ball-breaking	1	4.5116206E-8
ball-busting	2	9.023241E-8
ball-cap	1	4.5116206E-8
ball-control	1	4.5116206E-8
ball-ee	1	4.5116206E-8
ball-filled	1	4.5116206E-8
ball-form	4	1.8046482E-7
ball-forms	1	4.5116206E-8
ball-gown	1	4.5116206E-8
ball-hawking	1	4.5116206E-8
ball-hitting-the-athlete-in-the-groin	1	4.5116206E-8
ball-licking	1	4.5116206E-8
ball-like	7	3.1581345E-7
ball-out	1	4.5116206E-8
ball-park	1	4.5116206E-8
ball-peen	1	4.5116206E-8
ball-point	1	4.5116206E-8
ball-scratching	1	4.5116206E-8
ball-striking	1	4.5116206E-8
ball-whacker	1	4.5116206E-8
ballack	1	4.5116206E-8
ballad	54	2.436275E-6
ballade	1	4.5116206E-8
balladeer	3	1.3534861E-7
balladeering	1	4.5116206E-8
balladeers	1	4.5116206E-8
balladry	2	9.023241E-8
ballads	50	2.2558104E-6
balladur	1	4.5116206E-8
ballady	1	4.5116206E-8
ballajá	3	1.3534861E-7
ballance	1	4.5116206E-8
ballantine	14	6.316269E-7
ballantyne	4	1.8046482E-7
ballard	43	1.939997E-6
ballards	1	4.5116206E-8
ballast	9	4.0604587E-7
ballbreaker	1	4.5116206E-8
ballbuster	4	1.8046482E-7
ballcap	1	4.5116206E-8
ballclub	5	2.2558103E-7
balled	6	2.7069723E-7
ballein	1	4.5116206E-8
ballenger	1	4.5116206E-8
ballentine	7	3.1581345E-7
baller	4	1.8046482E-7
ballerina	18	8.1209174E-7
ballerinas	6	2.7069723E-7
ballerino	1	4.5116206E-8
ballesteros	2	9.023241E-8
ballet	229	1.03316115E-5
ballet-like	1	4.5116206E-8
ballethnic	1	4.5116206E-8
balletic	6	2.7069723E-7
balletomane	2	9.023241E-8
ballets	17	7.669755E-7
ballew	1	4.5116206E-8
ballgame	34	1.533951E-6
ballgames	5	2.2558103E-7
ballgown	1	4.5116206E-8
ballgowns	1	4.5116206E-8
ballgowny	1	4.5116206E-8
ballhandling	3	1.3534861E-7
ballhill	1	4.5116206E-8
ballin	1	4.5116206E-8
balling	1	4.5116206E-8
ballinger	11	4.962783E-7
balliol	4	1.8046482E-7
ballistic	45	2.0302293E-6
ballistics	10	4.5116207E-7
ballivet	1	4.5116206E-8
ballmer	65	2.9325533E-6
ballmer-and	1	4.5116206E-8
ballo	2	9.023241E-8
ballocks	1	4.5116206E-8
ballon	2	9.023241E-8
balloning	1	4.5116206E-8
balloon	139	6.271153E-6
balloon-breasted	1	4.5116206E-8
balloon-buster	1	4.5116206E-8
balloon-draped	1	4.5116206E-8
balloon-tossing	1	4.5116206E-8
ballooned	14	6.316269E-7
ballooning	20	9.0232413E-7
balloonist	10	4.5116207E-7
balloonists	11	4.962783E-7
balloons	60	2.7069725E-6
ballot	283	1.2767887E-5
ballot-boxes	1	4.5116206E-8
ballot-stuffing	1	4.5116206E-8
balloting	17	7.669755E-7
ballots	67	3.022786E-6
ballou	4	1.8046482E-7
ballpark	76	3.4288316E-6
ballpark-building	1	4.5116206E-8
ballpark-siting	1	4.5116206E-8
ballparks	12	5.4139446E-7
ballplay	1	4.5116206E-8
ballplayer	17	7.669755E-7
ballplayers	16	7.218593E-7
ballpoint	6	2.7069723E-7
ballroom	68	3.067902E-6
ballrooms	2	9.023241E-8
ballrooom	1	4.5116206E-8
balls	418	1.8858575E-5
balls-at	1	4.5116206E-8
balls-up	1	4.5116206E-8
ballsbridge	7	3.1581345E-7
ballsiest	1	4.5116206E-8
ballsiness	1	4.5116206E-8
ballskirts	1	4.5116206E-8
ballslangostinolarge	1	4.5116206E-8
ballston	1	4.5116206E-8
ballsy	3	1.3534861E-7
ballum	1	4.5116206E-8
ballushi	2	9.023241E-8
bally	8	3.6092965E-7
ballyards	3	1.3534861E-7
ballybunion	1	4.5116206E-8
ballycloran	1	4.5116206E-8
ballyhoo	8	3.6092965E-7
ballyhooed	10	4.5116207E-7
ballykissangel	1	4.5116206E-8
ballymoney	2	9.023241E-8
ballyo	1	4.5116206E-8
ballys	1	4.5116206E-8
balm	19	8.572079E-7
balma	1	4.5116206E-8
balmain	2	9.023241E-8
balmer	7	3.1581345E-7
balmford	3	1.3534861E-7
balmiest	1	4.5116206E-8
balmoral	4	1.8046482E-7
balms	1	4.5116206E-8
balmy	22	9.925566E-7
balnave	1	4.5116206E-8
balnear	2	9.023241E-8
balneario	3	1.3534861E-7
balnearios	1	4.5116206E-8
balok	1	4.5116206E-8
baloney	30	1.3534863E-6
baloney-slicing	1	4.5116206E-8
baloo	1	4.5116206E-8
balrog	8	3.6092965E-7
balsa	1	4.5116206E-8
balsain	1	4.5116206E-8
balsalmic	1	4.5116206E-8
balsam	6	2.7069723E-7
balsamea	1	4.5116206E-8
balsamic	11	4.962783E-7
balso	6	2.7069723E-7
balston	7	3.1581345E-7
balt	1	4.5116206E-8
baltar	2	9.023241E-8
baltard	2	9.023241E-8
baltasar	4	1.8046482E-7
baltazar	1	4.5116206E-8
balthazar	2	9.023241E-8
baltic	27	1.2181375E-6
baltics	3	1.3534861E-7
baltimore	339	1.5294394E-5
baltimore-born	1	4.5116206E-8
baltimorean	1	4.5116206E-8
baltimoreans	2	9.023241E-8
baltista	1	4.5116206E-8
balto	2	9.023241E-8
baltoslavic	1	4.5116206E-8
balts	1	4.5116206E-8
baltus	1	4.5116206E-8
baltz	1	4.5116206E-8
baluchi	6	2.7069723E-7
baluchistan	6	2.7069723E-7
balusters	4	1.8046482E-7
balustrade	5	2.2558103E-7
balustrades	7	3.1581345E-7
balz	15	6.767431E-7
balzac	7	3.1581345E-7
balzacian	2	9.023241E-8
balzacq	13	5.865107E-7
balzaqc	3	1.3534861E-7
balzer	2	9.023241E-8
balzers	2	9.023241E-8
balúk	1	4.5116206E-8
bam	81	3.6544127E-6
bam-ba-bomp-ba-bom-ba	2	9.023241E-8
bama	2	9.023241E-8
bamaca	10	4.5116207E-7
bamako	1	4.5116206E-8
bamani	1	4.5116206E-8
bamba	9	4.0604587E-7
bambaleo	1	4.5116206E-8
bambas	2	9.023241E-8
bamber	1	4.5116206E-8
bamberger	1	4.5116206E-8
bambi	17	7.669755E-7
bambi-happy	2	9.023241E-8
bambi-on-ice	1	4.5116206E-8
bambina	1	4.5116206E-8
bambino	3	1.3534861E-7
bambis	1	4.5116206E-8
bamboleo	1	4.5116206E-8
bamboo	92	4.150691E-6
bamboo-and-paper	1	4.5116206E-8
bamboo-lined	1	4.5116206E-8
bamboo-ware	1	4.5116206E-8
bamboozle	1	4.5116206E-8
bamboozled	4	1.8046482E-7
bamboozlement	1	4.5116206E-8
bamburger	1	4.5116206E-8
bamforth	1	4.5116206E-8
bamh	19	8.572079E-7
bamhi	18	8.1209174E-7
bamian	1	4.5116206E-8
bamiyan	2	9.023241E-8
bammerlin	1	4.5116206E-8
bamorghini	1	4.5116206E-8
ban	639	2.8829256E-5
bana	9	4.0604587E-7
banac	1	4.5116206E-8
banal	71	3.2032506E-6
banal-ytica	1	4.5116206E-8
banalities	15	6.767431E-7
banality	23	1.0376727E-6
banalization	1	4.5116206E-8
banalize	1	4.5116206E-8
banalized	1	4.5116206E-8
banalizes	1	4.5116206E-8
banalizing	1	4.5116206E-8
banally	1	4.5116206E-8
banamex	3	1.3534861E-7
banan	2	9.023241E-8
banana	171	7.714872E-6
banana-free	1	4.5116206E-8
banana-jockey	1	4.5116206E-8
banana-mangoey	1	4.5116206E-8
banana-producing	1	4.5116206E-8
banana-republic	1	4.5116206E-8
banana-shaped	1	4.5116206E-8
banana-tallying	1	4.5116206E-8
banana-walnut	1	4.5116206E-8
bananafish	1	4.5116206E-8
bananarama	1	4.5116206E-8
bananas	100	4.511621E-6
bananera	2	9.023241E-8
bananier	1	4.5116206E-8
banbury	1	4.5116206E-8
banc	11	4.962783E-7
bancgroup	1	4.5116206E-8
banco	14	6.316269E-7
bancorp	7	3.1581345E-7
bancrofiti	1	4.5116206E-8
bancroft	20	9.0232413E-7
bancrofti	8	3.6092965E-7
band	1538	6.938873E-5
band-aid	4	1.8046482E-7
band-aids	5	2.2558103E-7
band-confirmation	1	4.5116206E-8
band-era	1	4.5116206E-8
band-esque	1	4.5116206E-8
band-limited	1	4.5116206E-8
band-pass	1	4.5116206E-8
band-passed	1	4.5116206E-8
band-signing	1	4.5116206E-8
band-to-be	1	4.5116206E-8
banda	4	1.8046482E-7
bandage	27	1.2181375E-6
bandaged	9	4.0604587E-7
bandages	10	4.5116207E-7
bandaging	7	3.1581345E-7
bandai	1	4.5116206E-8
bandaid	3	1.3534861E-7
bandaids	7	3.1581345E-7
bandak	17	7.669755E-7
bandaloop	1	4.5116206E-8
bandama	4	1.8046482E-7
bandana	3	1.3534861E-7
bandanas	6	2.7069723E-7
bandanna	8	3.6092965E-7
bandannas	2	9.023241E-8
bandar	22	9.925566E-7
bandaraya	1	4.5116206E-8
bandarlog	1	4.5116206E-8
bandaru	1	4.5116206E-8
bandbox	1	4.5116206E-8
bande	1	4.5116206E-8
bandeaux	1	4.5116206E-8
banded	26	1.1730214E-6
bandeira	3	1.3534861E-7
bander	2	9.023241E-8
bandera	10	4.5116207E-7
banderas	26	1.1730214E-6
banderillas	3	1.3534861E-7
banderillero	1	4.5116206E-8
banderilleros	1	4.5116206E-8
bandhani	1	4.5116206E-8
bandhu	1	4.5116206E-8
bandicoot	6	2.7069723E-7
bandido	1	4.5116206E-8
bandidos	2	9.023241E-8
bandied	11	4.962783E-7
bandinelli	1	4.5116206E-8
banding	24	1.0827889E-6
bandini	1	4.5116206E-8
bandira	1	4.5116206E-8
bandit	34	1.533951E-6
bandit-chieftain	1	4.5116206E-8
banditism	1	4.5116206E-8
bandito	6	2.7069723E-7
banditos	2	9.023241E-8
banditry	7	3.1581345E-7
bandits	19	8.572079E-7
bandits-melt-your-parents	1	4.5116206E-8
bandleader	7	3.1581345E-7
bandleaders	2	9.023241E-8
bandling	1	4.5116206E-8
bandmate	7	3.1581345E-7
bandmates	4	1.8046482E-7
bandol	1	4.5116206E-8
bandoliers	5	2.2558103E-7
bandon	4	1.8046482E-7
bandoneon	3	1.3534861E-7
bandow	1	4.5116206E-8
bandpass	7	3.1581345E-7
bands	556	2.5084611E-5
bandscan	1	4.5116206E-8
bandshell	1	4.5116206E-8
bandstand	21	9.4744036E-7
bandung	2	9.023241E-8
bandwagon	50	2.2558104E-6
bandwagoning	1	4.5116206E-8
bandwagons	1	4.5116206E-8
bandwidth	93	4.1958074E-6
bandwidths	1	4.5116206E-8
bandwith-heavy	1	4.5116206E-8
bandy	2	9.023241E-8
bandy-legged	1	4.5116206E-8
bandyopadhyay	2	9.023241E-8
bane	14	6.316269E-7
bane-fire	1	4.5116206E-8
baneberry	1	4.5116206E-8
baneful	2	9.023241E-8
banepa	1	4.5116206E-8
banes	1	4.5116206E-8
banesh	1	4.5116206E-8
banff	10	4.5116207E-7
banfield	2	9.023241E-8
bang	202	9.113473E-6
bang-bang	2	9.023241E-8
bang-up	4	1.8046482E-7
banga	2	9.023241E-8
bangalore	13	5.865107E-7
bangbangbangbangbangbangbangbangbang	1	4.5116206E-8
bangchui	1	4.5116206E-8
banged	27	1.2181375E-6
banged-up	2	9.023241E-8
banger	1	4.5116206E-8
bangers	3	1.3534861E-7
banghy	1	4.5116206E-8
banging	43	1.939997E-6
bangkok	69	3.1130182E-6
bangla	1	4.5116206E-8
bangladesh	61	2.7520887E-6
bangladeshi	9	4.0604587E-7
bangladeshis	10	4.5116207E-7
bangle	3	1.3534861E-7
bangles	6	2.7069723E-7
banglewood	3	1.3534861E-7
bangli	3	1.3534861E-7
bango	1	4.5116206E-8
bangor	9	4.0604587E-7
bangs	58	2.61674E-6
bangs-fest	1	4.5116206E-8
bangsal	4	1.8046482E-7
bangy	1	4.5116206E-8
banias	1	4.5116206E-8
banihammad	16	7.218593E-7
banira	1	4.5116206E-8
banish	18	8.1209174E-7
banished	48	2.1655778E-6
banishers	1	4.5116206E-8
banishes	2	9.023241E-8
banishing	18	8.1209174E-7
banishment	7	3.1581345E-7
banister	2	9.023241E-8
banisters	2	9.023241E-8
baniya	1	4.5116206E-8
banja	2	9.023241E-8
banjar	3	1.3534861E-7
banjo	18	8.1209174E-7
banjoist	1	4.5116206E-8
banjos	8	3.6092965E-7
banjul	1	4.5116206E-8
bank	2122	9.573659E-5
bank-breaking	1	4.5116206E-8
bank-busters	1	4.5116206E-8
bank-funded	1	4.5116206E-8
bank-issued	1	4.5116206E-8
bank-led	1	4.5116206E-8
bank-merger	1	4.5116206E-8
bank-overhaul	1	4.5116206E-8
bank-owned	1	4.5116206E-8
bank-robbing	1	4.5116206E-8
bank-vault	1	4.5116206E-8
banka	1	4.5116206E-8
bankability	1	4.5116206E-8
bankable	3	1.3534861E-7
bankamerica	5	2.2558103E-7
bankboston	13	5.865107E-7
bankcard	1	4.5116206E-8
banke	3	1.3534861E-7
banked	33	1.4888349E-6
banked-oval	1	4.5116206E-8
banker	119	5.3688286E-6
banker-father	1	4.5116206E-8
banker-navigator-cartographer	1	4.5116206E-8
bankers	152	6.8576633E-6
bankhead	2	9.023241E-8
bankier	4	1.8046482E-7
banking	382	1.7234392E-5
banknote	1	4.5116206E-8
banknotes	2	9.023241E-8
bankoff	1	4.5116206E-8
bankone	1	4.5116206E-8
bankone-polaroid	1	4.5116206E-8
bankrate	7	3.1581345E-7
bankroll	10	4.5116207E-7
bankrolled	9	4.0604587E-7
bankrolling	4	1.8046482E-7
bankrolls	1	4.5116206E-8
bankrupcty	2	9.023241E-8
bankrupt	126	5.684642E-6
bankruptcies	21	9.4744036E-7
bankruptcy	423	1.9084155E-5
bankrupted	13	5.865107E-7
bankruptices	1	4.5116206E-8
bankrupting	6	2.7069723E-7
bankrupture	1	4.5116206E-8
bankrupty	1	4.5116206E-8
banks	915	4.1281328E-5
banks-earnings	2	9.023241E-8
banks-marketplace	1	4.5116206E-8
banksia	1	4.5116206E-8
bankside	1	4.5116206E-8
bankston	2	9.023241E-8
banlieux	1	4.5116206E-8
banna	2	9.023241E-8
bannantine	2	9.023241E-8
bannayan	2	9.023241E-8
banned	281	1.2677654E-5
bannen	2	9.023241E-8
banner	184	8.301382E-6
banner-ad	1	4.5116206E-8
banner-sized	1	4.5116206E-8
banner-towing	4	1.8046482E-7
bannered	2	9.023241E-8
banners	52	2.3460427E-6
banning	105	4.737202E-6
bannings	1	4.5116206E-8
bannister	4	1.8046482E-7
bannock	1	4.5116206E-8
bannockburn	2	9.023241E-8
bannon	6	2.7069723E-7
banns	1	4.5116206E-8
banonis	2	9.023241E-8
banovcin	2	9.023241E-8
banpo	3	1.3534861E-7
banque	4	1.8046482E-7
banquet	51	2.3009266E-6
banquet-type	1	4.5116206E-8
banqueting	1	4.5116206E-8
banquets	10	4.5116207E-7
banquette	23	1.0376727E-6
banquetted	1	4.5116206E-8
banquettes	24	1.0827889E-6
banquo	8	3.6092965E-7
bans	75	3.3837155E-6
bansa	1	4.5116206E-8
banshee	2	9.023241E-8
banshees	5	2.2558103E-7
banshiri	5	2.2558103E-7
banstetter	2	9.023241E-8
banta	2	9.023241E-8
bantam	9	4.0604587E-7
bantams	1	4.5116206E-8
bantamweight	2	9.023241E-8
banter	44	1.9851132E-6
bantered	5	2.2558103E-7
bantering	8	3.6092965E-7
banters	3	1.3534861E-7
bantha	1	4.5116206E-8
banthra	1	4.5116206E-8
banting	3	1.3534861E-7
bantling	2	9.023241E-8
bantu	8	3.6092965E-7
bantu-speakers	1	4.5116206E-8
bantus	2	9.023241E-8
bantustan	1	4.5116206E-8
banvil	1	4.5116206E-8
banxi	2	9.023241E-8
banyalbufar	3	1.3534861E-7
banyamulenge	3	1.3534861E-7
banyan	16	7.218593E-7
banys	4	1.8046482E-7
banzai	13	5.865107E-7
banzhaf	1	4.5116206E-8
banús	5	2.2558103E-7
bao	5	2.2558103E-7
baobab	4	1.8046482E-7
baochu	1	4.5116206E-8
baodingshan	1	4.5116206E-8
baoguangsi	1	4.5116206E-8
baoguosi	1	4.5116206E-8
baohedian	1	4.5116206E-8
baoshen	1	4.5116206E-8
baotou	4	1.8046482E-7
baotuquan	1	4.5116206E-8
baozi	1	4.5116206E-8
baozuo	1	4.5116206E-8
bap	8	3.6092965E-7
baps	4	1.8046482E-7
bapta	9	4.0604587E-7
bapta-am	2	9.023241E-8
baptised	2	9.023241E-8
baptism	23	1.0376727E-6
baptisma	1	4.5116206E-8
baptismal	9	4.0604587E-7
baptisms	5	2.2558103E-7
baptist	154	6.947896E-6
baptista	4	1.8046482E-7
baptiste	5	2.2558103E-7
baptistery	15	6.767431E-7
baptistry	1	4.5116206E-8
baptists	29	1.30837E-6
baptize	5	2.2558103E-7
baptized	21	9.4744036E-7
baptizing	1	4.5116206E-8
bapu	1	4.5116206E-8
baq	1	4.5116206E-8
baqer	1	4.5116206E-8
bar	1682	7.588546E-5
bar-able	1	4.5116206E-8
bar-b-p	1	4.5116206E-8
bar-b-q	1	4.5116206E-8
bar-band	1	4.5116206E-8
bar-bar	1	4.5116206E-8
bar-brasserie	1	4.5116206E-8
bar-code	1	4.5116206E-8
bar-coded	2	9.023241E-8
bar-coding	1	4.5116206E-8
bar-fights	1	4.5116206E-8
bar-hoppers	1	4.5116206E-8
bar-hopping	1	4.5116206E-8
bar-omega	1	4.5116206E-8
bar-restaurant	4	1.8046482E-7
bar-restaurants	1	4.5116206E-8
bar-sponsored	3	1.3534861E-7
bar-squared	1	4.5116206E-8
bar-stool	1	4.5116206E-8
bara	23	1.0376727E-6
barabajagal	1	4.5116206E-8
barabak	1	4.5116206E-8
barabar	1	4.5116206E-8
baraboo	9	4.0604587E-7
baracoa	12	5.4139446E-7
barad	1	4.5116206E-8
barada	1	4.5116206E-8
barage	1	4.5116206E-8
baragwanath	1	4.5116206E-8
baraj	1	4.5116206E-8
barajas	11	4.962783E-7
barak	171	7.714872E-6
barakat	3	1.3534861E-7
barakban	1	4.5116206E-8
barakgate	1	4.5116206E-8
baraldini	1	4.5116206E-8
baram	4	1.8046482E-7
baramos	1	4.5116206E-8
baran	2	9.023241E-8
baranczak	2	9.023241E-8
baranda	1	4.5116206E-8
barani	1	4.5116206E-8
baranski	7	3.1581345E-7
baranyi	4	1.8046482E-7
baranzini	4	1.8046482E-7
barasingh	1	4.5116206E-8
barasingha	1	4.5116206E-8
barat	1	4.5116206E-8
barata	1	4.5116206E-8
baratillo	1	4.5116206E-8
barb	16	7.218593E-7
barb-trading	1	4.5116206E-8
barbach	1	4.5116206E-8
barbacoa	7	3.1581345E-7
barbadine	1	4.5116206E-8
barbados	10	4.5116207E-7
barbancourt	1	4.5116206E-8
barbara	397	1.7911134E-5
barbarella	4	1.8046482E-7
barbarian	20	9.0232413E-7
barbarian-subduing	1	4.5116206E-8
barbarians	46	2.0753455E-6
barbaric	38	1.7144158E-6
barbarically	1	4.5116206E-8
barbarics	1	4.5116206E-8
barbarino	1	4.5116206E-8
barbarism	19	8.572079E-7
barbarismo	1	4.5116206E-8
barbarisms	2	9.023241E-8
barbarities	1	4.5116206E-8
barbarity	1	4.5116206E-8
barbaro	1	4.5116206E-8
barbaroja	1	4.5116206E-8
barbarossa	5	2.2558103E-7
barbarous	12	5.4139446E-7
barbarously	1	4.5116206E-8
barbary	10	4.5116207E-7
barbash	1	4.5116206E-8
barbati	2	9.023241E-8
barbatus	2	9.023241E-8
barbeau	1	4.5116206E-8
barbecue	236	1.06474245E-5
barbecue-sauce	1	4.5116206E-8
barbecued	30	1.3534863E-6
barbecueing	1	4.5116206E-8
barbecuers	2	9.023241E-8
barbecues	27	1.2181375E-6
barbecuing	11	4.962783E-7
barbed	44	1.9851132E-6
barbed-wire	8	3.6092965E-7
barbee	1	4.5116206E-8
barbeito	1	4.5116206E-8
barbel	2	9.023241E-8
barbells	3	1.3534861E-7
barbels	1	4.5116206E-8
barbeque	10	4.5116207E-7
barbequed	1	4.5116206E-8
barbeques	1	4.5116206E-8
barber	67	3.022786E-6
barber-surgeons	1	4.5116206E-8
barbera	10	4.5116207E-7
barbered	1	4.5116206E-8
barberie	1	4.5116206E-8
barberini	1	4.5116206E-8
barberis	1	4.5116206E-8
barbero	3	1.3534861E-7
barberry	1	4.5116206E-8
barbers	3	1.3534861E-7
barbershop	14	6.316269E-7
barbey	3	1.3534861E-7
barbian	1	4.5116206E-8
barbican	3	1.3534861E-7
barbie	67	3.022786E-6
barbie-doll	1	4.5116206E-8
barbie-esque	1	4.5116206E-8
barbie-head	2	9.023241E-8
barbie-like	2	9.023241E-8
barbielike	1	4.5116206E-8
barbier	1	4.5116206E-8
barbieri	2	9.023241E-8
barbies	9	4.0604587E-7
barbified	1	4.5116206E-8
barbiturate	1	4.5116206E-8
barbiturates	5	2.2558103E-7
barbizon	2	9.023241E-8
barble	1	4.5116206E-8
barbour	54	2.436275E-6
barboza	5	2.2558103E-7
barbra	28	1.2632538E-6
barbri	4	1.8046482E-7
barbs	10	4.5116207E-7
barbudos	1	4.5116206E-8
barbunya	1	4.5116206E-8
barbès	1	4.5116206E-8
barc	1	4.5116206E-8
barca	2	9.023241E-8
barcaccia	1	4.5116206E-8
barcalounger	3	1.3534861E-7
barcaloungers	1	4.5116206E-8
barcarolle	1	4.5116206E-8
barcelona	216	9.7451E-6
barcelona-based	1	4.5116206E-8
barcelona-by-bike	1	4.5116206E-8
barcelonans	8	3.6092965E-7
barceloneta	10	4.5116207E-7
barcelos	9	4.0604587E-7
barchart	1	4.5116206E-8
barcharts	2	9.023241E-8
barchester	1	4.5116206E-8
barcino	3	1.3534861E-7
barclay	3	1.3534861E-7
barclays	11	4.962783E-7
barcode	8	3.6092965E-7
barcoded	7	3.1581345E-7
barcodes	6	2.7069723E-7
barcoding	20	9.0232413E-7
barcodinglife	1	4.5116206E-8
barcos	2	9.023241E-8
barcsay	1	4.5116206E-8
barczy	1	4.5116206E-8
bard	49	2.2106942E-6
bard-arts-center	2	9.023241E-8
bardach	1	4.5116206E-8
barde	1	4.5116206E-8
barden	3	1.3534861E-7
bardi	1	4.5116206E-8
bardia	2	9.023241E-8
bardic	1	4.5116206E-8
bardling	1	4.5116206E-8
bardment	1	4.5116206E-8
bardolino	1	4.5116206E-8
bardolph	2	9.023241E-8
bardot	8	3.6092965E-7
bardot-a	1	4.5116206E-8
bardoubling	2	9.023241E-8
bardovi	4	1.8046482E-7
bards	1	4.5116206E-8
bardstown	1	4.5116206E-8
bardugo	2	9.023241E-8
bare	231	1.0421843E-5
bare-assed	2	9.023241E-8
bare-bellied	1	4.5116206E-8
bare-boat	1	4.5116206E-8
bare-bones	12	5.4139446E-7
bare-bottomed	1	4.5116206E-8
bare-breasted	4	1.8046482E-7
bare-cheeked	1	4.5116206E-8
bare-chest	2	9.023241E-8
bare-chested	5	2.2558103E-7
bare-faced	2	9.023241E-8
bare-fisted	1	4.5116206E-8
bare-handed	1	4.5116206E-8
bare-knuckle	2	9.023241E-8
bare-knuckled	2	9.023241E-8
bare-knuckles	2	9.023241E-8
bare-legged	1	4.5116206E-8
bare-naked	1	4.5116206E-8
bare-shouldered	1	4.5116206E-8
bareass	1	4.5116206E-8
bareback	1	4.5116206E-8
bareboat	1	4.5116206E-8
barebones	1	4.5116206E-8
bareclona	1	4.5116206E-8
bared	13	5.865107E-7
barefaced	1	4.5116206E-8
barefeet	1	4.5116206E-8
barefoot	64	2.8874372E-6
barefooted	2	9.023241E-8
barehanded	3	1.3534861E-7
bareheaded	3	1.3534861E-7
barel	1	4.5116206E-8
barela	5	2.2558103E-7
barelas	1	4.5116206E-8
barely	696	3.140088E-5
barely-buried	1	4.5116206E-8
barely-concealed	1	4.5116206E-8
barely-controlled	2	9.023241E-8
barely-disguised	2	9.023241E-8
barely-know-my-choreography-and	1	4.5116206E-8
barely-know-my-choreography-and-can	1	4.5116206E-8
barely-legal	2	9.023241E-8
barely-legal-if-that-woman	1	4.5116206E-8
barely-noticed	1	4.5116206E-8
barely-scraping-by	1	4.5116206E-8
barely-there	1	4.5116206E-8
barely-used	1	4.5116206E-8
barenaked	6	2.7069723E-7
barenboim	6	2.7069723E-7
bareness	1	4.5116206E-8
barentholtz	1	4.5116206E-8
barents	1	4.5116206E-8
barer	1	4.5116206E-8
bares	7	3.1581345E-7
barest	7	3.1581345E-7
barest-bones	1	4.5116206E-8
baretta	1	4.5116206E-8
barettes	1	4.5116206E-8
barf	6	2.7069723E-7
barfed	1	4.5116206E-8
barfield	2	9.023241E-8
barfight	1	4.5116206E-8
barfing	3	1.3534861E-7
barflies	1	4.5116206E-8
barfly	1	4.5116206E-8
barfy	1	4.5116206E-8
bargain	269	1.213626E-5
bargain-basement	13	5.865107E-7
bargain-bin	1	4.5116206E-8
bargain-hungry	1	4.5116206E-8
bargain-hunter	1	4.5116206E-8
bargain-hunters	3	1.3534861E-7
bargain-hunting	7	3.1581345E-7
bargain-price	1	4.5116206E-8
bargain-shopping	1	4.5116206E-8
bargain-stretchers	1	4.5116206E-8
bargained	14	6.316269E-7
bargaining	174	7.85022E-6
bargains	101	4.5567367E-6
bargainst	1	4.5116206E-8
barge	80	3.6092965E-6
barge-to-train	1	4.5116206E-8
bargeld	1	4.5116206E-8
bargello	6	2.7069723E-7
bargeloads	1	4.5116206E-8
barger	9	4.0604587E-7
barges	40	1.8046483E-6
barghouthi	5	2.2558103E-7
barghouti	6	2.7069723E-7
barging	5	2.2558103E-7
barham	2	9.023241E-8
bari	12	5.4139446E-7
bariatric	4	1.8046482E-7
bariay	1	4.5116206E-8
barigye	3	1.3534861E-7
barik	1	4.5116206E-8
barile	1	4.5116206E-8
baring	9	4.0604587E-7
barings	7	3.1581345E-7
barinka	1	4.5116206E-8
bario	1	4.5116206E-8
baris	1	4.5116206E-8
barisan	1	4.5116206E-8
barish	5	2.2558103E-7
barishnikov	1	4.5116206E-8
barista	4	1.8046482E-7
baristas	2	9.023241E-8
baritonal	1	4.5116206E-8
baritone	21	9.4744036E-7
baritones	1	4.5116206E-8
barium	3	1.3534861E-7
bark	109	4.9176665E-6
bark-eaters	1	4.5116206E-8
barkai	1	4.5116206E-8
barkand	1	4.5116206E-8
barkat	1	4.5116206E-8
barkcloth	1	4.5116206E-8
barke	1	4.5116206E-8
barked	16	7.218593E-7
barkely	1	4.5116206E-8
barker	43	1.939997E-6
barkeri	2	9.023241E-8
barkers	3	1.3534861E-7
barkin	12	5.4139446E-7
barking	56	2.5265076E-6
barkingly	1	4.5116206E-8
barkins	1	4.5116206E-8
barkla	1	4.5116206E-8
barkley	16	7.218593E-7
barklike	1	4.5116206E-8
barks	29	1.30837E-6
barksdale	15	6.767431E-7
barky	1	4.5116206E-8
barlass	1	4.5116206E-8
barlavento	7	3.1581345E-7
barleria	3	1.3534861E-7
barlerin	1	4.5116206E-8
barlett	5	2.2558103E-7
barley	39	1.7595321E-6
barleygreen	2	9.023241E-8
barlovento	2	9.023241E-8
barlow	36	1.6241835E-6
barlows	1	4.5116206E-8
barmaid	5	2.2558103E-7
barmaids	2	9.023241E-8
barmak	1	4.5116206E-8
barman	9	4.0604587E-7
barmen	1	4.5116206E-8
barn	127	5.7297584E-6
barn-inspired	1	4.5116206E-8
barn-like	1	4.5116206E-8
barna	1	4.5116206E-8
barnabas	3	1.3534861E-7
barnaby	13	5.865107E-7
barnacle	2	9.023241E-8
barnacle-encrusted	1	4.5116206E-8
barnacles	1	4.5116206E-8
barnard	14	6.316269E-7
barnardine	1	4.5116206E-8
barnes	219	9.880449E-6
barnesandnoble	16	7.218593E-7
barnet	1	4.5116206E-8
barnett	48	2.1655778E-6
barneuve	1	4.5116206E-8
barnevik	8	3.6092965E-7
barney	103	4.6469695E-6
barneys	14	6.316269E-7
barnful	1	4.5116206E-8
barnhardt	12	5.4139446E-7
barnhart	23	1.0376727E-6
barnharts	3	1.3534861E-7
barnhill	1	4.5116206E-8
barnhouse	1	4.5116206E-8
barnicle	10	4.5116207E-7
barnicles	2	9.023241E-8
barnier	1	4.5116206E-8
barnlike	1	4.5116206E-8
barnraising	1	4.5116206E-8
barns	28	1.2632538E-6
barnsdall	2	9.023241E-8
barnsley	1	4.5116206E-8
barnstead	2	9.023241E-8
barnstorm	1	4.5116206E-8
barnstormed	1	4.5116206E-8
barnstormers	1	4.5116206E-8
barnstorming	1	4.5116206E-8
barnum	16	7.218593E-7
barnum-style	1	4.5116206E-8
barnwell	5	2.2558103E-7
barnyad	1	4.5116206E-8
barnyard	14	6.316269E-7
barnyards	1	4.5116206E-8
baro	2	9.023241E-8
barolo	2	9.023241E-8
barolos	1	4.5116206E-8
barometer	20	9.0232413E-7
barometers	3	1.3534861E-7
barometric	2	9.023241E-8
baron	59	2.6618561E-6
barone	13	5.865107E-7
baroness	4	1.8046482E-7
baronet	1	4.5116206E-8
baronetcy	1	4.5116206E-8
barong	5	2.2558103E-7
baronial	7	3.1581345E-7
barons	30	1.3534863E-6
barony	2	9.023241E-8
baroque	216	9.7451E-6
baroque-period	1	4.5116206E-8
baroque-rococo	1	4.5116206E-8
baroque-style	3	1.3534861E-7
baroreceptor	1	4.5116206E-8
baroreflex	2	9.023241E-8
barotrauma	2	9.023241E-8
barowitz	1	4.5116206E-8
barpower	1	4.5116206E-8
barq	1	4.5116206E-8
barqua	1	4.5116206E-8
barque	5	2.2558103E-7
barques	1	4.5116206E-8
barquq	2	9.023241E-8
barr	115	5.188364E-6
barra	16	7.218593E-7
barrack	7	3.1581345E-7
barracked	1	4.5116206E-8
barrackroom	1	4.5116206E-8
barracks	73	3.2934831E-6
barracks-style	1	4.5116206E-8
barracuda	13	5.865107E-7
barracudas	5	2.2558103E-7
barrage	47	2.1204617E-6
barraged	5	2.2558103E-7
barragem	2	9.023241E-8
barrages	3	1.3534861E-7
barraging	1	4.5116206E-8
barrak	1	4.5116206E-8
barrameda	1	4.5116206E-8
barramundi	1	4.5116206E-8
barranco	7	3.1581345E-7
barranquilla	1	4.5116206E-8
barras	3	1.3534861E-7
barrasso	4	1.8046482E-7
barre	9	4.0604587E-7
barreau	1	4.5116206E-8
barred	138	6.2260365E-6
barreirinha	1	4.5116206E-8
barrel	151	6.8125473E-6
barrel-ceilinged	1	4.5116206E-8
barrel-chested	3	1.3534861E-7
barrel-fermented	1	4.5116206E-8
barrel-making	1	4.5116206E-8
barrel-organs	1	4.5116206E-8
barrel-shaped	2	9.023241E-8
barrel-vault	1	4.5116206E-8
barrel-vaulted	7	3.1581345E-7
barreled	2	9.023241E-8
barrelhead	1	4.5116206E-8
barrelhouse	1	4.5116206E-8
barreling	8	3.6092965E-7
barrell	3	1.3534861E-7
barrelled	2	9.023241E-8
barrelling	2	9.023241E-8
barrels	77	3.473948E-6
barren	64	2.8874372E-6
barrenness	4	1.8046482E-7
barrer	2	9.023241E-8
barrera	5	2.2558103E-7
barret	3	1.3534861E-7
barrett	47	2.1204617E-6
barrette	1	4.5116206E-8
barrettes	2	9.023241E-8
barretts	2	9.023241E-8
barri	10	4.5116207E-7
barricade	18	8.1209174E-7
barricaded	7	3.1581345E-7
barricades	19	8.572079E-7
barricading	3	1.3534861E-7
barrichello	2	9.023241E-8
barrick	6	2.7069723E-7
barrida	2	9.023241E-8
barrie	7	3.1581345E-7
barrientos	1	4.5116206E-8
barrier	265	1.1955794E-5
barrier-island	1	4.5116206E-8
barriera	1	4.5116206E-8
barriers	311	1.403114E-5
barriga	1	4.5116206E-8
barrikady	1	4.5116206E-8
barrilito	1	4.5116206E-8
barring	80	3.6092965E-6
barringer	14	6.316269E-7
barrington	16	7.218593E-7
barrio	50	2.2558104E-6
barriologist	2	9.023241E-8
barriology	3	1.3534861E-7
barrios	22	9.925566E-7
barris	4	1.8046482E-7
barrister	9	4.0604587E-7
barritt	1	4.5116206E-8
barrkuda	1	4.5116206E-8
barro	16	7.218593E-7
barroc	2	9.023241E-8
barron	39	1.7595321E-6
barron-centers	1	4.5116206E-8
barroom	13	5.865107E-7
barrooms	2	9.023241E-8
barrow	13	5.865107E-7
barroway	1	4.5116206E-8
barrowed	1	4.5116206E-8
barrowman	2	9.023241E-8
barrows	4	1.8046482E-7
barrs	1	4.5116206E-8
barrueto	4	1.8046482E-7
barry	349	1.5745556E-5
barry-loathing	1	4.5116206E-8
barrymore	27	1.2181375E-6
barrymores	1	4.5116206E-8
barryness	1	4.5116206E-8
barrès	1	4.5116206E-8
bars	674	3.0408324E-5
barshefsky	4	1.8046482E-7
barsley	1	4.5116206E-8
barstead	1	4.5116206E-8
barstool	2	9.023241E-8
barstools	4	1.8046482E-7
barsuk	1	4.5116206E-8
bart	56	2.5265076E-6
bartel	3	1.3534861E-7
bartell	2	9.023241E-8
bartels	1	4.5116206E-8
bartelstein	2	9.023241E-8
bartendee	1	4.5116206E-8
bartender	62	2.7972048E-6
bartenders	14	6.316269E-7
bartending	4	1.8046482E-7
barter	18	8.1209174E-7
bartered	5	2.2558103E-7
bartering	5	2.2558103E-7
bartertown	1	4.5116206E-8
barth	10	4.5116207E-7
bartha	4	1.8046482E-7
barthalona	1	4.5116206E-8
barthel	3	1.3534861E-7
bartheleme	1	4.5116206E-8
barthelme	17	7.669755E-7
barthelme-quoting	1	4.5116206E-8
barthes	2	9.023241E-8
bartholdi	2	9.023241E-8
bartholomew	10	4.5116207E-7
barthélemy	17	7.669755E-7
bartiromo	9	4.0604587E-7
bartl	1	4.5116206E-8
bartle	2	9.023241E-8
bartleby	5	2.2558103E-7
bartlet	4	1.8046482E-7
bartlett	31	1.3986024E-6
bartley	8	3.6092965E-7
bartman	1	4.5116206E-8
bartnik	1	4.5116206E-8
barto	2	9.023241E-8
bartok	1	4.5116206E-8
bartol	3	1.3534861E-7
bartoli	31	1.3986024E-6
bartolo	27	1.2181375E-6
bartolomeo	4	1.8046482E-7
bartolomeu	4	1.8046482E-7
bartolomé	4	1.8046482E-7
bartolotta	4	1.8046482E-7
bartomeu	1	4.5116206E-8
barton	65	2.9325533E-6
barton-le	1	4.5116206E-8
bartosek	1	4.5116206E-8
bartoshuk	4	1.8046482E-7
bartosika	1	4.5116206E-8
bartotti	1	4.5116206E-8
bartov	1	4.5116206E-8
barts	15	6.767431E-7
bartylak	4	1.8046482E-7
bartz	2	9.023241E-8
bartók	4	1.8046482E-7
baru	1	4.5116206E-8
baruch	15	6.767431E-7
barung	1	4.5116206E-8
baruthar	1	4.5116206E-8
barware	1	4.5116206E-8
barwin	2	9.023241E-8
barwin-like	1	4.5116206E-8
barycentric	2	9.023241E-8
baryshnikov	14	6.316269E-7
barzan	3	1.3534861E-7
barzani	15	6.767431E-7
barzun	4	1.8046482E-7
bar­thol­o­mew	1	4.5116206E-8
barça	3	1.3534861E-7
barère	1	4.5116206E-8
bas	19	8.572079E-7
bas-relief	5	2.2558103E-7
bas-reliefs	10	4.5116207E-7
basal	307	1.3850676E-5
basal-most	1	4.5116206E-8
basaldua	4	1.8046482E-7
basalis	1	4.5116206E-8
basally	4	1.8046482E-7
basalt	11	4.962783E-7
basantapur	4	1.8046482E-7
basayev	1	4.5116206E-8
bascially	1	4.5116206E-8
base	2283	1.030003E-4
base-base	1	4.5116206E-8
base-called	1	4.5116206E-8
base-coated	1	4.5116206E-8
base-composition	1	4.5116206E-8
base-excision	4	1.8046482E-7
base-line	1	4.5116206E-8
base-maps	1	4.5116206E-8
base-pair	28	1.2632538E-6
base-paired	7	3.1581345E-7
base-pairing	9	4.0604587E-7
base-pairings	2	9.023241E-8
base-pairs	27	1.2181375E-6
base-paths	1	4.5116206E-8
base-running	1	4.5116206E-8
base-stealers	1	4.5116206E-8
base-touching	1	4.5116206E-8
base-year	1	4.5116206E-8
baseball	1620	7.308825E-5
baseball-congress	3	1.3534861E-7
baseball-free	1	4.5116206E-8
baseball-ignorant	1	4.5116206E-8
baseball-infatuated	1	4.5116206E-8
baseball-instead-of	1	4.5116206E-8
baseball-licensed	1	4.5116206E-8
baseball-stadium	1	4.5116206E-8
baseball-umpires	1	4.5116206E-8
baseballer	1	4.5116206E-8
baseballreliquary	1	4.5116206E-8
baseballs	11	4.962783E-7
baseballwise	1	4.5116206E-8
baseboard	4	1.8046482E-7
baseboards	13	5.865107E-7
based	5670	2.558089E-4
based-on-a-true	1	4.5116206E-8
basedon	2	9.023241E-8
basedonelectronic	1	4.5116206E-8
baseketball	2	9.023241E-8
basel	16	7.218593E-7
baseler	5	2.2558103E-7
baseless	18	8.1209174E-7
baselessly	1	4.5116206E-8
baseline	720	3.248367E-5
baseline-rooted	1	4.5116206E-8
baselineand	1	4.5116206E-8
baseliner	1	4.5116206E-8
baselines	10	4.5116207E-7
basely	1	4.5116206E-8
basem	1	4.5116206E-8
baseman	158	7.1283607E-6
basemans	1	4.5116206E-8
basemen	3	1.3534861E-7
basement	436	1.9670666E-5
basement-membrane	1	4.5116206E-8
basements	47	2.1204617E-6
baseness	1	4.5116206E-8
basenji	2	9.023241E-8
basenjies	1	4.5116206E-8
basepair	5	2.2558103E-7
basepairing	3	1.3534861E-7
basepairings	1	4.5116206E-8
basepairs	5	2.2558103E-7
basepat	1	4.5116206E-8
basepaths	4	1.8046482E-7
baser	4	1.8046482E-7
baserunner	1	4.5116206E-8
baserunners	6	2.7069723E-7
baserunning	2	9.023241E-8
bases	520	2.3460427E-5
bases-empty	2	9.023241E-8
bases-loaded	11	4.962783E-7
basest	2	9.023241E-8
basestealers	1	4.5116206E-8
basf	2	9.023241E-8
bash	55	2.4813914E-6
basha-michi	1	4.5116206E-8
bashar	5	2.2558103E-7
bashaw	3	1.3534861E-7
bashed	6	2.7069723E-7
basher	6	2.7069723E-7
bashers	8	3.6092965E-7
bashes	11	4.962783E-7
bashevis	13	5.865107E-7
bashford	3	1.3534861E-7
bashful	7	3.1581345E-7
bashful-like	1	4.5116206E-8
bashfully	1	4.5116206E-8
bashing	52	2.3460427E-6
bashir	12	5.4139446E-7
bashkir	4	1.8046482E-7
bashkirian	7	3.1581345E-7
bashkirs	2	9.023241E-8
bashkortostan	6	2.7069723E-7
bashmet	8	3.6092965E-7
basho	2	9.023241E-8
bashokla	1	4.5116206E-8
bashur	3	1.3534861E-7
basi	1	4.5116206E-8
basial	6	2.7069723E-7
basic	1781	8.0351965E-5
basic-education	1	4.5116206E-8
basic-knowledge	1	4.5116206E-8
basic-leucine	1	4.5116206E-8
basic-tier	1	4.5116206E-8
basicallly	1	4.5116206E-8
basically	1932	8.716451E-5
basicity	1	4.5116206E-8
basico	1	4.5116206E-8
basicphase	3	1.3534861E-7
basics	144	6.496734E-6
basidiobolus	1	4.5116206E-8
basidiomycetes	3	1.3534861E-7
basidiomycota	1	4.5116206E-8
basie	8	3.6092965E-7
basil	72	3.248367E-6
basil-grilled	5	2.2558103E-7
basilar	2	9.023241E-8
basile	5	2.2558103E-7
basilia	1	4.5116206E-8
basilian	1	4.5116206E-8
basilica	190	8.572079E-6
basilicas	1	4.5116206E-8
basilico	1	4.5116206E-8
basilio	2	9.023241E-8
basilique	9	4.0604587E-7
basilisk	2	9.023241E-8
basin	120	5.413945E-6
basin-less	1	4.5116206E-8
basinette	1	4.5116206E-8
basing	32	1.4437186E-6
basinger	10	4.5116207E-7
basingstoke	2	9.023241E-8
basins	11	4.962783E-7
basir	4	1.8046482E-7
basis	2248	1.0142123E-4
basis-point	2	9.023241E-8
basis-you	1	4.5116206E-8
basista	3	1.3534861E-7
basit	1	4.5116206E-8
bask	20	9.0232413E-7
basked	6	2.7069723E-7
baskers	1	4.5116206E-8
baskerville	1	4.5116206E-8
baskervilles	2	9.023241E-8
baskes	3	1.3534861E-7
basket	155	6.993012E-6
basket-choking	1	4.5116206E-8
basket-like	1	4.5116206E-8
basket-making	1	4.5116206E-8
basket-ware	1	4.5116206E-8
basket-weaving	1	4.5116206E-8
basket-work	2	9.023241E-8
basketball	656	2.959623E-5
basketball-on-wednesdays	1	4.5116206E-8
basketball-or	1	4.5116206E-8
basketball-wise	2	9.023241E-8
basketballer	1	4.5116206E-8
basketballs	4	1.8046482E-7
basketful	1	4.5116206E-8
basketmaking	1	4.5116206E-8
basketry	9	4.0604587E-7
baskets	80	3.6092965E-6
basketstore	1	4.5116206E-8
basketware	3	1.3534861E-7
baskies	1	4.5116206E-8
baskin	4	1.8046482E-7
basking	28	1.2632538E-6
basmati	1	4.5116206E-8
basment	1	4.5116206E-8
basoc	1	4.5116206E-8
basolateral	23	1.0376727E-6
basonuclin	2	9.023241E-8
basonuclin-like	1	4.5116206E-8
basophilic	3	1.3534861E-7
basophils	8	3.6092965E-7
basque	102	4.601853E-6
basquear	2	9.023241E-8
basqueing	1	4.5116206E-8
basqueria	1	4.5116206E-8
basquería	1	4.5116206E-8
basques	37	1.6692996E-6
basquiat	1	4.5116206E-8
basra	2	9.023241E-8
bass	240	1.082789E-5
bass-ackward	1	4.5116206E-8
bass-ackwards	1	4.5116206E-8
bass-baritone	1	4.5116206E-8
bass-fishing	1	4.5116206E-8
bass-singing	1	4.5116206E-8
bass-viols	1	4.5116206E-8
bassa	4	1.8046482E-7
bassackawad	1	4.5116206E-8
bassam	2	9.023241E-8
bassani	1	4.5116206E-8
bassayev	1	4.5116206E-8
basse	17	7.669755E-7
bassenthwaite	11	4.962783E-7
bassersdorf	1	4.5116206E-8
basses	1	4.5116206E-8
basset	12	5.4139446E-7
bassets	1	4.5116206E-8
bassett	30	1.3534863E-6
bassin	6	2.7069723E-7
bassinet	2	9.023241E-8
bassinets	2	9.023241E-8
bassinger	2	9.023241E-8
bassist	22	9.925566E-7
bassist-oost	1	4.5116206E-8
bassists	1	4.5116206E-8
bassless	1	4.5116206E-8
bassline	2	9.023241E-8
bassnan	2	9.023241E-8
basso	3	1.3534861E-7
bassoon	2	9.023241E-8
bassplayer	2	9.023241E-8
basspulpooctopus	1	4.5116206E-8
bassui	2	9.023241E-8
bast	5	2.2558103E-7
basta	1	4.5116206E-8
bastani	1	4.5116206E-8
bastard	119	5.3688286E-6
bastardised	1	4.5116206E-8
bastardization	1	4.5116206E-8
bastardize	1	4.5116206E-8
bastardized	2	9.023241E-8
bastards	109	4.9176665E-6
bastardspeak	1	4.5116206E-8
basters	1	4.5116206E-8
bastia	1	4.5116206E-8
bastianich	1	4.5116206E-8
bastid	4	1.8046482E-7
bastidge	1	4.5116206E-8
bastidges	1	4.5116206E-8
bastilla	2	9.023241E-8
bastille	29	1.30837E-6
basting	2	9.023241E-8
bastion	49	2.2106942E-6
bastions	16	7.218593E-7
bastl	1	4.5116206E-8
bastrop	4	1.8046482E-7
bastylia	1	4.5116206E-8
bastyr	3	1.3534861E-7
basu	7	3.1581345E-7
basílica	7	3.1581345E-7
bat	253	1.14144E-5
bat-dialogue	1	4.5116206E-8
bat-family	2	9.023241E-8
bat-filled	1	4.5116206E-8
bat-free	1	4.5116206E-8
bat-like	1	4.5116206E-8
bat-lore	1	4.5116206E-8
bat-shaped	1	4.5116206E-8
bat-shit	1	4.5116206E-8
bat-titles	1	4.5116206E-8
bat-tossing	1	4.5116206E-8
bataan	3	1.3534861E-7
bataille	5	2.2558103E-7
batalha	4	1.8046482E-7
batali	3	1.3534861E-7
batalla	2	9.023241E-8
batallion	1	4.5116206E-8
batalnet	1	4.5116206E-8
batand	1	4.5116206E-8
batang	1	4.5116206E-8
batang-ai	1	4.5116206E-8
batards	1	4.5116206E-8
batarfi	1	4.5116206E-8
batati	1	4.5116206E-8
batavia	3	1.3534861E-7
batavians	1	4.5116206E-8
batboy	1	4.5116206E-8
batboys	1	4.5116206E-8
batcave	4	1.8046482E-7
batch	157	7.0832443E-6
batch-processing	1	4.5116206E-8
batchawana	1	4.5116206E-8
batches	56	2.5265076E-6
batching	1	4.5116206E-8
bate	2	9.023241E-8
bateand	1	4.5116206E-8
bateau	3	1.3534861E-7
bated	7	3.1581345E-7
bateliers	1	4.5116206E-8
bateman	7	3.1581345E-7
batenburg	2	9.023241E-8
bater	2	9.023241E-8
bates	34	1.533951E-6
bateson	4	1.8046482E-7
batesville	1	4.5116206E-8
batf	6	2.7069723E-7
batfam	1	4.5116206E-8
batfamily	1	4.5116206E-8
batfuck	1	4.5116206E-8
batgirl	23	1.0376727E-6
bath	388	1.7505088E-5
bath-application	1	4.5116206E-8
bath-applied	3	1.3534861E-7
bath-clogs	1	4.5116206E-8
bath-house	1	4.5116206E-8
bath-salts	1	4.5116206E-8
bath-type	1	4.5116206E-8
bath-women	1	4.5116206E-8
bathe	49	2.2106942E-6
bathed	63	2.842321E-6
bather	3	1.3534861E-7
bathers	8	3.6092965E-7
bathes	9	4.0604587E-7
bathesora	1	4.5116206E-8
bathetic	5	2.2558103E-7
bathetically	1	4.5116206E-8
bathhouse	6	2.7069723E-7
bathhouses	2	9.023241E-8
bathija	2	9.023241E-8
bathing	141	6.361385E-6
bathing-as-rebaptism	2	9.023241E-8
bathing-beauty	1	4.5116206E-8
bathing-place	1	4.5116206E-8
bathing-related	1	4.5116206E-8
bathing-suit-clad	1	4.5116206E-8
bathmat	1	4.5116206E-8
bathness	1	4.5116206E-8
bathoom	1	4.5116206E-8
bathos	13	5.865107E-7
bathrobe	20	9.0232413E-7
bathrobe-wearing	1	4.5116206E-8
bathrobes	4	1.8046482E-7
bathroom	476	2.1475314E-5
bathroom-porn	1	4.5116206E-8
bathroomk	1	4.5116206E-8
bathrooms	72	3.248367E-6
baths	146	6.5869663E-6
bathsheba	4	1.8046482E-7
bathsoap	1	4.5116206E-8
bathtime	1	4.5116206E-8
bathtub	62	2.7972048E-6
bathtubs	6	2.7069723E-7
bathtubs-full	1	4.5116206E-8
bathurst	3	1.3534861E-7
bathwater	2	9.023241E-8
bathyscaph	2	9.023241E-8
bathyseism	1	4.5116206E-8
bathysphere	1	4.5116206E-8
batiente	1	4.5116206E-8
batik	26	1.1730214E-6
batik-painting	1	4.5116206E-8
batiks	2	9.023241E-8
bating	1	4.5116206E-8
batisse	1	4.5116206E-8
batista	9	4.0604587E-7
batiste	1	4.5116206E-8
batistelli	2	9.023241E-8
batliner	3	1.3534861E-7
batlló	3	1.3534861E-7
batman	130	5.8651067E-6
batmanuel	3	1.3534861E-7
batmobile	2	9.023241E-8
bato	23	1.0376727E-6
batobus	1	4.5116206E-8
baton	30	1.3534863E-6
baton-blows	1	4.5116206E-8
baton-twirling	1	4.5116206E-8
batons	9	4.0604587E-7
batos	2	9.023241E-8
batouti	14	6.316269E-7
batouty	3	1.3534861E-7
batphone	1	4.5116206E-8
bats	126	5.684642E-6
bats-love	1	4.5116206E-8
batscha	2	9.023241E-8
batshit	25	1.1279052E-6
batsi	2	9.023241E-8
batsman	1	4.5116206E-8
batspat	1	4.5116206E-8
batta	1	4.5116206E-8
battaglia	7	3.1581345E-7
battalion	187	8.43673E-6
battalions	10	4.5116207E-7
battani	1	4.5116206E-8
battcher	1	4.5116206E-8
batted	59	2.6618561E-6
batted-ball	1	4.5116206E-8
battelle	5	2.2558103E-7
batten	1	4.5116206E-8
battenberg	1	4.5116206E-8
battenburg	1	4.5116206E-8
battening	1	4.5116206E-8
batter	76	3.4288316E-6
batter-fried	1	4.5116206E-8
batter-like	1	4.5116206E-8
battered	123	5.5492933E-6
battered-spouse	1	4.5116206E-8
battered-women	1	4.5116206E-8
batterer	2	9.023241E-8
batterers	2	9.023241E-8
batteries	110	4.962783E-6
battering	17	7.669755E-7
batterjee	1	4.5116206E-8
batters	39	1.7595321E-6
battery	166	7.4892905E-6
battery-only	1	4.5116206E-8
battery-operated	5	2.2558103E-7
battery-powered	7	3.1581345E-7
battery-related	1	4.5116206E-8
batterymate	1	4.5116206E-8
batterytunnel	1	4.5116206E-8
battey	1	4.5116206E-8
batthyány	3	1.3534861E-7
battie	2	9.023241E-8
battier	1	4.5116206E-8
batting	198	8.933009E-6
batting-cage	1	4.5116206E-8
batting-practice	1	4.5116206E-8
battise	2	9.023241E-8
battista	7	3.1581345E-7
battistero	2	9.023241E-8
battistoni	1	4.5116206E-8
battle	1146	5.1703173E-5
battle-cry	1	4.5116206E-8
battle-fatigued	1	4.5116206E-8
battle-field	1	4.5116206E-8
battle-for-free-will	1	4.5116206E-8
battle-hardened	1	4.5116206E-8
battle-like	1	4.5116206E-8
battle-plan	1	4.5116206E-8
battle-rapping	1	4.5116206E-8
battle-ravaged	1	4.5116206E-8
battle-readiness	2	9.023241E-8
battle-ready	1	4.5116206E-8
battle-scarred	2	9.023241E-8
battle-scarred-we	1	4.5116206E-8
battle-tested	2	9.023241E-8
battle-weary	1	4.5116206E-8
battlebots	2	9.023241E-8
battlecade	1	4.5116206E-8
battled	56	2.5265076E-6
battlefield	73	3.2934831E-6
battlefields	16	7.218593E-7
battlefront	3	1.3534861E-7
battleground	38	1.7144158E-6
battlegrounds	4	1.8046482E-7
battlemented	2	9.023241E-8
battlements	19	8.572079E-7
battler	1	4.5116206E-8
battles	254	1.1459517E-5
battleship	11	4.962783E-7
battleships	6	2.7069723E-7
battleshoe	3	1.3534861E-7
battlestar	11	4.962783E-7
battlewagon	1	4.5116206E-8
battling	111	5.007899E-6
batts	2	9.023241E-8
battus	1	4.5116206E-8
batty	25	1.1279052E-6
batu	20	9.0232413E-7
batuan	3	1.3534861E-7
batubolong	2	9.023241E-8
batubulan	4	1.8046482E-7
batumi	1	4.5116206E-8
batur	12	5.4139446E-7
batuta	1	4.5116206E-8
batverse	3	1.3534861E-7
batwing	3	1.3534861E-7
baty	1	4.5116206E-8
batya	1	4.5116206E-8
batz	1	4.5116206E-8
batz-sur	1	4.5116206E-8
bau	5	2.2558103E-7
bauachuch	1	4.5116206E-8
bauamannii	1	4.5116206E-8
bauble	4	1.8046482E-7
baubles	14	6.316269E-7
bauby	6	2.7069723E-7
baucau	1	4.5116206E-8
baucus	29	1.30837E-6
baud	4	1.8046482E-7
baudelaire	18	8.1209174E-7
baudelairean	1	4.5116206E-8
bauderye	2	9.023241E-8
baudin	1	4.5116206E-8
baudoin	2	9.023241E-8
baudrillard	4	1.8046482E-7
bauds	1	4.5116206E-8
baudy	3	1.3534861E-7
baue	1	4.5116206E-8
bauer	294	1.3264164E-5
bauer-like	1	4.5116206E-8
bauerite	1	4.5116206E-8
bauerle	1	4.5116206E-8
bauerls	1	4.5116206E-8
baugh	15	6.767431E-7
baughan	4	1.8046482E-7
baughman	2	9.023241E-8
bauhaus	21	9.4744036E-7
bauhinia	6	2.7069723E-7
baulcombe	2	9.023241E-8
baule	3	1.3534861E-7
baum	13	5.865107E-7
baumann	4	1.8046482E-7
baumannii	23	1.0376727E-6
baume	1	4.5116206E-8
baume-les	1	4.5116206E-8
baumeister	1	4.5116206E-8
baumgartner	1	4.5116206E-8
baumol	4	1.8046482E-7
baums	1	4.5116206E-8
baun	2	9.023241E-8
baur	2	9.023241E-8
bauro	1	4.5116206E-8
bausch	4	1.8046482E-7
bauserman	2	9.023241E-8
bauszus	2	9.023241E-8
bautista	12	5.4139446E-7
baux	6	2.7069723E-7
baux-de	2	9.023241E-8
bauxite	3	1.3534861E-7
bavaria	12	5.4139446E-7
bavarian	13	5.865107E-7
bavarian-cream-flavored	1	4.5116206E-8
bavarians	1	4.5116206E-8
bavaro	2	9.023241E-8
bavaud	2	9.023241E-8
bavella	1	4.5116206E-8
baveno	1	4.5116206E-8
bavière	1	4.5116206E-8
bavokerk	1	4.5116206E-8
bawazir	1	4.5116206E-8
bawd	4	1.8046482E-7
bawderye	1	4.5116206E-8
bawdiest	1	4.5116206E-8
bawdily	1	4.5116206E-8
bawdry	2	9.023241E-8
bawdy	19	8.572079E-7
bawdy-house	2	9.023241E-8
bawer	1	4.5116206E-8
bawitdaba	1	4.5116206E-8
bawl	4	1.8046482E-7
bawled	5	2.2558103E-7
bawling	10	4.5116207E-7
bawlnlaurn	1	4.5116206E-8
bawlpoint	1	4.5116206E-8
bawls	1	4.5116206E-8
bawn	1	4.5116206E-8
bax	20	9.0232413E-7
baxianguan	1	4.5116206E-8
baxter	20	9.0232413E-7
bay	1171	5.2831077E-5
bay-bee	5	2.2558103E-7
bay-istas	1	4.5116206E-8
bay-men	1	4.5116206E-8
bay-to	1	4.5116206E-8
baya	1	4.5116206E-8
bayadere	30	1.3534863E-6
bayadere-ballet	2	9.023241E-8
bayadère	1	4.5116206E-8
bayakoa	1	4.5116206E-8
bayan	4	1.8046482E-7
bayani	5	2.2558103E-7
bayanus	1	4.5116206E-8
bayar	1	4.5116206E-8
bayard	3	1.3534861E-7
bayat	7	3.1581345E-7
bayazid	1	4.5116206E-8
baybank	3	1.3534861E-7
baybee	11	4.962783E-7
baybeee	1	4.5116206E-8
baybeeee	1	4.5116206E-8
bayberry	1	4.5116206E-8
baye	1	4.5116206E-8
bayede	3	1.3534861E-7
bayer	15	6.767431E-7
bayers	1	4.5116206E-8
bayes	35	1.5790672E-6
bayesian	60	2.7069725E-6
bayeti	1	4.5116206E-8
bayeux	7	3.1581345E-7
bayfront	4	1.8046482E-7
bayh	7	3.1581345E-7
bayh–	1	4.5116206E-8
baying	7	3.1581345E-7
bayistas	1	4.5116206E-8
bayle	1	4.5116206E-8
bayless	5	2.2558103E-7
bayley	1	4.5116206E-8
bayliner	3	1.3534861E-7
baylink	1	4.5116206E-8
bayliss	13	5.865107E-7
baylor	81	3.6544127E-6
baylos	1	4.5116206E-8
bayogoula	1	4.5116206E-8
bayonara	1	4.5116206E-8
bayonet	8	3.6092965E-7
bayonets	3	1.3534861E-7
bayonne	10	4.5116207E-7
bayot	2	9.023241E-8
bayou	12	5.4139446E-7
bayoumi	81	3.6544127E-6
bayoumi-a	1	4.5116206E-8
bayoumi-who	1	4.5116206E-8
bayous	2	9.023241E-8
bayport	1	4.5116206E-8
bayrakdarian	1	4.5116206E-8
bayram	1	4.5116206E-8
bayreuth	3	1.3534861E-7
bayroot	1	4.5116206E-8
bayrou	1	4.5116206E-8
bays	71	3.2032506E-6
bayshore	1	4.5116206E-8
bayside	4	1.8046482E-7
bayt	2	9.023241E-8
baytown	2	9.023241E-8
bayts	1	4.5116206E-8
bayu	1	4.5116206E-8
bayville	1	4.5116206E-8
baywatch	11	4.962783E-7
bayyyybe	1	4.5116206E-8
baz	7	3.1581345E-7
bazaar	102	4.601853E-6
bazaar-like	1	4.5116206E-8
bazaars	25	1.1279052E-6
bazabachuch	1	4.5116206E-8
bazach	1	4.5116206E-8
bazarah	4	1.8046482E-7
bazas	4	1.8046482E-7
bazbazich	1	4.5116206E-8
bazelon	3	1.3534861E-7
bazerman	1	4.5116206E-8
bazetophoth	1	4.5116206E-8
bazett	1	4.5116206E-8
bazia	1	4.5116206E-8
bazich	1	4.5116206E-8
bazigar	1	4.5116206E-8
bazilika	1	4.5116206E-8
bazillion	7	3.1581345E-7
bazillions	2	9.023241E-8
bazillionth	1	4.5116206E-8
bazo	1	4.5116206E-8
bazooka	16	7.218593E-7
bazookas	5	2.2558103E-7
bazoomba	2	9.023241E-8
bazooms	1	4.5116206E-8
bazooooookaaa	1	4.5116206E-8
bazouki	1	4.5116206E-8
bazz	1	4.5116206E-8
bazza	2	9.023241E-8
ba­si­li­ca	1	4.5116206E-8
ba­zaar	1	4.5116206E-8
baçal	1	4.5116206E-8
bañar	1	4.5116206E-8
baños	1	4.5116206E-8
bañuelo	1	4.5116206E-8
bb	87	3.92511E-6
bb-as-cassie	1	4.5116206E-8
bb-as-holden	1	4.5116206E-8
bb-as-joyce	1	4.5116206E-8
bb-as-victimlady	1	4.5116206E-8
bb-expos-demise	1	4.5116206E-8
bb-expos-demise-art	1	4.5116206E-8
bb-ll-wood	1	4.5116206E-8
bba	3	1.3534861E-7
bba-expos	3	1.3534861E-7
bba-mariners	2	9.023241E-8
bba-redsox-comment	1	4.5116206E-8
bba-redsox-jays	1	4.5116206E-8
bba-redsox-tampa	3	1.3534861E-7
bba-redsox-yankees	1	4.5116206E-8
bba-thiel-column	1	4.5116206E-8
bbab	1	4.5116206E-8
bbabb	9	4.0604587E-7
bbb	10	4.5116207E-7
bbbbbbbbbbbbbwahahahahahahahahah	1	4.5116206E-8
bbbnbbb	1	4.5116206E-8
bbc	182	8.211149E-6
bbc-pbs	1	4.5116206E-8
bbc-sponsored	1	4.5116206E-8
bbc-tv	2	9.023241E-8
bbca	4	1.8046482E-7
bbcamerica	2	9.023241E-8
bbccc	1	4.5116206E-8
bbcnews	1	4.5116206E-8
bbd	4	1.8046482E-7
bbdo	15	6.767431E-7
bbenefit	1	4.5116206E-8
bbennett	1	4.5116206E-8
bbf	7	3.1581345E-7
bbfc	2	9.023241E-8
bbhc	1	4.5116206E-8
bbhs	5	2.2558103E-7
bbi	2	9.023241E-8
bbl	2	9.023241E-8
bbm	6	2.7069723E-7
bbm-core	1	4.5116206E-8
bbmc	2	9.023241E-8
bbmv	16	7.218593E-7
bbmvs	1	4.5116206E-8
bbn	4	1.8046482E-7
bbn-braves	2	9.023241E-8
bbn-glavine	1	4.5116206E-8
bbn-hammond	2	9.023241E-8
bbn-lloyd	3	1.3534861E-7
bbn-mets-owners	1	4.5116206E-8
bbn-reds	5	2.2558103E-7
bbn-sosa	1	4.5116206E-8
bbo-anderson-column	1	4.5116206E-8
bbo-baseball-poll	1	4.5116206E-8
bbo-berkow-column	1	4.5116206E-8
bbo-carter	3	1.3534861E-7
bbo-interleague	1	4.5116206E-8
bbo-labor	1	4.5116206E-8
bbo-minor-leagues	1	4.5116206E-8
bbo-minor-leauge	1	4.5116206E-8
bbo-note	8	3.6092965E-7
bbo-notebook	1	4.5116206E-8
bbo-rhoden-column	2	9.023241E-8
bbo-smith-hall-of-fame	1	4.5116206E-8
bbo-team-woes	1	4.5116206E-8
bbo-vecsey-column	1	4.5116206E-8
bbo-yankees-payroll	1	4.5116206E-8
bboc	9	4.0604587E-7
bbox	11	4.962783E-7
bboys	1	4.5116206E-8
bbq	19	8.572079E-7
bbq-basics-ribs	5	2.2558103E-7
bbq-brief	1	4.5116206E-8
bbs	20	9.0232413E-7
bbss	1	4.5116206E-8
bbt	7	3.1581345E-7
bbu	1	4.5116206E-8
bbundy	4	1.8046482E-7
bbut	1	4.5116206E-8
bbv	5	2.2558103E-7
bbva	12	5.4139446E-7
bbvii	7	3.1581345E-7
bbw	1	4.5116206E-8
bbwgacyt	1	4.5116206E-8
bbx	1	4.5116206E-8
bbz	1	4.5116206E-8
bc	133	6.0004554E-6
bc-adobe-azr	1	4.5116206E-8
bc-aids-conference-nyt	1	4.5116206E-8
bc-amwest-azr	1	4.5116206E-8
bc-amwestpilots-azr	1	4.5116206E-8
bc-calif-dog-trial-nyt	1	4.5116206E-8
bc-campusjobs-azr	1	4.5116206E-8
bc-cns-asian-icecream-flavors	2	9.023241E-8
bc-cns-asian-jazz	2	9.023241E-8
bc-cns-bar-cars-vanishing	2	9.023241E-8
bc-cns-broadway-family	2	9.023241E-8
bc-cns-chagas-disease	2	9.023241E-8
bc-cns-comic-book-college	2	9.023241E-8
bc-cns-depression-chic	2	9.023241E-8
bc-cns-first-in-line	2	9.023241E-8
bc-cns-formal-maternity-clothes	2	9.023241E-8
bc-cns-gay-friendly-business	2	9.023241E-8
bc-cns-iguana-rescuers	2	9.023241E-8
bc-cns-india-films	2	9.023241E-8
bc-cns-japanese-buyers	2	9.023241E-8
bc-cns-keyword	2	9.023241E-8
bc-cns-locomotive-broker	2	9.023241E-8
bc-cns-male-bodywaxing	2	9.023241E-8
bc-cns-muslim-womens-magazines	2	9.023241E-8
bc-cns-online-fan-fiction	2	9.023241E-8
bc-cns-online-therapy	2	9.023241E-8
bc-cns-party-tarot	2	9.023241E-8
bc-cns-peanutbutter-restaurant	2	9.023241E-8
bc-cns-plussize-kids-clothes	2	9.023241E-8
bc-cns-prison-penpals	2	9.023241E-8
bc-cns-reusing-coins	2	9.023241E-8
bc-cns-squished-pennies	2	9.023241E-8
bc-cns-stolen-russian-icon	2	9.023241E-8
bc-cns-teaching-workplace-skills	2	9.023241E-8
bc-cns-token-jewelry	2	9.023241E-8
bc-cns-transgender-acceptance	2	9.023241E-8
bc-cns-tugboat-life	2	9.023241E-8
bc-cns-weird-holidays	2	9.023241E-8
bc-cns-wtc-portable-memorial	2	9.023241E-8
bc-cns-yankee-redsox-rivalry	2	9.023241E-8
bc-cns-yoyo-rebound	2	9.023241E-8
bc-coyotesarena-azr	1	4.5116206E-8
bc-crowndancers-azr	1	4.5116206E-8
bc-cryo-profile-azr	1	4.5116206E-8
bc-cryo-science-azr	1	4.5116206E-8
bc-deathrow-azr	1	4.5116206E-8
bc-deecee-williams-art-nyt	1	4.5116206E-8
bc-drunkpilot	1	4.5116206E-8
bc-eagle	1	4.5116206E-8
bc-early-frontpage	5	2.2558103E-7
bc-echeverria-azr	1	4.5116206E-8
bc-facilities-azr	1	4.5116206E-8
bc-finfronts	5	2.2558103E-7
bc-fire	1	4.5116206E-8
bc-fire-apache-azr	1	4.5116206E-8
bc-fire-church-azr	1	4.5116206E-8
bc-fire-evacuees-azr	1	4.5116206E-8
bc-fire-main-azr	1	4.5116206E-8
bc-fire-motive-azr	1	4.5116206E-8
bc-fire-parade-azr	1	4.5116206E-8
bc-fire-profile-azr	1	4.5116206E-8
bc-fire-rimfire	1	4.5116206E-8
bc-firefight-reform-nyt	1	4.5116206E-8
bc-firefolo-azr	1	4.5116206E-8
bc-fires-azr	1	4.5116206E-8
bc-gaming-azr	1	4.5116206E-8
bc-gradstudy-azr	1	4.5116206E-8
bc-gregg-azr	1	4.5116206E-8
bc-gunfire-azr	1	4.5116206E-8
bc-hawaii-azr	1	4.5116206E-8
bc-heart	1	4.5116206E-8
bc-hospital	1	4.5116206E-8
bc-hospital-azr	1	4.5116206E-8
bc-houseofhope-azr	1	4.5116206E-8
bc-israel-bomb-survivors-nyt	1	4.5116206E-8
bc-jason-azr	1	4.5116206E-8
bc-juan	1	4.5116206E-8
bc-judge-azr	1	4.5116206E-8
bc-lethalfence	1	4.5116206E-8
bc-littleelvis-azr	1	4.5116206E-8
bc-loophole	1	4.5116206E-8
bc-magnet	1	4.5116206E-8
bc-mags-azr	2	9.023241E-8
bc-martha-stewart-nyt	1	4.5116206E-8
bc-montini	1	4.5116206E-8
bc-montini-col-azr	3	1.3534861E-7
bc-natgeo-ancient-factory-june	1	4.5116206E-8
bc-natgeo-news-keyword-date-nytsf	1	4.5116206E-8
bc-natgeo-today-keyword-date-nytsf	1	4.5116206E-8
bc-nj-toricelli-art-nyt	1	4.5116206E-8
bc-ny-bread-making-nyt	1	4.5116206E-8
bc-obit-shulman-nyt	1	4.5116206E-8
bc-page	5	2.2558103E-7
bc-pluto-nash-internet-nyt	1	4.5116206E-8
bc-pope-mexico-azr	1	4.5116206E-8
bc-pope-mexicoside-azr	1	4.5116206E-8
bc-ranchlocal-azr	1	4.5116206E-8
bc-rimfire-azr	1	4.5116206E-8
bc-rod-steiger-obit	2	9.023241E-8
bc-russia-kaliningrad-nyt	1	4.5116206E-8
bc-samaritan-azr	1	4.5116206E-8
bc-sciquest-azr	1	4.5116206E-8
bc-speedy-side-food-ladn	1	4.5116206E-8
bc-sri-lanka-u	1	4.5116206E-8
bc-storm-azr	1	4.5116206E-8
bc-syphilis	1	4.5116206E-8
bc-teencancer-azr	1	4.5116206E-8
bc-texbudget-features	6	2.7069723E-7
bc-vienna-berkshires-art-nyt	1	4.5116206E-8
bc-vienna-berkshires-nyt	1	4.5116206E-8
bc-womensrights	1	4.5116206E-8
bca	19	8.572079E-7
bcap	1	4.5116206E-8
bcb	1	4.5116206E-8
bcba	1	4.5116206E-8
bcc	4	1.8046482E-7
bcccc	1	4.5116206E-8
bcci	1	4.5116206E-8
bcd	3	1.3534861E-7
bcdna	1	4.5116206E-8
bce	11	4.962783E-7
bcesm	4	1.8046482E-7
bcg	3	1.3534861E-7
bch	1	4.5116206E-8
bchange	1	4.5116206E-8
bchat	2	9.023241E-8
bchd	3	1.3534861E-7
bchh	3	1.3534861E-7
bchi	3	1.3534861E-7
bcip	10	4.5116207E-7
bcip-nbt	1	4.5116206E-8
bck	2	9.023241E-8
bcl	112	5.0530152E-6
bcl-x	10	4.5116207E-7
bclearly	1	4.5116206E-8
bcli	1	4.5116206E-8
bcls	3	1.3534861E-7
bcm	8	3.6092965E-7
bcn	1	4.5116206E-8
bcne	3	1.3534861E-7
bcom	1	4.5116206E-8
bcompare	1	4.5116206E-8
bcontains	1	4.5116206E-8
bcontrols	1	4.5116206E-8
bcp	2	9.023241E-8
bcpc	1	4.5116206E-8
bcps	2	9.023241E-8
bcr	74	3.3385993E-6
bcr-abl	18	8.1209174E-7
bcr-abl-positive	2	9.023241E-8
bcr-activated	1	4.5116206E-8
bcr-induced	22	9.925566E-7
bcr-mediated	6	2.7069723E-7
bcr-stimulated	1	4.5116206E-8
bcs	72	3.248367E-6
bcw	1	4.5116206E-8
bd	71	3.2032506E-6
bd-transduction	1	4.5116206E-8
bdaf-c	1	4.5116206E-8
bdaley	5	2.2558103E-7
bdart	1	4.5116206E-8
bday	7	3.1581345E-7
bdc	5	2.2558103E-7
bddp	1	4.5116206E-8
bdemonstrate	1	4.5116206E-8
bdemonstrated	1	4.5116206E-8
bdemonstrates	3	1.3534861E-7
bdepicts	1	4.5116206E-8
bdgp	30	1.3534863E-6
bdisplays	1	4.5116206E-8
bdiv	1	4.5116206E-8
bdm	77	3.473948E-6
bdmn	2	9.023241E-8
bdna	1	4.5116206E-8
bdnf	97	4.376272E-6
bdo	8	3.6092965E-7
bdoes	1	4.5116206E-8
bdoom	1	4.5116206E-8
bdp	1	4.5116206E-8
bdrm	2	9.023241E-8
bdu	14	6.316269E-7
bdudney	1	4.5116206E-8
bdul	1	4.5116206E-8
bdup	2	9.023241E-8
bdur	1	4.5116206E-8
bdus	10	4.5116207E-7
bdz	1	4.5116206E-8
bdzs	2	9.023241E-8
be	108865	0.004911576
be-a	1	4.5116206E-8
be-all	9	4.0604587E-7
be-and	1	4.5116206E-8
be-ay-kase	1	4.5116206E-8
be-bop	1	4.5116206E-8
be-bopping	2	9.023241E-8
be-dew	1	4.5116206E-8
be-extra-fair-to	1	4.5116206E-8
be-is	1	4.5116206E-8
be-like-me	1	4.5116206E-8
be-many	1	4.5116206E-8
be-oo-tee-ful	1	4.5116206E-8
be-otch	1	4.5116206E-8
be-the	1	4.5116206E-8
bea	24	1.0827889E-6
beaaaaaaaaaaaans	1	4.5116206E-8
beach	2088	9.420264E-5
beach-bar	1	4.5116206E-8
beach-based	2	9.023241E-8
beach-blanket	1	4.5116206E-8
beach-bound	2	9.023241E-8
beach-front	1	4.5116206E-8
beach-glare	1	4.5116206E-8
beach-goers	4	1.8046482E-7
beach-going	1	4.5116206E-8
beach-head	1	4.5116206E-8
beach-house	1	4.5116206E-8
beach-hugging	1	4.5116206E-8
beach-loving	1	4.5116206E-8
beach-runoff	1	4.5116206E-8
beach-side	1	4.5116206E-8
beach-style	1	4.5116206E-8
beach-volleyball	3	1.3534861E-7
beachcomber	3	1.3534861E-7
beachcombers	2	9.023241E-8
beachcombing	1	4.5116206E-8
beached	14	6.316269E-7
beacher	2	9.023241E-8
beachers	1	4.5116206E-8
beaches	744	3.356646E-5
beaches-do	1	4.5116206E-8
beachfront	29	1.30837E-6
beachgoers	4	1.8046482E-7
beachhead	10	4.5116207E-7
beachheads	1	4.5116206E-8
beaching	1	4.5116206E-8
beachings	1	4.5116206E-8
beachside	18	8.1209174E-7
beachum	4	1.8046482E-7
beachwear	4	1.8046482E-7
beachwood	1	4.5116206E-8
beachworthy	1	4.5116206E-8
beachy	2	9.023241E-8
beacock	2	9.023241E-8
beacon	73	3.2934831E-6
beaconage	1	4.5116206E-8
beacons	14	6.316269E-7
beaconsfield	2	9.023241E-8
beacue	1	4.5116206E-8
beacuse	2	9.023241E-8
bead	64	2.8874372E-6
bead-bound	3	1.3534861E-7
bead-conjugated	1	4.5116206E-8
bead-probe-fragment	1	4.5116206E-8
beaded	17	7.669755E-7
beading	7	3.1581345E-7
beadmaking	1	4.5116206E-8
beads	235	1.0602309E-5
beads-and-sandals	2	9.023241E-8
beadwork	3	1.3534861E-7
beady	5	2.2558103E-7
beady-eyed	1	4.5116206E-8
beaf	1	4.5116206E-8
beagle	8	3.6092965E-7
beaglehole	1	4.5116206E-8
beagles	4	1.8046482E-7
beahan	2	9.023241E-8
beak	13	5.865107E-7
beak-like	1	4.5116206E-8
beaked	1	4.5116206E-8
beaker	6	2.7069723E-7
beakers	3	1.3534861E-7
beakman	1	4.5116206E-8
beaks	9	4.0604587E-7
beaky	2	9.023241E-8
beal	9	4.0604587E-7
beale	12	5.4139446E-7
bealing	1	4.5116206E-8
beall	6	2.7069723E-7
bealmear	1	4.5116206E-8
beals	2	9.023241E-8
beam	179	8.075801E-6
beam-column	3	1.3534861E-7
beamed	26	1.1730214E-6
beamer	4	1.8046482E-7
beamers	1	4.5116206E-8
beaming	37	1.6692996E-6
beams	104	4.6920854E-6
beams-of-fire	1	4.5116206E-8
beamsplitter	1	4.5116206E-8
beamy	1	4.5116206E-8
bean	140	6.316269E-6
bean-bag	2	9.023241E-8
bean-brawl	1	4.5116206E-8
bean-counter	1	4.5116206E-8
bean-counters	2	9.023241E-8
bean-counting	2	9.023241E-8
bean-shaped	1	4.5116206E-8
beanbag	4	1.8046482E-7
beanbags	1	4.5116206E-8
beancurd	3	1.3534861E-7
beane	6	2.7069723E-7
beaneaters	2	9.023241E-8
beaned	1	4.5116206E-8
beaner	1	4.5116206E-8
beanfield	2	9.023241E-8
beangab	1	4.5116206E-8
beanie	48	2.1655778E-6
beanie-loving	1	4.5116206E-8
beanpole	1	4.5116206E-8
beans	237	1.0692541E-5
beans-no	1	4.5116206E-8
beanstalk	1	4.5116206E-8
beantown	2	9.023241E-8
beanz	1	4.5116206E-8
bear	939	4.2364118E-5
bear-eaten	2	9.023241E-8
bear-market	2	9.023241E-8
bear-tracking	1	4.5116206E-8
bearable	17	7.669755E-7
bearcat	1	4.5116206E-8
bearclaw	1	4.5116206E-8
beard	120	5.413945E-6
beardall	22	9.925566E-7
bearded	45	2.0302293E-6
bearden	1	4.5116206E-8
beardgirlfriend	1	4.5116206E-8
beardless	3	1.3534861E-7
beardlip	1	4.5116206E-8
beardpatterned	1	4.5116206E-8
beards	20	9.0232413E-7
beardsley	1	4.5116206E-8
beardstown	4	1.8046482E-7
beare	1	4.5116206E-8
beared	1	4.5116206E-8
bearer	16	7.218593E-7
bearers	11	4.962783E-7
bearing	328	1.4798115E-5
bearings	45	2.0302293E-6
bearish	11	4.962783E-7
bearishness	2	9.023241E-8
bearlike	1	4.5116206E-8
bearlstraat	1	4.5116206E-8
bearnaise	2	9.023241E-8
bearpaw	2	9.023241E-8
bears	427	1.926462E-5
bears-film-review	2	9.023241E-8
bears-review	3	1.3534861E-7
bearsbreath	1	4.5116206E-8
bearskin	6	2.7069723E-7
bearskins	1	4.5116206E-8
beart	2	9.023241E-8
bearthe	1	4.5116206E-8
bearu	1	4.5116206E-8
beary	15	6.767431E-7
beasily	1	4.5116206E-8
beasley	12	5.4139446E-7
beason	1	4.5116206E-8
beast	211	9.51952E-6
beast-baiting	1	4.5116206E-8
beastcakes	1	4.5116206E-8
beastcordy	1	4.5116206E-8
beastesses	1	4.5116206E-8
beastial	1	4.5116206E-8
beastiality	1	4.5116206E-8
beastie	28	1.2632538E-6
beasties	10	4.5116207E-7
beastly	4	1.8046482E-7
beastmaster	2	9.023241E-8
beasts	78	3.5190642E-6
beasty	2	9.023241E-8
beat	1224	5.5222237E-5
beat-about-the-bush	1	4.5116206E-8
beat-box	1	4.5116206E-8
beat-era	1	4.5116206E-8
beat-perfect	1	4.5116206E-8
beat-to-beat	3	1.3534861E-7
beat-up	10	4.5116207E-7
beata	4	1.8046482E-7
beatable	2	9.023241E-8
beatam	1	4.5116206E-8
beatbox	1	4.5116206E-8
beatch	1	4.5116206E-8
beatdown	3	1.3534861E-7
beaten	233	1.0512076E-5
beaten-down	4	1.8046482E-7
beaten-up	2	9.023241E-8
beater	14	6.316269E-7
beaters	4	1.8046482E-7
beatgreets	1	4.5116206E-8
beathard	1	4.5116206E-8
beatific	6	2.7069723E-7
beatific-looking	1	4.5116206E-8
beatifically	2	9.023241E-8
beatification	12	5.4139446E-7
beatifications	1	4.5116206E-8
beatified	10	4.5116207E-7
beatifies	2	9.023241E-8
beatify	11	4.962783E-7
beating	354	1.5971138E-5
beatings	22	9.925566E-7
beatitude	2	9.023241E-8
beatitudes	3	1.3534861E-7
beatle	9	4.0604587E-7
beatle-y	1	4.5116206E-8
beatlejuice	1	4.5116206E-8
beatlemania	2	9.023241E-8
beatles	196	8.842777E-6
beatles-style	1	4.5116206E-8
beatlesongs	1	4.5116206E-8
beatlesque	1	4.5116206E-8
beatnik	6	2.7069723E-7
beatniks	3	1.3534861E-7
beato	3	1.3534861E-7
beaton	1	4.5116206E-8
beatrice	16	7.218593E-7
beatrix	14	6.316269E-7
beats	183	8.256266E-6
beats-and-glass	1	4.5116206E-8
beattie	2	9.023241E-8
beatties	1	4.5116206E-8
beatty	180	8.120917E-6
beattying	1	4.5116206E-8
beatum	1	4.5116206E-8
beatus	1	4.5116206E-8
beau	28	1.2632538E-6
beaubourg	7	3.1581345E-7
beauce	1	4.5116206E-8
beauchamp	2	9.023241E-8
beauchemin	1	4.5116206E-8
beauchesne	1	4.5116206E-8
beaucoup	8	3.6092965E-7
beaudelaire	1	4.5116206E-8
beaudesert	1	4.5116206E-8
beaudin	1	4.5116206E-8
beauford	1	4.5116206E-8
beaufort	7	3.1581345E-7
beaufoy	2	9.023241E-8
beaufret	1	4.5116206E-8
beauiful	1	4.5116206E-8
beaujalais	1	4.5116206E-8
beaujolais	11	4.962783E-7
beaulieu	4	1.8046482E-7
beaumarchais	2	9.023241E-8
beaumont	13	5.865107E-7
beaumont-area	1	4.5116206E-8
beaune	6	2.7069723E-7
beaunichons	1	4.5116206E-8
beauport	1	4.5116206E-8
beaupré	1	4.5116206E-8
beauregard	2	9.023241E-8
beause	2	9.023241E-8
beauseigneur	3	1.3534861E-7
beausoleil	1	4.5116206E-8
beaut	5	2.2558103E-7
beauteous	6	2.7069723E-7
beautfiul	1	4.5116206E-8
beautful	1	4.5116206E-8
beautfully	1	4.5116206E-8
beauti	1	4.5116206E-8
beautician	8	3.6092965E-7
beauticians	1	4.5116206E-8
beauticontrol	1	4.5116206E-8
beautie	1	4.5116206E-8
beauties	44	1.9851132E-6
beautification	3	1.3534861E-7
beautified	3	1.3534861E-7
beautifier	1	4.5116206E-8
beautifol	1	4.5116206E-8
beautiful	1958	8.833753E-5
beautiful-blonde-who-isn	1	4.5116206E-8
beautifully	256	1.1549749E-5
beautifully-preserved	1	4.5116206E-8
beautify	6	2.7069723E-7
beautifying	3	1.3534861E-7
beauty	795	3.5867386E-5
beauty-care	1	4.5116206E-8
beauty-contest	1	4.5116206E-8
beauty-obsessed	1	4.5116206E-8
beauty-pageant	3	1.3534861E-7
beauty-pageant-bashing	1	4.5116206E-8
beauty-parlor	1	4.5116206E-8
beauty-queen	2	9.023241E-8
beauty-shop	1	4.5116206E-8
beauty-whore	1	4.5116206E-8
beauvais	1	4.5116206E-8
beauvoir	6	2.7069723E-7
beaux	27	1.2181375E-6
beaux-arts	3	1.3534861E-7
beau­jolais	1	4.5116206E-8
beavailable	1	4.5116206E-8
beaver	58	2.61674E-6
beaverbrook	3	1.3534861E-7
beavercreek	1	4.5116206E-8
beaverlick	1	4.5116206E-8
beavers	25	1.1279052E-6
beavertail	3	1.3534861E-7
beaverton	2	9.023241E-8
beavis	25	1.1279052E-6
beayootiful	2	9.023241E-8
beazley	1	4.5116206E-8
bebble	1	4.5116206E-8
bebe	35	1.5790672E-6
bebear	15	6.767431E-7
bebek	2	9.023241E-8
bebel	1	4.5116206E-8
bebelplatz	2	9.023241E-8
bebidas	2	9.023241E-8
bebo	1	4.5116206E-8
bebop	13	5.865107E-7
bebopping	1	4.5116206E-8
bec	18	8.1209174E-7
bec-scie	1	4.5116206E-8
beca	5	2.2558103E-7
becaause	1	4.5116206E-8
becalmed	7	3.1581345E-7
becalms	1	4.5116206E-8
became	3175	1.4324396E-4
becasue	4	1.8046482E-7
becau	1	4.5116206E-8
becaues	1	4.5116206E-8
because	37470	0.0016905043
becausehe	1	4.5116206E-8
becauseitsafullyloadedcitrusbeverageright	1	4.5116206E-8
becauser	1	4.5116206E-8
becausethey	1	4.5116206E-8
becbause	2	9.023241E-8
becca	4	1.8046482E-7
beccafumi	1	4.5116206E-8
becdause	1	4.5116206E-8
bech	9	4.0604587E-7
becher	2	9.023241E-8
becherovka	4	1.8046482E-7
bechers	1	4.5116206E-8
bechet	4	1.8046482E-7
bechetta	1	4.5116206E-8
bechler	1	4.5116206E-8
bechloss	1	4.5116206E-8
bechtel	1	4.5116206E-8
bechuanaland	1	4.5116206E-8
beciome	1	4.5116206E-8
becited	1	4.5116206E-8
beck	112	5.0530152E-6
beckardos	2	9.023241E-8
beckeman	3	1.3534861E-7
beckenbauer	1	4.5116206E-8
beckenham	1	4.5116206E-8
beckenstein	1	4.5116206E-8
becker	67	3.022786E-6
beckerich	1	4.5116206E-8
becket	3	1.3534861E-7
beckett	31	1.3986024E-6
beckettian	1	4.5116206E-8
beckham	9	4.0604587E-7
beckie	1	4.5116206E-8
beckinsale	5	2.2558103E-7
beckman	63	2.842321E-6
beckmann	9	4.0604587E-7
beckon	10	4.5116207E-7
beckoned	4	1.8046482E-7
beckoning	6	2.7069723E-7
beckons	15	6.767431E-7
becks	1	4.5116206E-8
beckson	1	4.5116206E-8
beckton	5	2.2558103E-7
beckwith	9	4.0604587E-7
becky	37	1.6692996E-6
becloud	1	4.5116206E-8
beco	1	4.5116206E-8
becom	1	4.5116206E-8
become	5353	2.4150705E-4
becomes	1285	5.7974325E-5
becomesthe	1	4.5116206E-8
becomig	1	4.5116206E-8
becoming	1135	5.1206895E-5
becoming-nice	1	4.5116206E-8
becomingly	2	9.023241E-8
becomming	2	9.023241E-8
becomnes	1	4.5116206E-8
becomng	1	4.5116206E-8
beconsistent	1	4.5116206E-8
beconstrued	1	4.5116206E-8
becora	2	9.023241E-8
becsause	1	4.5116206E-8
becton	90	4.0604587E-6
becuase	84	3.7897614E-6
bed	1455	6.564408E-5
bed-and	2	9.023241E-8
bed-and-breakfast	9	4.0604587E-7
bed-and-breakfasts	3	1.3534861E-7
bed-days	15	6.767431E-7
bed-dvh	26	1.1730214E-6
bed-dvh-bladder	1	4.5116206E-8
bed-dvh-rectum	1	4.5116206E-8
bed-finger	1	4.5116206E-8
bed-in	1	4.5116206E-8
bed-rest	1	4.5116206E-8
bed-ridden	2	9.023241E-8
bed-sharing	1	4.5116206E-8
bed-sheet	1	4.5116206E-8
bed-shifting	1	4.5116206E-8
bed-sitter	1	4.5116206E-8
bed-time	1	4.5116206E-8
bed-wetter	1	4.5116206E-8
bed-wetting	1	4.5116206E-8
bedard	8	3.6092965E-7
bedbound	1	4.5116206E-8
bedbug	2	9.023241E-8
bedbugs	8	3.6092965E-7
bedcam	1	4.5116206E-8
bedchamber	4	1.8046482E-7
bedclothes	2	9.023241E-8
bedcovers	2	9.023241E-8
bedd	1	4.5116206E-8
bedded	7	3.1581345E-7
bedderhead	2	9.023241E-8
beddin	1	4.5116206E-8
bedding	61	2.7520887E-6
beddow	7	3.1581345E-7
beddy-bye	1	4.5116206E-8
bede	3	1.3534861E-7
bedecked	11	4.962783E-7
bedecking	1	4.5116206E-8
bedehuset	1	4.5116206E-8
bedell	21	9.4744036E-7
bedella	1	4.5116206E-8
bedesten	5	2.2558103E-7
bedevil	4	1.8046482E-7
bedeviled	7	3.1581345E-7
bedeviling	1	4.5116206E-8
bedevils	4	1.8046482E-7
bedewing	1	4.5116206E-8
bedfellow	15	6.767431E-7
bedfellows	9	4.0604587E-7
bedford	75	3.3837155E-6
bedfordshire	3	1.3534861E-7
bedfort	1	4.5116206E-8
bedhead	5	2.2558103E-7
bedhopping	1	4.5116206E-8
bediako	1	4.5116206E-8
bedie	3	1.3534861E-7
bedifficult	1	4.5116206E-8
bedirectly	1	4.5116206E-8
bedlam	15	6.767431E-7
bedlin	2	9.023241E-8
bedload	1	4.5116206E-8
bedmate	1	4.5116206E-8
bedminster	2	9.023241E-8
bednarczuk	1	4.5116206E-8
bednarz	2	9.023241E-8
bednet	12	5.4139446E-7
bednets	17	7.669755E-7
bednobs	1	4.5116206E-8
bedocumented	1	4.5116206E-8
bedoin	2	9.023241E-8
bedong	1	4.5116206E-8
bedoni	4	1.8046482E-7
bedore	1	4.5116206E-8
bedouin	13	5.865107E-7
bedouin-style	1	4.5116206E-8
bedouins	5	2.2558103E-7
bedoya	9	4.0604587E-7
bedpan	3	1.3534861E-7
bedpans	2	9.023241E-8
bedpore	1	4.5116206E-8
bedpost	1	4.5116206E-8
bedraggled	15	6.767431E-7
bedragglement	1	4.5116206E-8
bedrest	1	4.5116206E-8
bedridden	10	4.5116207E-7
bedrock	43	1.939997E-6
bedrocks	1	4.5116206E-8
bedroll	1	4.5116206E-8
bedrolls	1	4.5116206E-8
bedroom	482	2.1746011E-5
bedroom-close	1	4.5116206E-8
bedroom-visit	1	4.5116206E-8
bedroommaking	1	4.5116206E-8
bedrooms	116	5.23348E-6
beds	222	1.0015798E-5
bedsheet	3	1.3534861E-7
bedsheets	3	1.3534861E-7
bedside	60	2.7069725E-6
bedsize	1	4.5116206E-8
bedskirt	2	9.023241E-8
bedspread	12	5.4139446E-7
bedspreads	6	2.7069723E-7
bedstead	2	9.023241E-8
bedswapping	1	4.5116206E-8
bedtime	75	3.3837155E-6
bedtime-story	1	4.5116206E-8
bedtimes	2	9.023241E-8
bedugul	3	1.3534861E-7
bedulu	1	4.5116206E-8
bedward	2	9.023241E-8
bedwetr	2	9.023241E-8
bedwetter	1	4.5116206E-8
bee	120	5.413945E-6
bee-a-tch	1	4.5116206E-8
bee-eaters	2	9.023241E-8
bee-loud	2	9.023241E-8
bee-shaped	1	4.5116206E-8
bee-stung	2	9.023241E-8
bee-subjective	1	4.5116206E-8
bee-venom	1	4.5116206E-8
bee-yan	1	4.5116206E-8
bee-yatches	1	4.5116206E-8
bee-yoo-tiful	1	4.5116206E-8
bee-yoot-iful	1	4.5116206E-8
bee-you-tee-ful	1	4.5116206E-8
beeb	3	1.3534861E-7
beebe	6	2.7069723E-7
beebers	1	4.5116206E-8
beebog	3	1.3534861E-7
beebop	2	9.023241E-8
beeby	2	9.023241E-8
beech	16	7.218593E-7
beecham	7	3.1581345E-7
beecher	12	5.4139446E-7
beeches	5	2.2558103E-7
beechwood	3	1.3534861E-7
beee	4	1.8046482E-7
beee-u-tiful	1	4.5116206E-8
beeeech	1	4.5116206E-8
beeeee	1	4.5116206E-8
beeeeeer	1	4.5116206E-8
beef	423	1.9084155E-5
beef-based	1	4.5116206E-8
beef-bashing	1	4.5116206E-8
beef-recall	5	2.2558103E-7
beef-safety	2	9.023241E-8
beef-up	1	4.5116206E-8
beefalo	1	4.5116206E-8
beefcake	3	1.3534861E-7
beefea	2	9.023241E-8
beefeaters	1	4.5116206E-8
beefed	9	4.0604587E-7
beefed-up	9	4.0604587E-7
beefheart	5	2.2558103E-7
beefheart-lovers	1	4.5116206E-8
beefing	4	1.8046482E-7
beefing-bee	1	4.5116206E-8
beefs	5	2.2558103E-7
beefsteak	2	9.023241E-8
beefy	20	9.0232413E-7
beegee	3	1.3534861E-7
beegees	2	9.023241E-8
beehive	11	4.962783E-7
beehives	2	9.023241E-8
beej	1	4.5116206E-8
beejesus	1	4.5116206E-8
beek	3	1.3534861E-7
beek-cake	1	4.5116206E-8
beekeeper	1	4.5116206E-8
beekeeping	3	1.3534861E-7
beeker	1	4.5116206E-8
beekett	1	4.5116206E-8
beekman	1	4.5116206E-8
beel	1	4.5116206E-8
beeline	12	5.4139446E-7
beelines	1	4.5116206E-8
beelzebub	1	4.5116206E-8
beeman	1	4.5116206E-8
beemer	4	1.8046482E-7
beemer-drivin	1	4.5116206E-8
been	41530	0.0018736761
been-and	2	9.023241E-8
been-there	4	1.8046482E-7
been-to-heaven-and-back	1	4.5116206E-8
beena	3	1.3534861E-7
beenas	4	1.8046482E-7
beenawarded	1	4.5116206E-8
beene	5	2.2558103E-7
beenestablished	2	9.023241E-8
beenidentified	1	4.5116206E-8
beenmet	1	4.5116206E-8
beenobserved	1	4.5116206E-8
beenpainfulness	1	4.5116206E-8
beens	2	9.023241E-8
beensubject	1	4.5116206E-8
beenthis	1	4.5116206E-8
beenwell	1	4.5116206E-8
beenwithin	1	4.5116206E-8
beep	77	3.473948E-6
beep-beep-beeps	1	4.5116206E-8
beeped	4	1.8046482E-7
beeper	8	3.6092965E-7
beepers	2	9.023241E-8
beeping	5	2.2558103E-7
beepocalypse	1	4.5116206E-8
beeps	6	2.7069723E-7
beer	790	3.5641802E-5
beer-and-tv	1	4.5116206E-8
beer-bellied	1	4.5116206E-8
beer-brewing	1	4.5116206E-8
beer-commercial	1	4.5116206E-8
beer-drinking	1	4.5116206E-8
beer-fueled	1	4.5116206E-8
beer-garden	1	4.5116206E-8
beer-guzzling	1	4.5116206E-8
beer-house	1	4.5116206E-8
beer-loving	2	9.023241E-8
beer-snob	1	4.5116206E-8
beer-soaked	1	4.5116206E-8
beer-stained	1	4.5116206E-8
beer-swigging	1	4.5116206E-8
beer-swilling	3	1.3534861E-7
beer-testing	1	4.5116206E-8
beerand	1	4.5116206E-8
beerbohm	1	4.5116206E-8
beerdom	1	4.5116206E-8
beerhalls	1	4.5116206E-8
beering	1	4.5116206E-8
beerless	1	4.5116206E-8
beerman	1	4.5116206E-8
beero	1	4.5116206E-8
beers	139	6.271153E-6
beerse	1	4.5116206E-8
beersheba	4	1.8046482E-7
beersheva	1	4.5116206E-8
beeru	1	4.5116206E-8
beeruna	2	9.023241E-8
beery	4	1.8046482E-7
bees	152	6.8576633E-6
beeson	5	2.2558103E-7
beeswax	4	1.8046482E-7
beet	10	4.5116207E-7
beetches	1	4.5116206E-8
beeten	3	1.3534861E-7
beeth	1	4.5116206E-8
beethoven	55	2.4813914E-6
beethovens	1	4.5116206E-8
beetier	1	4.5116206E-8
beetle	47	2.1204617E-6
beetle-free	1	4.5116206E-8
beetle-like	1	4.5116206E-8
beetle-pollinated	1	4.5116206E-8
beetled	1	4.5116206E-8
beetlejuice	10	4.5116207E-7
beetles	43	1.939997E-6
beets	40	1.8046483E-6
beewee	5	2.2558103E-7
beewees	1	4.5116206E-8
beeyatch	1	4.5116206E-8
beeyootiful	1	4.5116206E-8
beeyotches	3	1.3534861E-7
bef	16	7.218593E-7
befall	9	4.0604587E-7
befallen	5	2.2558103E-7
befalling	4	1.8046482E-7
befalls	5	2.2558103E-7
befell	3	1.3534861E-7
beffa	1	4.5116206E-8
befit	1	4.5116206E-8
befits	26	1.1730214E-6
befitted	2	9.023241E-8
befitting	13	5.865107E-7
befo	1	4.5116206E-8
befog	1	4.5116206E-8
befogs	1	4.5116206E-8
befoir	1	4.5116206E-8
befoozled	1	4.5116206E-8
before	15587	7.032263E-4
before-and-after	6	2.7069723E-7
before-school	1	4.5116206E-8
before-tax	1	4.5116206E-8
before-you	1	4.5116206E-8
beforebeginning	1	4.5116206E-8
beforehand	91	4.1055746E-6
beforen	1	4.5116206E-8
beforethe	1	4.5116206E-8
befouling	1	4.5116206E-8
befriend	14	6.316269E-7
befriended	20	9.0232413E-7
befriending	5	2.2558103E-7
befriends	12	5.4139446E-7
befuddled	24	1.0827889E-6
befuddled-looking	1	4.5116206E-8
befuddledment	1	4.5116206E-8
befuddlement	7	3.1581345E-7
befuddling	2	9.023241E-8
beg	103	4.6469695E-6
bega	1	4.5116206E-8
begajah	1	4.5116206E-8
begala	34	1.533951E-6
began	3009	1.3575467E-4
begar	1	4.5116206E-8
begari	1	4.5116206E-8
begarm	1	4.5116206E-8
begas	1	4.5116206E-8
begat	9	4.0604587E-7
begats	1	4.5116206E-8
begatz	1	4.5116206E-8
begawan	2	9.023241E-8
begay	3	1.3534861E-7
beget	9	4.0604587E-7
begets	8	3.6092965E-7
begetting	4	1.8046482E-7
beggar	11	4.962783E-7
beggar-books	1	4.5116206E-8
beggar-masters	1	4.5116206E-8
beggar-thy-neighbor	1	4.5116206E-8
beggarman	1	4.5116206E-8
beggars	15	6.767431E-7
beggary	1	4.5116206E-8
begged	60	2.7069725E-6
beggiatoa	1	4.5116206E-8
beggin	2	9.023241E-8
begging	96	4.3311557E-6
begging-the-question	1	4.5116206E-8
beggy	1	4.5116206E-8
beghards	2	9.023241E-8
begiessen	1	4.5116206E-8
begijnhof	5	2.2558103E-7
begin	1837	8.287847E-5
beginer	1	4.5116206E-8
begining	6	2.7069723E-7
beginitalic	27	1.2181375E-6
beginner	18	8.1209174E-7
beginners	33	1.4888349E-6
beginners-level	1	4.5116206E-8
beginning	2120	9.5646355E-5
beginning-of-summer	2	9.023241E-8
beginning-year	1	4.5116206E-8
beginningjanuary	1	4.5116206E-8
beginnings	86	3.879994E-6
begins	977	4.4078533E-5
begl	4	1.8046482E-7
begley	22	9.925566E-7
begm	1	4.5116206E-8
begone	2	9.023241E-8
begonia	3	1.3534861E-7
begonias	9	4.0604587E-7
begot	1	4.5116206E-8
begotten	7	3.1581345E-7
begoun	1	4.5116206E-8
begowned	1	4.5116206E-8
begr	4	1.8046482E-7
begrudge	21	9.4744036E-7
begrudged	2	9.023241E-8
begrudges	2	9.023241E-8
begrudgingly	8	3.6092965E-7
begs	52	2.3460427E-6
beguile	4	1.8046482E-7
beguiled	3	1.3534861E-7
beguiles	4	1.8046482E-7
beguiling	21	9.4744036E-7
beguilingly	3	1.3534861E-7
beguine	1	4.5116206E-8
beguines	3	1.3534861E-7
begum	5	2.2558103E-7
begun	665	3.0002277E-5
begun-included	1	4.5116206E-8
beh	1	4.5116206E-8
behai	1	4.5116206E-8
behaivors	1	4.5116206E-8
behalf	455	2.0527874E-5
behalf-could	1	4.5116206E-8
behan	3	1.3534861E-7
behar	1	4.5116206E-8
behari	2	9.023241E-8
behav	1	4.5116206E-8
behave	181	8.166034E-6
behaved	105	4.737202E-6
behaves	43	1.939997E-6
behaving	60	2.7069725E-6
behavior	1771	7.9900805E-5
behavior-babble	1	4.5116206E-8
behavior-policing	2	9.023241E-8
behavior-related	2	9.023241E-8
behavioral	294	1.3264164E-5
behaviorally	3	1.3534861E-7
behaviorism	6	2.7069723E-7
behaviorist	11	4.962783E-7
behaviorists	1	4.5116206E-8
behaviors	237	1.0692541E-5
behaviors-and	1	4.5116206E-8
behaviour	147	6.632082E-6
behavioural	14	6.316269E-7
behaviours	14	6.316269E-7
behcet	2	9.023241E-8
behe	1	4.5116206E-8
behead	10	4.5116207E-7
beheaded	25	1.1279052E-6
beheading	14	6.316269E-7
beheadings	7	3.1581345E-7
beheads	3	1.3534861E-7
beheld	5	2.2558103E-7
behemoth	22	9.925566E-7
behemoths	5	2.2558103E-7
behenic	1	4.5116206E-8
behest	34	1.533951E-6
behests	2	9.023241E-8
behind	3387	1.5280858E-4
behind-the	2	9.023241E-8
behind-the-scene	1	4.5116206E-8
behind-the-scenes	49	2.2106942E-6
behindness	1	4.5116206E-8
behinds	5	2.2558103E-7
behmel	1	4.5116206E-8
behn	2	9.023241E-8
behning	1	4.5116206E-8
behold	55	2.4813914E-6
beholden	27	1.2181375E-6
beholder	14	6.316269E-7
beholdin	1	4.5116206E-8
beholding	3	1.3534861E-7
behoove	5	2.2558103E-7
behooves	15	6.767431E-7
behr	3	1.3534861E-7
behrandt	2	9.023241E-8
behravesh	2	9.023241E-8
behre	12	5.4139446E-7
behrens	2	9.023241E-8
behrenstraße	1	4.5116206E-8
behring	4	1.8046482E-7
behrout	1	4.5116206E-8
behung	1	4.5116206E-8
behviour	1	4.5116206E-8
behçet	3	1.3534861E-7
bei	9	4.0604587E-7
bei?en	1	4.5116206E-8
beibi	1	4.5116206E-8
beichan	1	4.5116206E-8
beichman	1	4.5116206E-8
beidaihe	2	9.023241E-8
beiden	2	9.023241E-8
beiderbecke	1	4.5116206E-8
beig	1	4.5116206E-8
beige	70	3.1581344E-6
beige-and-red	1	4.5116206E-8
beige-book	1	4.5116206E-8
beige-colored	1	4.5116206E-8
beige-tan	2	9.023241E-8
beige-tan-pinkish	1	4.5116206E-8
beigeangel	1	4.5116206E-8
beigelli	1	4.5116206E-8
beigey	1	4.5116206E-8
beign	3	1.3534861E-7
beignets	4	1.8046482E-7
beigy-tan-toned	1	4.5116206E-8
beihai	15	6.767431E-7
beijing	503	2.2693452E-5
beijing-backed	1	4.5116206E-8
beijing-based	3	1.3534861E-7
beijing-connected	1	4.5116206E-8
beijing-style	1	4.5116206E-8
beijingers	4	1.8046482E-7
beikoku	2	9.023241E-8
beilein	1	4.5116206E-8
beilin	2	9.023241E-8
beille	5	2.2558103E-7
beimel	1	4.5116206E-8
bein	10	4.5116207E-7
beinart	5	2.2558103E-7
beinbruch	1	4.5116206E-8
beinfest	12	5.4139446E-7
being	15279	6.893305E-4
being-an-actual-mom	1	4.5116206E-8
being-left-aloneness	1	4.5116206E-8
being-tied-in-the-living-room-and-snarking	2	9.023241E-8
beinga	1	4.5116206E-8
beingbelow	1	4.5116206E-8
beingimportant	1	4.5116206E-8
beings	255	1.1504632E-5
beingwas	1	4.5116206E-8
beinstein	1	4.5116206E-8
beiping	1	4.5116206E-8
beira	11	4.962783E-7
beiras	4	1.8046482E-7
beirne	31	1.3986024E-6
beirut	43	1.939997E-6
beishan	1	4.5116206E-8
beit	10	4.5116207E-7
beiwenquan	1	4.5116206E-8
beiyuan	2	9.023241E-8
beja	5	2.2558103E-7
bejeebus	1	4.5116206E-8
bejesus	2	9.023241E-8
bejeweled	10	4.5116207E-7
bejewelled	1	4.5116206E-8
bejezus	1	4.5116206E-8
beji	1	4.5116206E-8
bek	1	4.5116206E-8
beka	1	4.5116206E-8
bekaa	1	4.5116206E-8
bekbolatov	1	4.5116206E-8
bekennen	1	4.5116206E-8
bekex	3	1.3534861E-7
beknighted	2	9.023241E-8
bel	28	1.2632538E-6
bel-air	1	4.5116206E-8
bela	35	1.5790672E-6
belabor	4	1.8046482E-7
belabored	3	1.3534861E-7
belaboring	2	9.023241E-8
belabors	1	4.5116206E-8
belacevac	1	4.5116206E-8
belafonte	12	5.4139446E-7
belafonte-loving	1	4.5116206E-8
belafontes	1	4.5116206E-8
belaga	2	9.023241E-8
belah	1	4.5116206E-8
belain	4	1.8046482E-7
belair	2	9.023241E-8
belaire	1	4.5116206E-8
belanjong	1	4.5116206E-8
belarius	1	4.5116206E-8
belarnes	1	4.5116206E-8
belarus	19	8.572079E-7
belarussian	4	1.8046482E-7
belarussians	1	4.5116206E-8
belasco	6	2.7069723E-7
belascoán	1	4.5116206E-8
belated	63	2.842321E-6
belatedly	30	1.3534863E-6
belatedness	2	9.023241E-8
belau	1	4.5116206E-8
belay	4	1.8046482E-7
belaying	1	4.5116206E-8
belays	1	4.5116206E-8
belbus	1	4.5116206E-8
belch	9	4.0604587E-7
belched	2	9.023241E-8
belcher	3	1.3534861E-7
belches	6	2.7069723E-7
belching	6	2.7069723E-7
belcourt	1	4.5116206E-8
belda	1	4.5116206E-8
beldame	2	9.023241E-8
belden	8	3.6092965E-7
belding	3	1.3534861E-7
beleaguered	47	2.1204617E-6
belega	1	4.5116206E-8
beleive	3	1.3534861E-7
beleived	1	4.5116206E-8
beleke	1	4.5116206E-8
belem	7	3.1581345E-7
belemjian	2	9.023241E-8
belen	1	4.5116206E-8
belenchia	1	4.5116206E-8
beleption	1	4.5116206E-8
belev	1	4.5116206E-8
beleve	4	1.8046482E-7
belfast	74	3.3385993E-6
belfast-born	1	4.5116206E-8
belfatmi	2	9.023241E-8
belford	2	9.023241E-8
belfour	10	4.5116207E-7
belfrage	1	4.5116206E-8
belfries	2	9.023241E-8
belfry	17	7.669755E-7
belgacom	4	1.8046482E-7
belgasam	1	4.5116206E-8
belger	17	7.669755E-7
belges	1	4.5116206E-8
belgian	86	3.879994E-6
belgian-born	1	4.5116206E-8
belgian-style	5	2.2558103E-7
belgians	13	5.865107E-7
belgica	1	4.5116206E-8
belgique	1	4.5116206E-8
belgium	116	5.23348E-6
belgium-based	1	4.5116206E-8
belgrade	130	5.8651067E-6
belgrano	1	4.5116206E-8
belhambra	1	4.5116206E-8
beli	1	4.5116206E-8
belian	2	9.023241E-8
belic	2	9.023241E-8
beliche	5	2.2558103E-7
belichick	18	8.1209174E-7
belie	9	4.0604587E-7
belied	8	3.6092965E-7
belief	565	2.5490657E-5
beliefe	2	9.023241E-8
beliefnet	4	1.8046482E-7
beliefs	368	1.6602764E-5
beliefs-a	1	4.5116206E-8
belierof	1	4.5116206E-8
belies	18	8.1209174E-7
believability	2	9.023241E-8
believable	65	2.9325533E-6
believable-looking	1	4.5116206E-8
believably	8	3.6092965E-7
believe	5108	2.3045359E-4
believe-incorrectly-that	1	4.5116206E-8
believe-it-or-not	1	4.5116206E-8
believe-that	1	4.5116206E-8
believeable	2	9.023241E-8
believed	1246	5.6214794E-5
believedshe	1	4.5116206E-8
believer	73	3.2934831E-6
believers	75	3.3837155E-6
believes	825	3.722087E-5
believewas	1	4.5116206E-8
believin	1	4.5116206E-8
believing	188	8.481847E-6
beligum	1	4.5116206E-8
belinda	29	1.30837E-6
beling	3	1.3534861E-7
belisha	2	9.023241E-8
belishas	1	4.5116206E-8
belittle	10	4.5116207E-7
belittled	6	2.7069723E-7
belittles	4	1.8046482E-7
belittling	9	4.0604587E-7
belive	5	2.2558103E-7
belived	1	4.5116206E-8
belives	2	9.023241E-8
belixe	1	4.5116206E-8
belize	20	9.0232413E-7
beljoxa	18	8.1209174E-7
belk	1	4.5116206E-8
belkin	1	4.5116206E-8
belknap	1	4.5116206E-8
bell	667	3.009251E-5
bell-butted	1	4.5116206E-8
bell-curve	1	4.5116206E-8
bell-curve-shaped	1	4.5116206E-8
bell-ist	1	4.5116206E-8
bell-like	3	1.3534861E-7
bell-ringing	1	4.5116206E-8
bell-shaped	7	3.1581345E-7
bell-striking	1	4.5116206E-8
bell-tower	2	9.023241E-8
bella	22	9.925566E-7
belladonna	3	1.3534861E-7
bellafante	4	1.8046482E-7
bellagi	1	4.5116206E-8
bellagio	21	9.4744036E-7
bellamar	1	4.5116206E-8
bellamy	5	2.2558103E-7
belland	2	9.023241E-8
bellas	7	3.1581345E-7
bellavista	1	4.5116206E-8
bellbottom	1	4.5116206E-8
bellboy	1	4.5116206E-8
bellboys	2	9.023241E-8
bellco	1	4.5116206E-8
bellcore	1	4.5116206E-8
belle	87	3.92511E-6
bellecour	1	4.5116206E-8
bellefontaine	1	4.5116206E-8
bellefonte	5	2.2558103E-7
bellens	1	4.5116206E-8
beller	1	4.5116206E-8
belles	2	9.023241E-8
belletristic	1	4.5116206E-8
belleville	6	2.7069723E-7
bellevue	11	4.962783E-7
bellflower	1	4.5116206E-8
bellhop	2	9.023241E-8
bellhops	2	9.023241E-8
bellhorn	3	1.3534861E-7
bellian	1	4.5116206E-8
belliard	1	4.5116206E-8
bellibones	4	1.8046482E-7
bellicose	14	6.316269E-7
bellicosity	3	1.3534861E-7
bellied	5	2.2558103E-7
bellies	18	8.1209174E-7
belligerence	17	7.669755E-7
belligerency	3	1.3534861E-7
belligerent	22	9.925566E-7
belligerently	1	4.5116206E-8
bellin	2	9.023241E-8
bellinger	1	4.5116206E-8
bellingham	7	3.1581345E-7
bellini	16	7.218593E-7
bellisario	1	4.5116206E-8
bellman	2	9.023241E-8
bellmarc	2	9.023241E-8
bellmen	2	9.023241E-8
bello	4	1.8046482E-7
belloc	3	1.3534861E-7
bellofatto	1	4.5116206E-8
bellomont	1	4.5116206E-8
bellone	3	1.3534861E-7
bellotti	4	1.8046482E-7
bellovian	1	4.5116206E-8
bellow	52	2.3460427E-6
bellowed	9	4.0604587E-7
bellowers	1	4.5116206E-8
bellowing	9	4.0604587E-7
bellows	24	1.0827889E-6
bellport	2	9.023241E-8
bells	165	7.444174E-6
bellsouth	26	1.1730214E-6
bellsweapons	1	4.5116206E-8
belltower	8	3.6092965E-7
belltowers	4	1.8046482E-7
belluck	5	2.2558103E-7
belluga	2	9.023241E-8
bellugi	2	9.023241E-8
bellum	1	4.5116206E-8
belluzzo	3	1.3534861E-7
bellver	3	1.3534861E-7
bellwether	11	4.962783E-7
bellwethers	6	2.7069723E-7
bellwhether	1	4.5116206E-8
belly	147	6.632082E-6
belly-bumping	2	9.023241E-8
belly-button-baring	1	4.5116206E-8
belly-crawl	1	4.5116206E-8
belly-dancer	1	4.5116206E-8
belly-dancing	6	2.7069723E-7
belly-flop	2	9.023241E-8
belly-laugh	3	1.3534861E-7
belly-nipper	1	4.5116206E-8
belly-rubbing	1	4.5116206E-8
belly-style	1	4.5116206E-8
belly-up	4	1.8046482E-7
bellyache	1	4.5116206E-8
bellyachin	1	4.5116206E-8
bellyaching	3	1.3534861E-7
bellybutton	13	5.865107E-7
bellybuttons	1	4.5116206E-8
bellydancer	1	4.5116206E-8
bellydancers	2	9.023241E-8
bellydancing	1	4.5116206E-8
bellyful	1	4.5116206E-8
bellying	1	4.5116206E-8
bellyologist	1	4.5116206E-8
bellys	2	9.023241E-8
bell­tower	1	4.5116206E-8
bellísimo	1	4.5116206E-8
belmaco	3	1.3534861E-7
belmaine	2	9.023241E-8
belman	5	2.2558103E-7
belmarço	1	4.5116206E-8
belme	1	4.5116206E-8
belmont	78	3.5190642E-6
belmonte	2	9.023241E-8
belmonts	1	4.5116206E-8
belmost	1	4.5116206E-8
belo	3	1.3534861E-7
beloit	2	9.023241E-8
beloki	63	2.842321E-6
belon	2	9.023241E-8
belong	464	2.093392E-5
belonged	168	7.579523E-6
belonging	161	7.2637094E-6
belongings	55	2.4813914E-6
belongs	303	1.3670211E-5
belorussia	1	4.5116206E-8
belorussian	1	4.5116206E-8
belostomatid	1	4.5116206E-8
belote	4	1.8046482E-7
beloved	286	1.2903235E-5
below	2321	1.04714716E-4
below-average	6	2.7069723E-7
below-deck	1	4.5116206E-8
below-freezing	3	1.3534861E-7
below-ground	1	4.5116206E-8
below-market	3	1.3534861E-7
below-median-income	1	4.5116206E-8
below-sensitivity	1	4.5116206E-8
below-the-fold	7	3.1581345E-7
below-the-fold-front	1	4.5116206E-8
below-the-poverty-line	1	4.5116206E-8
below-the-surface	1	4.5116206E-8
belowdecks	1	4.5116206E-8
belowor	1	4.5116206E-8
belozersky	1	4.5116206E-8
belp-horn	1	4.5116206E-8
belsen	1	4.5116206E-8
belski	2	9.023241E-8
belson	2	9.023241E-8
belt	322	1.4527419E-5
belt-high	1	4.5116206E-8
belt-mounted	1	4.5116206E-8
belt-tightening	3	1.3534861E-7
belted	17	7.669755E-7
belter	1	4.5116206E-8
beltin	1	4.5116206E-8
belting	3	1.3534861E-7
beltless	5	2.2558103E-7
beltline	3	1.3534861E-7
belton	4	1.8046482E-7
beltramo	1	4.5116206E-8
beltran	4	1.8046482E-7
beltrao	2	9.023241E-8
beltre	61	2.7520887E-6
belts	121	5.459061E-6
beltsville	1	4.5116206E-8
beltway	63	2.842321E-6
beltway-bashing	1	4.5116206E-8
beltways	1	4.5116206E-8
belud	2	9.023241E-8
beluga	9	4.0604587E-7
beluis	1	4.5116206E-8
belur	7	3.1581345E-7
belushi	13	5.865107E-7
belva	2	9.023241E-8
belvedere	17	7.669755E-7
belváros	2	9.023241E-8
belvárosi	1	4.5116206E-8
belvédère	1	4.5116206E-8
belwyn	1	4.5116206E-8
belyeu	1	4.5116206E-8
belyi	1	4.5116206E-8
belying	3	1.3534861E-7
belz	2	9.023241E-8
belzec	2	9.023241E-8
belzer	3	1.3534861E-7
belästigung	1	4.5116206E-8
belém	13	5.865107E-7
belén	1	4.5116206E-8
bem	11	4.962783E-7
bema	1	4.5116206E-8
bembo	2	9.023241E-8
bemerson	1	4.5116206E-8
bemerton	1	4.5116206E-8
bemidji	1	4.5116206E-8
bemis	2	9.023241E-8
bemoan	18	8.1209174E-7
bemoaned	16	7.218593E-7
bemoaning	15	6.767431E-7
bemoans	17	7.669755E-7
bemos	2	9.023241E-8
bems	3	1.3534861E-7
bemuse	1	4.5116206E-8
bemused	33	1.4888349E-6
bemusement	6	2.7069723E-7
bemusing	1	4.5116206E-8
ben	671	3.0272975E-5
ben-and	1	4.5116206E-8
ben-confession-that-was	1	4.5116206E-8
ben-era	1	4.5116206E-8
ben-is	3	1.3534861E-7
benabid	1	4.5116206E-8
benacantil	1	4.5116206E-8
benacquista	1	4.5116206E-8
benadryl	24	1.0827889E-6
benadryle	1	4.5116206E-8
benadryls	1	4.5116206E-8
benagil	1	4.5116206E-8
benahoare	1	4.5116206E-8
benahoritas	1	4.5116206E-8
benaissa	5	2.2558103E-7
benalmádena	13	5.865107E-7
benami	1	4.5116206E-8
benares	3	1.3534861E-7
benasau	1	4.5116206E-8
benatar	11	4.962783E-7
benaulim	1	4.5116206E-8
benavides	3	1.3534861E-7
benazir	5	2.2558103E-7
benaïm	1	4.5116206E-8
benben	2	9.023241E-8
benbrook	2	9.023241E-8
benburb	1	4.5116206E-8
bench	212	9.564636E-6
bench-for-dining-table	1	4.5116206E-8
bench-press	1	4.5116206E-8
bench-presses	1	4.5116206E-8
bench-warmer	1	4.5116206E-8
benched	7	3.1581345E-7
benched-but-not-forgotten	1	4.5116206E-8
benches	61	2.7520887E-6
benchley	3	1.3534861E-7
benchmark	90	4.0604587E-6
benchmarked	11	4.962783E-7
benchmarking	36	1.6241835E-6
benchmarking-comparing	1	4.5116206E-8
benchmarks	31	1.3986024E-6
benchtop	1	4.5116206E-8
bend	193	8.707428E-6
bendability	1	4.5116206E-8
bendable	3	1.3534861E-7
bendahara	3	1.3534861E-7
bendak	1	4.5116206E-8
benday	1	4.5116206E-8
bendectin	1	4.5116206E-8
bended	5	2.2558103E-7
bendele	1	4.5116206E-8
bender	14	6.316269E-7
benders	6	2.7069723E-7
bendinat	1	4.5116206E-8
bending	81	3.6544127E-6
bendito	1	4.5116206E-8
bendix	5	2.2558103E-7
bendixen	5	2.2558103E-7
bendlerblock	1	4.5116206E-8
bendrix	1	4.5116206E-8
bends	56	2.5265076E-6
bendy	7	3.1581345E-7
bene	4	1.8046482E-7
bene?cial	2	9.023241E-8
bene?t	8	3.6092965E-7
bene?ting	1	4.5116206E-8
bene?ts	16	7.218593E-7
beneath	462	2.0843687E-5
benecke	2	9.023241E-8
benedetti	2	9.023241E-8
benedettini	1	4.5116206E-8
benedetto	1	4.5116206E-8
benedict	36	1.6241835E-6
benedicta	1	4.5116206E-8
benedictine	18	8.1209174E-7
benedictines	1	4.5116206E-8
benediction	9	4.0604587E-7
benedicto	1	4.5116206E-8
benedictory	1	4.5116206E-8
benefaction	1	4.5116206E-8
benefactor	20	9.0232413E-7
benefactors	14	6.316269E-7
benefactress	1	4.5116206E-8
beneficence	3	1.3534861E-7
beneficencia	1	4.5116206E-8
beneficent	6	2.7069723E-7
beneficia	1	4.5116206E-8
beneficiairies	1	4.5116206E-8
beneficial	285	1.2858119E-5
beneficialeffects	1	4.5116206E-8
beneficiaries	166	7.4892905E-6
beneficiary	64	2.8874372E-6
benefit	1633	7.367477E-5
benefit-cost	8	3.6092965E-7
benefit-receiving	1	4.5116206E-8
benefit-recipient	1	4.5116206E-8
benefit-related	1	4.5116206E-8
benefit-shopping	1	4.5116206E-8
benefitcosmetics	1	4.5116206E-8
benefited	142	6.406501E-6
benefiting	51	2.3009266E-6
benefitless	1	4.5116206E-8
benefits	2575	1.1617423E-4
benefits-although	1	4.5116206E-8
benefitted	10	4.5116207E-7
benefitting	1	4.5116206E-8
benefnit	1	4.5116206E-8
benelux	2	9.023241E-8
benepe	6	2.7069723E-7
benes	2	9.023241E-8
beneteau	1	4.5116206E-8
beneth	1	4.5116206E-8
benetint	2	9.023241E-8
benetton	20	9.0232413E-7
benevento	1	4.5116206E-8
benevides	4	1.8046482E-7
benevolence	12	5.4139446E-7
benevolence-but-really-evil	1	4.5116206E-8
benevolent	49	2.2106942E-6
benex	5	2.2558103E-7
bene­dictine	1	4.5116206E-8
bene­dic­tine	1	4.5116206E-8
benfey	12	5.4139446E-7
benfica	1	4.5116206E-8
benfit	1	4.5116206E-8
benford	5	2.2558103E-7
beng	1	4.5116206E-8
bengal	29	1.30837E-6
bengalensis	1	4.5116206E-8
bengali	9	4.0604587E-7
bengaline	1	4.5116206E-8
bengalis	1	4.5116206E-8
bengals	24	1.0827889E-6
bengie	24	1.0827889E-6
bengiveno	7	3.1581345E-7
benglish	1	4.5116206E-8
benhadara	16	7.218593E-7
benhadaras	11	4.962783E-7
benham	1	4.5116206E-8
beniaminów	1	4.5116206E-8
benicia	1	4.5116206E-8
benicio	3	1.3534861E-7
benidoleig	1	4.5116206E-8
benidorm	22	9.925566E-7
benighted	11	4.962783E-7
benign	175	7.895336E-6
benigni	15	6.767431E-7
benignly	3	1.3534861E-7
benihana	3	1.3534861E-7
benin	9	4.0604587E-7
benin-born	1	4.5116206E-8
bening	18	8.1209174E-7
benirschke	1	4.5116206E-8
benis	1	4.5116206E-8
benita	2	9.023241E-8
benitez	10	4.5116207E-7
benito	10	4.5116207E-7
benjamiiiin	1	4.5116206E-8
benjamin	250	1.1279051E-5
benjamina	1	4.5116206E-8
benjamini	1	4.5116206E-8
benjaminkline	1	4.5116206E-8
benjaminn	1	4.5116206E-8
benjamins	2	9.023241E-8
benjelloun	8	3.6092965E-7
benjellouns	14	6.316269E-7
benji	15	6.767431E-7
benjy	2	9.023241E-8
benkovic	4	1.8046482E-7
benlliure	2	9.023241E-8
benn	4	1.8046482E-7
bennack	1	4.5116206E-8
benner	1	4.5116206E-8
bennet	17	7.669755E-7
benneton	1	4.5116206E-8
bennett	370	1.6692997E-5
bennetts	1	4.5116206E-8
benni	1	4.5116206E-8
bennick	1	4.5116206E-8
bennie	1	4.5116206E-8
bennies	3	1.3534861E-7
bennifer	1	4.5116206E-8
bennigan	3	1.3534861E-7
benning	5	2.2558103E-7
bennington	5	2.2558103E-7
benno	11	4.962783E-7
benny	32	1.4437186E-6
benoa	9	4.0604587E-7
benoit	17	7.669755E-7
benold	4	1.8046482E-7
benomrane	10	4.5116207E-7
benozzo	1	4.5116206E-8
benoît	2	9.023241E-8
benoît-du	1	4.5116206E-8
benrubi	1	4.5116206E-8
bens	1	4.5116206E-8
bensafrim	1	4.5116206E-8
bensasson	1	4.5116206E-8
benshan	3	1.3534861E-7
benshoshan	2	9.023241E-8
bensi	1	4.5116206E-8
benso	1	4.5116206E-8
benson	72	3.248367E-6
bensonhurst	2	9.023241E-8
bent	215	9.699985E-6
bent-over	1	4.5116206E-8
bent-tip-tailed-cat	1	4.5116206E-8
bent-tube	1	4.5116206E-8
bentaiga	1	4.5116206E-8
bentaylorband	1	4.5116206E-8
bentham	2	9.023241E-8
benthic	6	2.7069723E-7
benthos	1	4.5116206E-8
bentinck	2	9.023241E-8
bentley	19	8.572079E-7
bentleys	2	9.023241E-8
bento	5	2.2558103E-7
benton	31	1.3986024E-6
bentonite	1	4.5116206E-8
bentonville	1	4.5116206E-8
bentsen	30	1.3534863E-6
bentwich	1	4.5116206E-8
bentwood	1	4.5116206E-8
bentyl	2	9.023241E-8
benumbed	2	9.023241E-8
benvenuto	4	1.8046482E-7
benvin	1	4.5116206E-8
benyak	1	4.5116206E-8
benyamin	2	9.023241E-8
benz	79	3.5641804E-6
benz-y	1	4.5116206E-8
benzaldehyde	3	1.3534861E-7
benzamides	1	4.5116206E-8
benzamidine	3	1.3534861E-7
benzamido	2	9.023241E-8
benze	1	4.5116206E-8
benzedrine	1	4.5116206E-8
benzene	10	4.5116207E-7
benzene-free	1	4.5116206E-8
benzenedicarboxylic	2	9.023241E-8
benzenesulphonyl	1	4.5116206E-8
benzenoids	1	4.5116206E-8
benzes	4	1.8046482E-7
benzidine	2	9.023241E-8
benzimidazole	10	4.5116207E-7
benzimidazoles	1	4.5116206E-8
benzinger	2	9.023241E-8
benzion	2	9.023241E-8
benznidazole	1	4.5116206E-8
benzoate	7	3.1581345E-7
benzodiazepine	5	2.2558103E-7
benzodiazepine-like	1	4.5116206E-8
benzodiazepines	20	9.0232413E-7
benzodiazepins	1	4.5116206E-8
benzofurandiyl	2	9.023241E-8
benzoic	2	9.023241E-8
benzopyrene	1	4.5116206E-8
benzoquinone	1	4.5116206E-8
benzoyl	4	1.8046482E-7
benzyl	19	8.572079E-7
benzylisoquinoline	1	4.5116206E-8
benzylocarbonyl	2	9.023241E-8
benzyloxy	1	4.5116206E-8
benáki	3	1.3534861E-7
benét	5	2.2558103E-7
beofre	3	1.3534861E-7
beog	1	4.5116206E-8
beome	1	4.5116206E-8
beond	1	4.5116206E-8
beor	1	4.5116206E-8
beorma	1	4.5116206E-8
beothuk	1	4.5116206E-8
beow	1	4.5116206E-8
beowulf	54	2.436275E-6
bepko	6	2.7069723E-7
beppino	1	4.5116206E-8
beppu	4	1.8046482E-7
bepreventing	1	4.5116206E-8
bequeath	10	4.5116207E-7
bequeathable	1	4.5116206E-8
bequeathed	39	1.7595321E-6
bequeathing	3	1.3534861E-7
bequeaths	2	9.023241E-8
bequest	14	6.316269E-7
bequests	12	5.4139446E-7
ber	5	2.2558103E-7
ber-lin	1	4.5116206E-8
ber-pathway	1	4.5116206E-8
berach	1	4.5116206E-8
berahi	2	9.023241E-8
beranek	1	4.5116206E-8
berard	2	9.023241E-8
berate	8	3.6092965E-7
berated	18	8.1209174E-7
berater	1	4.5116206E-8
berates	22	9.925566E-7
berating	7	3.1581345E-7
berbar	1	4.5116206E-8
berber	30	1.3534863E-6
berberidaceae	2	9.023241E-8
berbers	9	4.0604587E-7
berbería	3	1.3534861E-7
berbie	1	4.5116206E-8
bercause	1	4.5116206E-8
berceuse	2	9.023241E-8
berchem	1	4.5116206E-8
bercht	2	9.023241E-8
berchtesgaden	2	9.023241E-8
berckheyde	1	4.5116206E-8
bercovitch	1	4.5116206E-8
bercow	1	4.5116206E-8
bercsi	1	4.5116206E-8
bercsényi	1	4.5116206E-8
bercy	4	1.8046482E-7
bere	1	4.5116206E-8
berea	1	4.5116206E-8
bereaved	13	5.865107E-7
bereavement	8	3.6092965E-7
bereaving	1	4.5116206E-8
bered	2	9.023241E-8
bereft	23	1.0376727E-6
beremban	1	4.5116206E-8
beren	1	4.5116206E-8
berendt	2	9.023241E-8
berendzen	1	4.5116206E-8
berenetz	1	4.5116206E-8
berenger	2	9.023241E-8
berenguer	4	1.8046482E-7
berenice	3	1.3534861E-7
berenson	19	8.572079E-7
berenstain	1	4.5116206E-8
berenstein	1	4.5116206E-8
beresford	5	2.2558103E-7
beresky	1	4.5116206E-8
berestovoi	5	2.2558103E-7
beret	24	1.0827889E-6
beret-clad	1	4.5116206E-8
beret-wearing	1	4.5116206E-8
berets	10	4.5116207E-7
beretta	5	2.2558103E-7
berezhkov	1	4.5116206E-8
berezhnaya	9	4.0604587E-7
berezov	1	4.5116206E-8
berezovski	1	4.5116206E-8
berezovsky	21	9.4744036E-7
berg	34	1.533951E-6
bergama	3	1.3534861E-7
bergamo	7	3.1581345E-7
bergamot	2	9.023241E-8
bergapten	2	9.023241E-8
bergdorf	10	4.5116207E-7
berge	2	9.023241E-8
bergelson	1	4.5116206E-8
bergen	43	1.939997E-6
bergenfield	2	9.023241E-8
berger	339	1.5294394E-5
bergerac	3	1.3534861E-7
bergere	1	4.5116206E-8
bergeron	8	3.6092965E-7
bergers	2	9.023241E-8
bergert	7	3.1581345E-7
berges	5	2.2558103E-7
berget	1	4.5116206E-8
berggruen	5	2.2558103E-7
berghahn	2	9.023241E-8
berghe	1	4.5116206E-8
bergisch	1	4.5116206E-8
berglund	1	4.5116206E-8
bergman	49	2.2106942E-6
bergmark	2	9.023241E-8
bergonzi	1	4.5116206E-8
bergquist	4	1.8046482E-7
bergroth	1	4.5116206E-8
bergson	1	4.5116206E-8
bergsrud	1	4.5116206E-8
bergstrom	1	4.5116206E-8
bergè	1	4.5116206E-8
bergères	5	2.2558103E-7
beria	1	4.5116206E-8
beribboned	2	9.023241E-8
beriberi	4	1.8046482E-7
berico	1	4.5116206E-8
bering	11	4.962783E-7
beringed	1	4.5116206E-8
beringer	1	4.5116206E-8
beringia	2	9.023241E-8
beringian	2	9.023241E-8
berio	16	7.218593E-7
berium	1	4.5116206E-8
berjillion	3	1.3534861E-7
berk	2	9.023241E-8
berke	6	2.7069723E-7
berkeleian	1	4.5116206E-8
berkeley	260	1.1730213E-5
berkeley-based	1	4.5116206E-8
berkeley-ish	1	4.5116206E-8
berkeleyan	2	9.023241E-8
berkeleyite	1	4.5116206E-8
berkelium	2	9.023241E-8
berkey	2	9.023241E-8
berklee	7	3.1581345E-7
berkley	10	4.5116207E-7
berkman	74	3.3385993E-6
berkner	1	4.5116206E-8
berkoh	1	4.5116206E-8
berkow	3	1.3534861E-7
berkowitz	13	5.865107E-7
berks	1	4.5116206E-8
berkshire	39	1.7595321E-6
berkshires	12	5.4139446E-7
berky	1	4.5116206E-8
berl	4	1.8046482E-7
berla	1	4.5116206E-8
berlage	1	4.5116206E-8
berland	3	1.3534861E-7
berlaymont	4	1.8046482E-7
berle	6	2.7069723E-7
berlenga	1	4.5116206E-8
berlex	2	9.023241E-8
berlin	417	1.8813458E-5
berlin-based	2	9.023241E-8
berlin-born	1	4.5116206E-8
berlin-style	1	4.5116206E-8
berlind	2	9.023241E-8
berliner	16	7.218593E-7
berliners	18	8.1209174E-7
berling	1	4.5116206E-8
berliniana	1	4.5116206E-8
berlioz	8	3.6092965E-7
berlitz	9	4.0604587E-7
berlot	1	4.5116206E-8
berlusco	1	4.5116206E-8
berlusconi	2	9.023241E-8
berlyne	1	4.5116206E-8
berm	1	4.5116206E-8
berman	68	3.067902E-6
bermans	1	4.5116206E-8
bermingham	2	9.023241E-8
berms	1	4.5116206E-8
bermuda	315	1.4211605E-5
bermuda-registered	2	9.023241E-8
bermudafestival	1	4.5116206E-8
bermudajazz	1	4.5116206E-8
bermudian	19	8.572079E-7
bermudiana	2	9.023241E-8
bermudians	7	3.1581345E-7
bermúdez	1	4.5116206E-8
bern	8	3.6092965E-7
bernacchi	1	4.5116206E-8
bernadeane	1	4.5116206E-8
bernadette	16	7.218593E-7
bernadine	2	9.023241E-8
bernadino	1	4.5116206E-8
bernai	1	4.5116206E-8
bernaise	1	4.5116206E-8
bernal	4	1.8046482E-7
bernalillo	1	4.5116206E-8
bernall	9	4.0604587E-7
bernalls	1	4.5116206E-8
bernard	202	9.113473E-6
bernarda	10	4.5116207E-7
bernardes	1	4.5116206E-8
bernardi	3	1.3534861E-7
bernardin	18	8.1209174E-7
bernardino	31	1.3986024E-6
bernardo	13	5.865107E-7
bernards	3	1.3534861E-7
bernardus	1	4.5116206E-8
bernasconi	1	4.5116206E-8
bernat	1	4.5116206E-8
bernays	8	3.6092965E-7
bernaza	1	4.5116206E-8
bernbach	4	1.8046482E-7
bernd	3	1.3534861E-7
berndt	1	4.5116206E-8
berne	3	1.3534861E-7
bernee	1	4.5116206E-8
berner	3	1.3534861E-7
berners	2	9.023241E-8
bernese	2	9.023241E-8
bernet	1	4.5116206E-8
bernhard	15	6.767431E-7
bernhardt	6	2.7069723E-7
bernheim	4	1.8046482E-7
bernheimer	2	9.023241E-8
bernia	1	4.5116206E-8
bernic	2	9.023241E-8
bernice	4	1.8046482E-7
bernick	1	4.5116206E-8
bernie	54	2.436275E-6
bernieres	1	4.5116206E-8
bernina	1	4.5116206E-8
berning	1	4.5116206E-8
bernini	25	1.1279052E-6
bernières	2	9.023241E-8
bernoff	3	1.3534861E-7
bernoulli	20	9.0232413E-7
bernoulli-based	1	4.5116206E-8
bernow	2	9.023241E-8
bernreid	1	4.5116206E-8
berns	3	1.3534861E-7
bernsen	1	4.5116206E-8
bernson	1	4.5116206E-8
bernstein	163	7.353942E-6
bernsteins	1	4.5116206E-8
bernt	1	4.5116206E-8
bernton	3	1.3534861E-7
bernuy	1	4.5116206E-8
bero	2	9.023241E-8
berobed	1	4.5116206E-8
berquist	1	4.5116206E-8
berr-a	1	4.5116206E-8
berra	12	5.4139446E-7
berrazales	1	4.5116206E-8
berreby	1	4.5116206E-8
berrey	1	4.5116206E-8
berri	2	9.023241E-8
berridale	1	4.5116206E-8
berridge	1	4.5116206E-8
berried	2	9.023241E-8
berrier	1	4.5116206E-8
berries	38	1.7144158E-6
berrigan	1	4.5116206E-8
berris	44	1.9851132E-6
berrruga	1	4.5116206E-8
berruga	3	1.3534861E-7
berruguete	2	9.023241E-8
berry	107	4.827434E-6
berry-based	1	4.5116206E-8
berry-flavored	1	4.5116206E-8
berry-laden	2	9.023241E-8
berryhill	6	2.7069723E-7
berryman	3	1.3534861E-7
bers	1	4.5116206E-8
bersani	1	4.5116206E-8
berserk	18	8.1209174E-7
berserker	1	4.5116206E-8
bershad	1	4.5116206E-8
bershtel	2	9.023241E-8
berson	4	1.8046482E-7
bert	29	1.30837E-6
bertam	1	4.5116206E-8
bertani	7	3.1581345E-7
bertapelle	2	9.023241E-8
bertelsmann	119	5.3688286E-6
bertelsmann-assess	1	4.5116206E-8
berten	1	4.5116206E-8
berth	23	1.0376727E-6
bertha	16	7.218593E-7
berthe	2	9.023241E-8
berthed	1	4.5116206E-8
berthel	1	4.5116206E-8
berthelemy	2	9.023241E-8
berthelot	4	1.8046482E-7
berthillon	1	4.5116206E-8
berthing	1	4.5116206E-8
berthold	4	1.8046482E-7
berths	5	2.2558103E-7
berthélémy	2	9.023241E-8
berti	1	4.5116206E-8
bertie	8	3.6092965E-7
bertil	1	4.5116206E-8
bertinelli	4	1.8046482E-7
bertini	3	1.3534861E-7
bertiz	5	2.2558103E-7
bertodano	1	4.5116206E-8
bertogliati	16	7.218593E-7
bertold	1	4.5116206E-8
bertolgliati	1	4.5116206E-8
bertolli	1	4.5116206E-8
bertolotti	1	4.5116206E-8
bertolt	5	2.2558103E-7
bertolucci	7	3.1581345E-7
berton	1	4.5116206E-8
bertram	6	2.7069723E-7
bertrand	28	1.2632538E-6
bertrand-de	1	4.5116206E-8
bertrille	2	9.023241E-8
bertsch	1	4.5116206E-8
bertschy	2	9.023241E-8
bertucci	4	1.8046482E-7
berube	2	9.023241E-8
berugged	1	4.5116206E-8
berv	1	4.5116206E-8
berven	1	4.5116206E-8
berwick	3	1.3534861E-7
berwickshire	1	4.5116206E-8
berwitch	1	4.5116206E-8
berwyn	1	4.5116206E-8
bery	1	4.5116206E-8
beryl	3	1.3534861E-7
beryllina	12	5.4139446E-7
berzelius	2	9.023241E-8
berzerk	1	4.5116206E-8
berzerker	1	4.5116206E-8
berzinitski	2	9.023241E-8
berzé-la	1	4.5116206E-8
berühmte	1	4.5116206E-8
bes	8	3.6092965E-7
besakih	4	1.8046482E-7
besancon	4	1.8046482E-7
besançon	2	9.023241E-8
besar	20	9.0232413E-7
besatisfied	1	4.5116206E-8
beschloss	6	2.7069723E-7
beschloss-in-waiting	1	4.5116206E-8
beseech	3	1.3534861E-7
beseeched	6	2.7069723E-7
beseeches	1	4.5116206E-8
beseeching	2	9.023241E-8
beseechingly	1	4.5116206E-8
besen	1	4.5116206E-8
beserah	2	9.023241E-8
beserk	2	9.023241E-8
beset	31	1.3986024E-6
besetting	3	1.3534861E-7
besfort	1	4.5116206E-8
besharov	16	7.218593E-7
beshitting	1	4.5116206E-8
besi	1	4.5116206E-8
beside	331	1.4933465E-5
besides	972	4.3852953E-5
besiege	1	4.5116206E-8
besieged	44	1.9851132E-6
besiegers	2	9.023241E-8
besieging	1	4.5116206E-8
besitzer	1	4.5116206E-8
besmirch	2	9.023241E-8
besmirched	2	9.023241E-8
besmirching	2	9.023241E-8
besnik	1	4.5116206E-8
beso	1	4.5116206E-8
besotted	10	4.5116207E-7
bespangled	1	4.5116206E-8
bespeak	4	1.8046482E-7
bespeaking	2	9.023241E-8
bespeaks	11	4.962783E-7
bespecified	1	4.5116206E-8
bespectacled	9	4.0604587E-7
bespelled	2	9.023241E-8
bespin	1	4.5116206E-8
bespoil	1	4.5116206E-8
bespoke	2	9.023241E-8
bess	21	9.4744036E-7
bessborough	1	4.5116206E-8
bessel	4	1.8046482E-7
bessemer	1	4.5116206E-8
besser	12	5.4139446E-7
besses	1	4.5116206E-8
bessette	20	9.0232413E-7
bessey	1	4.5116206E-8
bessie	12	5.4139446E-7
besson	8	3.6092965E-7
bessonette	7	3.1581345E-7
bessy	3	1.3534861E-7
best	8563	3.8633007E-4
best-actress	1	4.5116206E-8
best-adjusted	1	4.5116206E-8
best-attended	1	4.5116206E-8
best-audited	1	4.5116206E-8
best-ball	1	4.5116206E-8
best-beloved	1	4.5116206E-8
best-case	8	3.6092965E-7
best-characterized	3	1.3534861E-7
best-complexioned	1	4.5116206E-8
best-connected	3	1.3534861E-7
best-designed	1	4.5116206E-8
best-developed	1	4.5116206E-8
best-dressed	3	1.3534861E-7
best-edited	1	4.5116206E-8
best-educated	2	9.023241E-8
best-equipped	2	9.023241E-8
best-est	1	4.5116206E-8
best-ever	3	1.3534861E-7
best-film	1	4.5116206E-8
best-fit	4	1.8046482E-7
best-fitting	1	4.5116206E-8
best-flacked	1	4.5116206E-8
best-forgotten	1	4.5116206E-8
best-friend	3	1.3534861E-7
best-friendliness	1	4.5116206E-8
best-friendly	1	4.5116206E-8
best-funded	1	4.5116206E-8
best-groomed	1	4.5116206E-8
best-guess	1	4.5116206E-8
best-in	1	4.5116206E-8
best-informed	2	9.023241E-8
best-interest-of-baseball	1	4.5116206E-8
best-kept	6	2.7069723E-7
best-known	106	4.782318E-6
best-laid	1	4.5116206E-8
best-liked	2	9.023241E-8
best-looking	2	9.023241E-8
best-loved	9	4.0604587E-7
best-made	1	4.5116206E-8
best-maintained	1	4.5116206E-8
best-managed	1	4.5116206E-8
best-marketed	1	4.5116206E-8
best-minus	1	4.5116206E-8
best-moments	1	4.5116206E-8
best-movie	1	4.5116206E-8
best-of	11	4.962783E-7
best-of-all-possible-worlds	1	4.5116206E-8
best-of-breed	1	4.5116206E-8
best-of-century	1	4.5116206E-8
best-of-five	1	4.5116206E-8
best-of-seven	1	4.5116206E-8
best-of-the-year	1	4.5116206E-8
best-off	1	4.5116206E-8
best-ofs	1	4.5116206E-8
best-paying	1	4.5116206E-8
best-performing	3	1.3534861E-7
best-picture	3	1.3534861E-7
best-pitched	1	4.5116206E-8
best-played	1	4.5116206E-8
best-practice	2	9.023241E-8
best-preserved	10	4.5116207E-7
best-remunerated	1	4.5116206E-8
best-reported	1	4.5116206E-8
best-repressed	1	4.5116206E-8
best-reputed	1	4.5116206E-8
best-run	2	9.023241E-8
best-scoring	1	4.5116206E-8
best-seller	51	2.3009266E-6
best-sellers	1	4.5116206E-8
best-selling	119	5.3688286E-6
best-smelling	1	4.5116206E-8
best-so-far	3	1.3534861E-7
best-sounding	2	9.023241E-8
best-spent	1	4.5116206E-8
best-stealer	1	4.5116206E-8
best-studied	2	9.023241E-8
best-thought-of	1	4.5116206E-8
best-understood	1	4.5116206E-8
best-written	3	1.3534861E-7
bestatin	2	9.023241E-8
bested	8	3.6092965E-7
bestemmiare	1	4.5116206E-8
bestest	27	1.2181375E-6
bestfares	4	1.8046482E-7
bestfit	1	4.5116206E-8
bestfoods	2	9.023241E-8
bestfriend	2	9.023241E-8
besthesda	1	4.5116206E-8
bestial	4	1.8046482E-7
bestiality	14	6.316269E-7
bestiaries	1	4.5116206E-8
bestiary	4	1.8046482E-7
besting	3	1.3534861E-7
bestinn	1	4.5116206E-8
bestness	2	9.023241E-8
bestow	17	7.669755E-7
bestowed	31	1.3986024E-6
bestowing	6	2.7069723E-7
bestows	7	3.1581345E-7
bestprac	1	4.5116206E-8
bestpractice	1	4.5116206E-8
bestpracticesforreviewingfacilitydesigns	1	4.5116206E-8
bestridden	1	4.5116206E-8
bestride	1	4.5116206E-8
bestrides	1	4.5116206E-8
bestriding	1	4.5116206E-8
bestrode	1	4.5116206E-8
bests	4	1.8046482E-7
bestseller	23	1.0376727E-6
bestsellers	9	4.0604587E-7
bestselling	3	1.3534861E-7
bestsolutions	1	4.5116206E-8
bestwestern	1	4.5116206E-8
besty	2	9.023241E-8
besugosea	1	4.5116206E-8
besupported	1	4.5116206E-8
besut	2	9.023241E-8
bet	1239	5.589898E-5
beta	292	1.31739325E-5
beta-actin	2	9.023241E-8
beta-adrenergic	15	6.767431E-7
beta-adrenoreceptors	1	4.5116206E-8
beta-agonists	1	4.5116206E-8
beta-amylase	1	4.5116206E-8
beta-amyloid	2	9.023241E-8
beta-amyrin	1	4.5116206E-8
beta-arrestin	1	4.5116206E-8
beta-barrel	1	4.5116206E-8
beta-binomial	4	1.8046482E-7
beta-blocker	8	3.6092965E-7
beta-blockers	20	9.0232413E-7
beta-branched	1	4.5116206E-8
beta-carbon	5	2.2558103E-7
beta-carbons	3	1.3534861E-7
beta-carboxyethyl	2	9.023241E-8
beta-carotene	9	4.0604587E-7
beta-catenin	13	5.865107E-7
beta-catenin-independent	2	9.023241E-8
beta-cell	5	2.2558103E-7
beta-cell-specific	1	4.5116206E-8
beta-chain	1	4.5116206E-8
beta-chemokines	1	4.5116206E-8
beta-copy	1	4.5116206E-8
beta-estradiol	1	4.5116206E-8
beta-galactosidase	7	3.1581345E-7
beta-glucosidase	1	4.5116206E-8
beta-glucuronidase	3	1.3534861E-7
beta-glycerophosphate	2	9.023241E-8
beta-hydrogen	10	4.5116207E-7
beta-hydrogens	1	4.5116206E-8
beta-interferon	1	4.5116206E-8
beta-lactam	2	9.023241E-8
beta-lactamases	1	4.5116206E-8
beta-mercaptoethanol	1	4.5116206E-8
beta-miacine	1	4.5116206E-8
beta-oxidation	1	4.5116206E-8
beta-pleated	1	4.5116206E-8
beta-propeller	1	4.5116206E-8
beta-secretase	1	4.5116206E-8
beta-sheet	1	4.5116206E-8
beta-strand	1	4.5116206E-8
beta-subunits	1	4.5116206E-8
beta-tachykinin	1	4.5116206E-8
beta-tubulin	4	1.8046482E-7
beta-turn	1	4.5116206E-8
beta-two	1	4.5116206E-8
betacarotine	1	4.5116206E-8
betacellulin	1	4.5116206E-8
betaine	6	2.7069723E-7
betaing	2	9.023241E-8
betake	1	4.5116206E-8
betaken	1	4.5116206E-8
betamax	2	9.023241E-8
betamercaptoethanol	1	4.5116206E-8
betancourt	1	4.5116206E-8
betancur	22	9.925566E-7
betancuria	4	1.8046482E-7
betancurt	2	9.023241E-8
betaprost	1	4.5116206E-8
betas	2	9.023241E-8
betaseron	1	4.5116206E-8
betcha	20	9.0232413E-7
betcherrygah	1	4.5116206E-8
betchya	2	9.023241E-8
betchyer	2	9.023241E-8
betel	3	1.3534861E-7
betel-chew	1	4.5116206E-8
betel-leaf	1	4.5116206E-8
betel-nut	1	4.5116206E-8
betelgeuse	7	3.1581345E-7
beth	257	1.1594865E-5
bethany	12	5.4139446E-7
bethel	2	9.023241E-8
bethelem	1	4.5116206E-8
bethesda	67	3.022786E-6
bethke	1	4.5116206E-8
bethlehem	76	3.4288316E-6
bethlehemite	1	4.5116206E-8
bethlehemites	1	4.5116206E-8
bethony	1	4.5116206E-8
bethpage	23	1.0376727E-6
bethphage	1	4.5116206E-8
bethroth	1	4.5116206E-8
bethulah	7	3.1581345E-7
bethune	9	4.0604587E-7
bethward	1	4.5116206E-8
bethyl	1	4.5116206E-8
beth­lehem	1	4.5116206E-8
beticked	1	4.5116206E-8
betide	2	9.023241E-8
betimes	2	9.023241E-8
betjeman	3	1.3534861E-7
betmoaned	1	4.5116206E-8
beto	8	3.6092965E-7
betoken	4	1.8046482E-7
betokened	2	9.023241E-8
betokening	1	4.5116206E-8
betokens	2	9.0232