'cause	'cause	IN	257
'd	'd	MD	11481
'd	'd	NNP	2166
'em	'em	PRP	586
'em	'em	NNP	15
'll	'll	MD	13866
'm	be	VBP	33489
'n	'n	NNP	20
'n'	'n'	CC	187
're	be	VBP	32626
's	's	POS	111857
's	's	PRP	677
's	's	NNP	71
's	be	VBZ	127676
't	't	NN	193
'til	'til	IN	22
've	have	VBP	22738
've	have	VB	778
-losing	-losing	UNC	1
1069	1069	NNP	17
727	727	NNP	34
?	?	NN	5149
?-?	?-?	JJ	20
?-?-?	?-?-?	JJ	2
?-actin	?-actin	JJ	99
?-actine	?-actine	JJ	1
?-actinin	?-actinin	JJ	18
?-active	?-active	JJ	1
?-adrenergic	?-adrenergic	JJ	9
?-adrenergic-receptor	?-adrenergic-receptor	JJ	1
?-adrenergicblockade	?-adrenergicblockade	JJ	1
?-adrenoceptor	?-adrenoceptor	JJ	6
?-agarase	?-agarase	JJ	1
?-agonist	?-agonist	JJ	1
?-amino	?-amino	JJ	10
?-aminoadipoyl	?-aminoadipoyl	JJ	1
?-aminobutyric	?-aminobutyric	JJ	1
?-aminoethyl	?-aminoethyl	JJ	1
?-aminoethylether	?-aminoethylether	JJ	1
?-amylase	?-amylase	JJ	2
?-amylase-like	?-amylase-like	JJ	1
?-amyloid	?-amyloid	JJ	2
?-arrestin	?-arrestin	JJ	2
?-barrel	?-barrel	JJ	21
?-barrel-like	?-barrel-like	JJ	1
?-barrels	?-barrels	JJ	2
?-binding	?-binding	JJ	3
?-blockade	?-blockade	JJ	4
?-blocker	?-blocker	JJ	15
?-blockeri	?-blockeri	JJ	1
?-blockers	?-blockers	JJ	5
?-blocking	?-blocking	JJ	3
?-box	?-box	JJ	19
?-branched	?-branched	JJ	3
?-bungarotoxin	?-bungarotoxin	JJ	6
?-carboxyl	?-carboxyl	JJ	2
?-carboxylate	?-carboxylate	JJ	1
?-carotene	?-carotene	JJ	3
?-catenin	?-catenin	JJ	123
?-catenin-mediated	?-catenin-mediated	JJ	2
?-cell	?-cell	JJ	22
?-cell-like	?-cell-like	JJ	1
?-cells	?-cells	JJ	51
?-chain	?-chain	JJ	3
?-chains-?	?-chains-?	JJ	1
?-chemokine	?-chemokine	JJ	1
?-cholestane	?-cholestane	JJ	1
?-chymotrypsin	?-chymotrypsin	JJ	1
?-cleavage	?-cleavage	JJ	1
?-coefficient	?-coefficient	JJ	1
?-configuration	?-configuration	JJ	2
?-counter	?-counter	JJ	2
?-cryptoxanthin	?-cryptoxanthin	JJ	2
?-ct	?-ct	JJ	3
?-cyclodextrin	?-cyclodextrin	JJ	2
?-d	?-d	JJ	2
?-defensins	?-defensins	JJ	1
?-dependent	?-dependent	JJ	3
?-dihydroprogesterone	?-dihydroprogesterone	JJ	1
?-dihydrotestosterone	?-dihydrotestosterone	JJ	2
?-dimethyl	?-dimethyl	JJ	3
?-diol	?-diol	JJ	3
?-distribution	?-distribution	JJ	3
?-dystrobrevin	?-dystrobrevin	JJ	2
?-dystrobrevin-interacting	?-dystrobrevin-interacting	JJ	1
?-elimination	?-elimination	JJ	1
?-endorphin	?-endorphin	JJ	15
?-estradiol	?-estradiol	JJ	25
?-factor	?-factor	JJ	2
?-factor-free	?-factor-free	JJ	1
?-fibrinogen	?-fibrinogen	JJ	7
?-fodrin	?-fodrin	JJ	1
?-fold	?-fold	JJ	1
?-gal	?-gal	JJ	16
?-galactosidase	?-galactosidase	JJ	95
?-galatosidase	?-galatosidase	JJ	1
?-globin	?-globin	JJ	16
?-glucuronidase	?-glucuronidase	JJ	12
?-glucuronide	?-glucuronide	JJ	1
?-glutamyl	?-glutamyl	JJ	1
?-glutamyl-?-amino-?	?-glutamyl-?-amino-?	JJ	1
?-glutamyl-meso-diaminopimelate	?-glutamyl-meso-diaminopimelate	JJ	2
?-glutamylcysteine	?-glutamylcysteine	JJ	1
?-glutamylcysteinylserine	?-glutamylcysteinylserine	JJ	1
?-glycero-phosphate	?-glycero-phosphate	JJ	1
?-glycerol	?-glycerol	JJ	2
?-glycerolphosphate	?-glycerolphosphate	JJ	2
?-glycerophosphate	?-glycerophosphate	JJ	10
?-goat	?-goat	JJ	1
?-grasp	?-grasp	JJ	4
?-gustducin	?-gustducin	JJ	19
?-hairpin	?-hairpin	JJ	5
?-hairpins	?-hairpins	JJ	1
?-helical	?-helical	JJ	20
?-helices	?-helices	JJ	11
?-helix	?-helix	JJ	27
?-hemolysin	?-hemolysin	JJ	1
?-hemolysis	?-hemolysis	JJ	8
?-hemolytic	?-hemolytic	JJ	17
?-human	?-human	JJ	1
?-hydroxy	?-hydroxy	JJ	4
?-hydroxyestrone	?-hydroxyestrone	JJ	1
?-hydroxylase	?-hydroxylase	JJ	2
?-hydroxylation	?-hydroxylation	JJ	1
?-hydroxysteroid	?-hydroxysteroid	JJ	6
?-independent	?-independent	JJ	5
?-induced	?-induced	JJ	2
?-innervation	?-innervation	JJ	2
?-isopropylmalate	?-isopropylmalate	JJ	1
?-isotype	?-isotype	JJ	1
?-ketobutyrate	?-ketobutyrate	JJ	3
?-ketoglutarate	?-ketoglutarate	JJ	8
?-lactam	?-lactam	JJ	19
?-lactamase	?-lactamase	JJ	9
?-lactamases	?-lactamases	JJ	9
?-lactams	?-lactams	JJ	2
?-like	?-like	JJ	2
?-linolenic	?-linolenic	JJ	5
?-mannosidase	?-mannosidase	JJ	1
?-meanders	?-meanders	JJ	2
?-melanocyte	?-melanocyte	JJ	1
?-mercaptoethanol	?-mercaptoethanol	JJ	30
?-methyl	?-methyl	JJ	1
?-mouse	?-mouse	JJ	1
?-neo	?-neo	JJ	1
?-nerve	?-nerve	JJ	1
?-nicotinamide	?-nicotinamide	JJ	1
?-octyl	?-octyl	JJ	2
?-opioid	?-opioid	JJ	41
?-opioid-mediated	?-opioid-mediated	JJ	2
?-opioids	?-opioids	JJ	5
?-oscillation	?-oscillation	JJ	1
?-oscillations	?-oscillations	JJ	2
?-oxidation	?-oxidation	JJ	10
?-p	?-p	JJ	1
?-pc	?-pc	JJ	1
?-phage	?-phage	JJ	1
?-phosphate	?-phosphate	JJ	14
?-phosphates	?-phosphates	JJ	1
?-phosphatidyl	?-phosphatidyl	JJ	1
?-phosphatidylcholine	?-phosphatidylcholine	JJ	1
?-phosphatidylethanolamine	?-phosphatidylethanolamine	JJ	1
?-phosphatidylinositol	?-phosphatidylinositol	JJ	2
?-phosphonate-group	?-phosphonate-group	JJ	1
?-phosphorothioate	?-phosphorothioate	JJ	2
?-progesterone	?-progesterone	JJ	1
?-propeller	?-propeller	JJ	1
?-protein	?-protein	JJ	1
?-proteobacteria	?-proteobacteria	JJ	34
?-proteobacterial	?-proteobacterial	JJ	3
?-proteobacterium	?-proteobacterium	JJ	5
?-rabbit	?-rabbit	JJ	1
?-receptor	?-receptor	JJ	1
?-reduced	?-reduced	JJ	1
?-reductase	?-reductase	JJ	3
?-replacement	?-replacement	JJ	1
?-responsive	?-responsive	JJ	1
?-rich	?-rich	JJ	3
?-sandwich	?-sandwich	JJ	3
?-sandwich-like	?-sandwich-like	JJ	1
?-scintillation	?-scintillation	JJ	6
?-secretase	?-secretase	JJ	30
?-secretase-cleaved	?-secretase-cleaved	JJ	1
?-secretase-mediated	?-secretase-mediated	JJ	3
?-secretase-type	?-secretase-type	JJ	2
?-secretases	?-secretases	JJ	1
?-secretion	?-secretion	JJ	1
?-selection	?-selection	JJ	1
?-sheet	?-sheet	JJ	13
?-sheets	?-sheets	JJ	2
?-signaling	?-signaling	JJ	1
?-site	?-site	JJ	3
?-sitosterol	?-sitosterol	JJ	1
?-smooth	?-smooth	JJ	6
?-specific	?-specific	JJ	1
?-squared	?-squared	JJ	2
?-stimulated	?-stimulated	JJ	5
?-strand	?-strand	JJ	4
?-strand-?-helix	?-strand-?-helix	JJ	1
?-strand-rich	?-strand-rich	JJ	3
?-strands	?-strands	JJ	18
?-structure	?-structure	JJ	3
?-subdivision	?-subdivision	JJ	2
?-subunit	?-subunit	JJ	15
?-subunits	?-subunits	JJ	11
?-synthase	?-synthase	JJ	1
?-synuclein	?-synuclein	JJ	32
?-synuclein-mediated	?-synuclein-mediated	JJ	1
?-thalassemia	?-thalassemia	JJ	3
?-thick	?-thick	JJ	1
?-thio	?-thio	JJ	1
?-thiophosphorylated	?-thiophosphorylated	JJ	1
?-thrombin	?-thrombin	JJ	1
?-thymosin	?-thymosin	JJ	2
?-tocopherol	?-tocopherol	JJ	4
?-toxin	?-toxin	JJ	1
?-transducin	?-transducin	JJ	1
?-trehalose	?-trehalose	JJ	1
?-tubulin	?-tubulin	JJ	97
?-tubulins	?-tubulins	JJ	1
?-turn	?-turn	JJ	2
?-type	?-type	JJ	9
??	??	NN	80
??-ct	??-ct	JJ	1
??-dependent	??-dependent	JJ	1
???	???	NN	1
???-proteobacterial	???-proteobacterial	JJ	1
?????	?????	NN	2
??????	??????	NN	1
??c	??c	NN	4
??ct	??ct	NN	4
??neo	??neo	NN	1
??pgk-neo	??pgk-neo	JJ	5
??tcr	??tcr	NN	3
?a	?a	NN	9
?a-crystallin	?a-crystallin	JJ	1
?aaand	?aaand	NN	1
?abc	?abc	NN	1
?acbetween	?acbetween	NN	1
?acrybp	?acrybp	NN	2
?actin	?actin	NN	1
?ade	?ade	NN	5
?age	?age	NN	1
?ailing	?ailing	VBG	1
?amboyant	?amboyant	NN	1
?amenco	?amenco	NN	1
?amingos	?amingos	NNS	1
?amp	?amp	NN	1
?ancé	?ancé	NN	3
?and	?and	NN	1
?anking	?anking	VBG	1
?apek	?apek	NN	2
?ar	?ar	NN	2
?ashcards	?ashcards	NNS	1
?at	?at	NN	2
?atoms	?atoms	NNS	1
?atter	?atter	NN	1
?b	?b	NN	22
?b-like	?b-like	JJ	3
?b?	?b?	NN	2
?bers	?bers	NNS	2
?bgt	?bgt	NN	2
?c	?c	NN	20
?can	?can	NN	1
?cat	?cat	NN	1
?cbf	?cbf	NN	11
?ccfor	?ccfor	NN	1
?cells	?cells	NNS	1
?chain	?chain	NN	1
?ci	?ci	NN	49
?crd	?crd	NN	2
?ct	?ct	NN	8
?ction	?ction	UNC	1
?ctional	?ctional	NN	1
?d	?d	NN	3
?dbf	?dbf	NN	1
?dere	?dere	NN	1
?dg	?dg	NN	2
?dht	?dht	NN	1
?di	?di	NN	2
?e	?e	NN	21
?ea-market	?ea-market	JJ	2
?ed	?ed	JJ	2
?edrr	?edrr	NN	2
?eld	?eld	NN	5
?elding	?elding	VBG	2
?elds	?elds	NNS	1
?erko	?erko	NN	7
?ew	?ew	NN	2
?exible	?exible	JJ	5
?exibly	?exibly	UNC	1
?extime	?extime	NN	1
?f	?f	NN	35
?farads	?farads	NNS	1
?fteen	?fteen	NN	1
?g	?g	NN	1680
?g-?h	?g-?h	JJ	1
?gdna	?gdna	NN	1
?geo	?geo	NN	2
?ghting	?ghting	VBG	1
?ghts	?ghts	NNS	1
?glucan	?glucan	NN	1
?gs	?gs	NNS	1
?gt	?gt	NN	4
?gure	?gure	NN	5
?gureheads	?gureheads	NNS	1
?gures	?gures	NNS	7
?h	?h	NN	4
?i	?i	NN	7
?in	?in	NN	1
?ir	?ir	NN	5
?itted	?itted	JJ	1
?j	?j	NN	10
?ja	?ja	NN	8
?k	?k	NN	2
?l	?l	NN	1369
?lac	?lac	NN	1
?lacz	?lacz	NN	5
?lc	?lc	NN	1
?lh	?lh	NN	14
?ll	?ll	NN	3
?llb?	?llb?	NN	1
?lled	?lled	JJ	6
?lling	?lling	VBG	2
?lls	?lls	NNS	1
?log	?log	NN	1
?loxpneo	?loxpneo	NN	5
?loxpneo-tk	?loxpneo-tk	JJ	1
?lrr	?lrr	NN	2
?lter	?lter	NN	1
?lw	?lw	NN	10
?lz	?lz	NN	5
?m	?m	NN	1407
?m-filtered	?m-filtered	JJ	1
?m-thick	?m-thick	JJ	1
?mhc	?mhc	NN	4
?mhc-lacz	?mhc-lacz	JJ	2
?mhclacz	?mhclacz	NN	2
?mol	?mol	NN	40
?mole	?mole	NN	4
?moles	?moles	NNS	2
?most	?most	NN	1
?mtv-ir-cat	?mtv-ir-cat	JJ	2
?n	?n	NN	52
?n-de-siècle	?n-de-siècle	JJ	1
?n-snip	?n-snip	JJ	1
?nal	?nal	NN	5
?nally	?nally	RB	10
?nancial	?nancial	NN	4
?nancially	?nancially	RB	2
?nd	?nd	NN	44
?nding	?nding	VBG	7
?ndings	?ndings	NNS	13
?nds	?nds	NNS	2
?ne	?ne	NN	15
?ne-tuned	?ne-tuned	JJ	1
?nest	?nest	NN	10
?nger	?nger	NN	2
?nish	?nish	NN	3
?nished	?nished	JJ	4
?nishing	?nishing	VBG	2
?nls-far	?nls-far	JJ	1
?od	?od	NN	1
?ogg	?ogg	NN	2
?ood	?ood	NN	1
?oodlit	?oodlit	NN	1
?oor	?oor	NN	4
?oorshows	?oorshows	NNS	1
?or	?or	NN	2
?orf	?orf	NN	1
?oundering	?oundering	VBG	1
?ourish	?ourish	NN	1
?ourished	?ourished	JJ	2
?ourishes	?ourishes	NNS	2
?ow	?ow	NN	1
?owers	?owers	NNS	2
?ows	?ows	NNS	1
?p	?p	NN	4
?pd	?pd	NN	2
?pgk	?pgk	NN	1
?pk	?pk	NN	2
?pop	?pop	NN	4
?pre	?pre	NN	18
?pv	?pv	NN	1
?q	?q	NN	1
?r	?r	NN	3
?rare	?rare	NN	3
?rare-tk-luc	?rare-tk-luc	JJ	1
?re	?re	NN	3
?ring	?ring	NN	1
?ringwas	?ringwas	NNS	1
?rm	?rm	NN	9
?rmly	?rmly	RB	4
?rmness	?rmness	NNS	1
?routine	?routine	NN	2
?rst	?rst	NN	78
?rst-borns	?rst-borns	JJ	1
?rst-class	?rst-class	JJ	2
?rst-grade	?rst-grade	JJ	1
?rst-time	?rst-time	JJ	1
?rstborn	?rstborn	NN	1
?rsthand	?rsthand	NN	1
?s	?s	NNS	13
?s	?s	NN	2
?s?	?s?	NN	2
?sec	?sec	NN	3
?self-preservation-minded	?self-preservation-minded	JJ	1
?sh	?sh	NN	4
?shermen	?shermen	NN	1
?shes	?shes	NNS	1
?shing	?shing	VBG	3
?sini-?pwäwa	?sini-?pwäwa	JJ	1
?sland	?sland	NN	1
?slt	?slt	NN	1
?t	?t	NN	12
?tpr	?tpr	NN	1
?tpr-pfpp	?tpr-pfpp	JJ	7
?trcp	?trcp	NN	1
?triplex	?triplex	NN	3
?ts	?ts	NNS	2
?u	?u	NN	4
?uctuated	?uctuated	JJ	1
?v	?v	NN	1
?v?	?v?	NN	7
?ve	?ve	NN	2
?x	?x	NN	1
?xed	?xed	JJ	2
?xing	?xing	VBG	1
?xj	?xj	NN	2
?y	?y	NN	5
?ying	?ying	VBG	1
?yj	?yj	NN	4
?yover	?yover	NN	2
?í?o?	?í?o?	NN	1
a	a	DT	490433
a	a	UNC	1048
a	a	NNP	847
a	a	NN	237
a	a	SYM	97
a	a	JJ	7
a-a	a-a	JJ	2
a-a	a-a	NNP	1
a-a-c	a-a-c	NNP	9
a-abaker	a-abaker	JJ	1
a-adrenoceptor	a-adrenoceptor	JJ	1
a-alternate	a-alternate	JJ	1
a-ank-fgf	a-ank-fgf	NNP	1
a-atp	a-atp	NNP	24
a-b	a-b	NNP	16
a-b-b-bye-bye	a-b-b-bye-bye	JJ	1
a-b-c	a-b-c	NNP	5
a-b-c-d	a-b-c-d	NNP	1
a-b-x-y	a-b-x-y	NNP	1
a-babble	a-babble	JJ	1
a-barrel	a-barrel	JJ	1
a-bed	a-bed	JJ	1
a-bigger	a-bigger	JJ	1
a-brewin	a-brewin	JJ	2
a-brewing	a-brewing	JJ	1
a-bustin	a-bustin	JJ	1
a-c	a-c	NNP	19
a-c	a-c	JJ	2
a-c-c	a-c-c	NNP	9
a-c-p	a-c-p	NNP	5
a-c-t	a-c-t	NNP	1
a-c-t-h	a-c-t-h	NNP	7
a-callin	a-callin	JJ	1
a-calling	a-calling	JJ	1
a-cand	a-cand	JJ	1
a-cappella	a-cappella	JJ	1
a-changin	a-changin	JJ	1
a-child	a-child	JJ	2
a-cockbill	a-cockbill	JJ	1
a-comin	a-comin	JJ	1
a-cut	a-cut	JJ	1
a-d	a-d	NNP	10
a-d	a-d	JJ	6
a-d-d	a-d-d	NNP	1
a-d-h	a-d-h	NNP	1
a-d-p	a-d-p	NNP	8
a-day	a-day	JJ	2
a-derived	a-derived	JJ	2
a-diaza-s-indacine	a-diaza-s-indacine	JJ	1
a-dna	a-dna	NNP	3
a-duplicate	a-duplicate	JJ	1
a-e	a-e	NNP	5
a-f	a-f	NNP	6
a-f-s	a-f	NNP	1
a-factor	a-factor	JJ	1
a-feared	a-feared	JJ	1
a-flutter	a-flutter	JJ	1
a-g	a-g	NNP	5
a-general	a-general	NNP	1
a-glimmering	a-glimmering	JJ	1
a-gonna	a-gonna	JJ	2
a-got	a-got	JJ	1
a-gvhd	a-gvhd	NNP	53
a-h	a-h	NNP	7
a-h	a-h	JJ	3
a-ha	a-ha	JJ	2
a-hehm	a-hehm	JJ	1
a-hem	a-hem	NNP	1
a-hem	a-hem	JJ	1
a-ho	a-ho	JJ	1
a-hp	a-hp	JJ	1
a-i	a-i	JJ	2
a-i	a-us	NNP	1
a-join-ed	a-join-ed	JJ	1
a-k	a-k	NNP	1
a-kan	a-kan	JJ	1
a-l	a-l	NNP	5
a-l-b	a-l-b	NNP	1
a-l-s	a-l	NNP	1
a-leaping	a-leaping	JJ	1
a-line	a-line	JJ	2
a-list	a-list	JJ	3
a-loo-min-um-foil	a-loo-min-um-foil	JJ	1
a-love	a-love	JJ	1
a-lovin	a-lovin	JJ	1
a-lu-min-i-um	a-lu-min-i-um	JJ	1
a-lying	a-lying	JJ	1
a-m	a-m	NNP	12
a-m-a	a-m-a	NNP	1
a-mazing	a-mazing	JJ	1
a-me	a-me	JJ	1
a-million-to-one	a-million-to-one	JJ	1
a-minus	a-minus	NNP	1
a-month	a-month	JJ	4
a-month-for-domestic-help	a-month-for-domestic-help	JJ	1
a-more	a-more	JJ	1
a-myc	a-myc	JJ	6
a-n	a-n	NNP	4
a-n	a-n	JJ	2
a-n-a	a-n-a	NNP	1
a-n-p	a-n-p	NNP	1
a-night	a-night	JJ	5
a-not	a-not	JJ	2
a-nt	a-nt	NNP	2
a-ny	a-ny	NNP	106
a-ok	a-ok	NNP	8
a-p	a-p	NNP	35
a-p-a	a-p-a	NNP	3
a-person	a-person	JJ	2
a-phorbol	a-phorbol	JJ	2
a-pinin	a-pinin	JJ	1
a-plate	a-plate	JJ	5
a-plinkin	a-plinkin	JJ	1
a-r	a-r	NNP	5
a-r-b-d	a-r-b-d	NNP	1
a-r-i	a-r-us	NNP	2
a-rattling	a-rattling	JJ	1
a-really-bad-cold-where-you-say-it	a-really-bad-cold-where-you-say-it	JJ	1
a-religiousness	a-religiousness	JJ	1
a-rockin	a-rockin	JJ	1
a-rod-style	a-rod-style	NNP	1
a-rollin	a-rollin	JJ	1
a-s	a	NNP	17
a-s-d	a-s-d	NNP	2
a-s-i-m-o-v	a-s-i-m-o-v	NNP	1
a-share	a-share	JJ	1
a-side	a-side	JJ	4
a-side	a-side	NNP	1
a-swabbin	a-swabbin	JJ	1
a-t	a-t	NNP	8
a-t-p	a-t-p	NNP	45
a-team	a-team	NNP	1
a-ticking	a-ticking	JJ	1
a-titter	a-titter	JJ	1
a-turning	a-turning	JJ	1
a-typical	a-typical	JJ	1
a-u	a-u	JJ	1
a-u	a-u	NNP	1
a-v	a-v	NNP	1
a-w	a-w	NNP	1
a-wailing	a-wailing	JJ	1
a-way	a-way	JJ	1
a-week	a-week	JJ	2
a-well	a-well	JJ	1
a-workin	a-workin	JJ	1
a-wt	a-wt	NNP	1
a-y	a-y	NNP	4
a-yard	a-yard	JJ	1
a-yeah	a-yeah	JJ	1
a-year	a-year	JJ	11
a-yup	a-yup	JJ	1
a-z	a-z	NNP	14
a-z-t	a-z-t	NNP	3
a?	a?	NNP	23
a?eld	a?eld	NN	1
aa	aa	NN	382
aa	aa	NNP	60
aa-amino	aa-amino	NNP	1
aa-binding	aa-binding	NNP	6
aa-d	aa-d	JJ	3
aa-enriched	aa-enriched	NNP	1
aa-raxpé-ahu	aa-raxpé-ahu	JJ	1
aa-rich	aa-rich	NNP	1
aa-tttt	aa-tttt	NNP	2
aaa	aaa	NNP	187
aaa-domain	aaa-domain	NNP	3
aaaa	aaaa	NNP	2
aaaaa	aaaaa	NNP	1
aaaaa	aaaaa	NN	1
aaaaaa	aaaaaa	NNP	3
aaaaaaa	aaaaaaa	NNP	1
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa	aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa	NNP	1
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaah	aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaah	NNP	1
aaaaaaaaaaare	aaaaaaaaaaare	NN	1
aaaaaaaagh	aaaaaaaagh	NNP	1
aaaaaaaahahahahahahaha	aaaaaaaahahahahahahaha	NNP	1
aaaaaaaccent	aaaaaaaccent	NN	2
aaaaaaadddaaammmmmm	aaaaaaadddaaammmmmm	NNP	1
aaaaaaagh	aaaaaaagh	NNP	1
aaaaaaahh	aaaaaaahh	NNP	1
aaaaaaand	aaaaaaand	NN	1
aaaaaagh	aaaaaagh	NNP	2
aaaaaah	aaaaaah	NN	2
aaaaaah	aaaaaah	NNP	1
aaaaaahhh	aaaaaahhh	NNP	1
aaaaaannnnnd	aaaaaannnnnd	NNP	1
aaaaaarrrrrgh	aaaaaarrrrrgh	NNP	1
aaaaaggghhh	aaaaaggghhh	NNP	1
aaaaaghhh	aaaaaghhh	NNP	1
aaaaahhh	aaaaahhh	NNP	1
aaaaahhhhhh	aaaaahhhhhh	NNP	1
aaaaand	aaaaand	NNP	1
aaaaargh	aaaaargh	NNP	1
aaaaauuughhh	aaaaauuughhh	NNP	1
aaaaaw	aaaaaw	NNP	1
aaaacacaacgaaacctg	aaaacacaacgaaacctg	NNP	1
aaaaccccaaaa	aaaaccccaaaa	NNP	1
aaaach	aaaach	NNP	1
aaaack	aaaack	NNP	1
aaaactgcagcggccgccaccatgcaccac-caccacaccaccaccacgtgagcaagggcgaggagctgttcaccg	aaaactgcagcggccgccaccatgcaccac-caccacaccaccaccacgtgagcaagggcgaggagctgttcaccg	NNP	1
aaaagaaaaaa	aaaagaaaaaa	NNP	1
aaaagataaag	aaaagataaag	NNP	1
aaaagcggccgcgagtggggggcggcggcc	aaaagcggccgcgagtggggggcggcggcc	NNP	1
aaaagcttcttgaaaggagacttctgt	aaaagcttcttgaaaggagacttctgt	NNP	1
aaaaggtgggcctgaggttca	aaaaggtgggcctgaggttca	NNP	1
aaaagh	aaaagh	NNP	2
aaaagh	aaaagh	NN	1
aaaagtcgacgcgcccagcagcgagaccgc	aaaagtcgacgcgcccagcagcgagaccgc	NNP	1
aaaah	aaaah	NNP	3
aaaahh	aaaahh	NNP	1
aaaahhh	aaaahhh	NNP	1
aaaan-ist	aaaan-ist	NNP	2
aaaand	aaaand	NNP	2
aaaargghhh	aaaargghhh	NNP	1
aaaargh	aaaargh	NNP	1
aaaargh	aaaargh	NN	1
aaaarrgh	aaaarrgh	NN	1
aaaarrrrrggghhhhh	aaaarrrrrggghhhhh	NNP	1
aaaawwww	aaaawwww	NNP	1
aaaawwwwww	aaaawwwwww	NNP	1
aaab	aaab	NNP	2
aaabs	aaab	NNP	1
aaacaggattttcgcctgctggg	aaacaggattttcgcctgctggg	NNP	2
aaaccatctcactcgcatga	aaaccatctcactcgcatga	NNP	1
aaaccent	aaaccent	NN	1
aaacgacggccagtgaattgtaatacgactcactataggcgc	aaacgacggccagtgaattgtaatacgactcactataggcgc	NNP	1
aaacgacggccagtgaattgtaatacgactcactataggg	aaacgacggccagtgaattgtaatacgactcactataggg	NNP	1
aaactgtacttgttatcaggat	aaactgtacttgttatcaggat	NNP	1
aaactgtgg	aaactgtgg	NNP	1
aaag	aaag	NNP	1
aaaggaccccacgaagtgtt	aaaggaccccacgaagtgtt	NNP	1
aaagh	aaagh	NNP	2
aaah	aaah	NNP	1
aaah	aaah	NN	1
aaahh	aaahh	NNP	1
aaahhhh	aaahhhh	NNP	1
aaahing	aaah	VBG	1
aaaieeeooh	aaaieeeooh	NNP	1
aaaieeeoooh	aaaieeeoooh	NNP	1
aaaiiggghhh	aaaiiggghhh	NNP	1
aaaiiiieeeee	aaaiiiieeeee	NNP	1
aaalac	aaalac	NNP	1
aaand	aaand	NN	1
aaand	aaand	NNP	1
aaargh	aaargh	NNP	9
aaarrgghhh	aaarrgghhh	NNP	1
aaarrgh	aaarrgh	NNP	1
aaarrrggghhh	aaarrrggghhh	NNP	1
aaarrrrrgggggghhhhh	aaarrrrrgggggghhhhh	NN	1
aaat	aaat	NNP	2
aaataaat	aaataaat	NNP	1
aaatctcaat	aaatctcaat	NNP	1
aaatgcagttgttactgtccctg	aaatgcagttgttactgtccctg	NNP	1
aaatgcatctgcgagggc	aaatgcatctgcgagggc	NNP	1
aaawwwww	aaawwwww	NNP	1
aab	aab	NNP	2
aab	aab	NN	1
aabb	aabb	NNP	5
aabb	aabb	NN	2
aac	aac	NNP	41
aac	aac	NN	1
aaca	aaca	NNP	4
aacacagtgagacgctgtct	aacacagtgagacgctgtct	NNP	1
aacc	aacc	NN	3
aaccaa	aaccaa	NNP	1
aaccatgcaggtacagtc	aaccatgcaggtacagtc	NNP	1
aacccacatgttcacggcgga	aacccacatgttcacggcgga	NNP	1
aacctcctct	aacctcctct	NNP	1
aacctctccattcagc	aacctctccattcagc	NNP	1
aacgggaagcccatcacc	aacgggaagcccatcacc	NNP	1
aachen	aachen	NNP	7
aack	aack	NNP	1
aactagatgtagaagtcgttcatggattc	aactagatgtagaagtcgttcatggattc	NNP	1
aad	aad	NNP	13
aadntp	aadntp	NN	1
aadutp	aadutp	NN	2
aae	aa	NNP	1
aaf	aaf	NNP	5
aafp	aafp	NN	1
aag	aag	NNP	15
aag-gtggtaaaccagggggatc	aag-gtggtaaaccagggggatc	NNP	1
aagaattcaaactggggcct	aagaattcaaactggggcct	NNP	1
aagagtagctgctcaccgtgtacaag	aagagtagctgctcaccgtgtacaag	NN	1
aagcagtggtaacaacgc	aagcagtggtaacaacgc	NNP	1
aagcagtggtaacaacgcagagtacgcggg	aagcagtggtaacaacgcagagtacgcggg	NNP	1
aagcagtggtatcaacgcagagtacgcggg	aagcagtggtatcaacgcagagtacgcggg	NNP	1
aagccctctgaacagtgtcccatcccaagt	aagccctctgaacagtgtcccatcccaagt	NNP	1
aagccgggaaggatctgtat	aagccgggaaggatctgtat	NNP	1
aagcctgaccacgctttcta	aagcctgaccacgctttcta	NNP	1
aagctt	aagctt	NNP	1
aagg	aagg	NNP	1
aaggagtgcggggaggag	aaggagtgcggggaggag	NNP	1
aaggghhh	aaggghhh	NNP	1
aaggtcaaaattcaacagctgcttgtacagctcgtccatgcc	aaggtcaaaattcaacagctgcttgtacagctcgtccatgcc	NNP	1
aaggtcaaaattcaacagctgggtgggtgctaatcctaatggttc	aaggtcaaaattcaacagctgggtgggtgctaatcctaatggttc	NNP	1
aaggtgcggagcaaaat	aaggtgcggagcaaaat	NNP	1
aagh	aagh	NN	1
aah	aah	NNP	4
aah	aah	NN	3
aahed	aahed	JJ	5
aahh	aahh	NN	1
aahing	aah	VBG	2
aahp	aahp	NNP	14
aahs	aah	NNS	2
aaib	aaib	NNP	1
aaiii	aaiius	NNP	2
aair	aair	NN	3
aairs	aair	NNS	1
aak	aak	NNP	2
aake	aake	NN	1
aakp	aakp	NNP	1
aakp	aakp	NN	1
aal	aal	NNP	58
aal-american	aal-american	NNP	1
aala	aalum	NNP	1
aalborg	aalborg	NNP	1
aalikum	aalikum	NN	1
aaliyah	aaliyah	NNP	4
aalso	aalso	NN	1
aalto	aalto	NNP	5
aam	aam	NNP	2
aamco	aamco	NNP	1
aames	aame	NNP	1
aand	aand	NNP	118
aand	aand	NN	32
aap	aap	NNP	10
aap	aap	NN	2
aapf-p-nitroanilide	aapf-p-nitroanilide	NNP	1
aapf-pna	aapf-pna	NNP	3
aapfakkk	aapfakkk	NNP	1
aaps	aap	NNP	3
aard	aard	NN	1
aardvark	aardvark	NNP	2
aardvark	aardvark	NN	2
aardvarken	aardvarken	NN	1
aardvarks	aardvark	NNP	1
aare	aare	NNP	2
aarg	aarg	NNP	1
aargh	aargh	NNP	10
aarikkaa	aarikkaa	NNP	1
aaron	aaron	NNP	175
aaron	aaron	NN	3
aaronetta	aaronetta	NNP	2
aaronic	aaronic	NNP	1
aaronj	aaronj	NNP	1
aaronson	aaronson	NNP	4
aarp	aarp	NNP	44
aarp	aarp	NN	2
aarp	aarp	UNC	1
aarparific	aarparific	NNP	1
aarrrrrggghhhh	aarrrrrggghhhh	NNP	1
aars	aar	NN	4
aarss	aarss	NNS	4
aas	aa	NNP	4
aas	aa	NNS	2
aasa	aasa	NNP	1
aasland	aasland	NNP	3
aassumes	aassume	NNS	1
aat	aat	NNP	28
aat	aat	NN	2
aataaa	aataaa	NNP	1
aataacctccaaattgacctg	aataacctccaaattgacctg	NNP	1
aatctgcagctatgaaatccc	aatctgcagctatgaaatccc	NNP	1
aatctttcatagttcatgcgtt	aatctttcatagttcatgcgtt	NNP	1
aatgaagcggagttcccaaagc	aatgaagcggagttcccaaagc	NNP	1
aatgaccaattatatgaatcaattatctg	aatgaccaattatatgaatcaattatctg	NNP	1
aatgggcagaggtataaagataagga	aatgggcagaggtataaagataagga	NNP	1
aattaaaccatccaatgaaatagagc	aattaaaccatccaatgaaatagagc	NNP	1
aattcagtgaactggccacc	aattcagtgaactggccacc	NNP	1
aattcatgctatgatgatgatgatgatggctac	aattcatgctatgatgatgatgatgatggctac	NNP	1
aattctgacaatcgacgccag	aattctgacaatcgacgccag	NNP	1
aattctggagcttctggatccaagaatggaatcaaagttaag	aattctggagcttctggatccaagaatggaatcaaagttaag	NNP	1
aatttatatggaatgctacgatt	aatttatatggaatgctacgatt	NNP	1
aau	aau	NNP	3
aauaaa	aauaaa	NNP	2
aaucmb	aaucmb	NNP	3
aaup	aaup	NNP	4
aava	aava	NNP	2
aave	aave	NNP	4
aaw	aaw	NNP	2
aawww	aawww	NNP	1
ab	ab	NNP	210
ab	ab	NN	42
ab	ab	UNC	1
ab-boin-ug	ab-boin-ug	JJ	1
ab-dependent	ab-dependent	NNP	1
ab-initio	ab-initio	JJ	1
aba	aba	NNP	56
aba	aba	NN	2
aba	aba	UNC	1
aba-mediated	aba-mediated	NNP	1
aba-nlada	aba-nlada	NNP	1
aba-response	aba-response	NNP	1
abaa	abaa	NN	1
ababa	ababa	NNP	1
ababb	ababb	NN	1
abac	abac	NN	1
abacavir	abacavir	NN	4
abacha	abacha	NNP	11
aback	aback	RB	26
abaco	abaco	NNP	9
abaconians	abaconian	NNP	1
abacos	abaco	NNP	10
abacus	abacus	JJ	8
abacus	abacus	NNP	3
abacuses	abacus	NNS	1
abacuses	abacus	NNP	1
abad	abad	NNP	3
abad	abad	NN	1
abade	abade	NNP	1
abadie	abadie	NNP	1
abado	abado	NNP	1
abaft	abaft	NN	1
abagyan	abagyan	NNP	3
abajo	abajo	NNP	2
abalon	abalon	NNP	1
abalone	abalone	NN	10
abalone	abalone	NNP	1
aban	aban	NN	1
abandandoned	abandandoned	JJ	1
abandon	abandon	VB	218
abandon	abandon	VBP	11
abandon	abandon	NNP	5
abandoned	abandon	VBN	351
abandoned	abandon	VBD	129
abandoned	abandoned	NNP	7
abandoned	abandoned	UNC	5
abandoned	abandoned	JJ	2
abandoned-including	abandoned-including	JJ	1
abandoner	abandoner	NN	1
abandonimg	abandonimg	NN	1
abandoning	abandon	VBG	115
abandoning	abandoning	UNC	1
abandonment	abandonment	NN	46
abandonment	abandonment	NNP	2
abandons	abandon	VBZ	13
abandons	abandon	NNP	3
abang	abang	NNP	8
abangales	abangale	NNP	1
abanic	abanic	NNP	1
abanus	abanus	NNP	1
abarca	abarca	NNP	1
abarcas	abarca	NNP	2
abarinov	abarinov	NNP	1
abarnard	abarnard	NN	1
abas	aba	NNP	1
abase	abase	NN	1
abashed	abashed	JJ	10
abashment	abashment	NN	1
abasic	abasic	JJ	18
abasic	abasic	NNP	1
abate	abate	VB	11
abate	abate	NNP	7
abated	abate	VBN	16
abatement	abatement	NN	8
abatement	abatement	NNP	2
abating	abate	VBG	7
abattoir	abattoir	NN	3
abattoir	abattoir	NNP	1
abaxial	abaxial	NN	1
abb	abb	NNP	17
abba	abba	NNP	6
abbaddaba	abbaddaba	NNP	1
abbado	abbado	NNP	2
abbas	abba	NNP	7
abbasid	abbasid	NNP	1
abbasiya	abbasiya	NNP	2
abbass	abbass	NNP	2
abbate	abbate	NNP	5
abbatiale	abbatiale	NNP	2
abbaye	abbaye	NNP	4
abbayedefontenay	abbayedefontenay	NN	1
abbayes	abbay	NNP	1
abbdominal	abbdominal	NN	1
abbe	abbe	NNP	4
abbella	abbellum	NN	1
abberation	abberation	NN	1
abbess	abbess	NNS	2
abbesses	abbess	NNP	3
abbeville	abbeville	NNP	2
abbey	abbey	NNP	88
abbey	abbey	NN	41
abbeys	abbey	NNS	6
abbeys	abbey	NNP	1
abbie	abbie	NNP	9
abbondanza	abbondanza	NNP	2
abbot	abbot	NNP	27
abbot	abbot	NN	16
abbots	abbot	NNS	2
abbott	abbott	NNP	57
abbotts	abbott	NNP	4
abboud	abboud	NNP	4
abboy	abboy	NNP	1
abbr	abbr	NNP	2
abbreivations	abbreivation	NNP	1
abbrev	abbrev	NNP	6
abbreviate	abbreviate	NN	10
abbreviate	abbreviate	NNP	2
abbreviated	abbreviated	JJ	59
abbreviated	abbreviated	NNP	1
abbreviates	abbreviate	NNS	1
abbreviating	abbreviate	VBG	4
abbreviation	abbreviation	NN	52
abbreviation	abbreviation	NNP	2
abbreviation	abbreviation	JJ	1
abbreviations	abbreviation	NNP	191
abbreviations	abbreviation	NNS	111
abbreviaturis	abbreviaturi	NNP	1
abbreviatus	abbreviatus	JJ	1
abbrevs	abbrev	NNP	1
abbuehl	abbuehl	NNP	1
abby	abby	NNP	75
abc	abc	NNP	679
abc	abc	NN	4
abc	abc	UNC	2
abc-dab	abc-dab	NNP	1
abc-horseradish	abc-horseradish	NNP	1
abc-hrp	abc-hrp	NNP	1
abc-kit	abc-kit	NNP	1
abc-paramount	abc-paramount	NNP	1
abc-tv	abc-tv	NNP	7
abca	abca	NNP	7
abcb	abcb	NNP	2
abcd	abcd	NNP	6
abcdefghijklmnopqrstuvwxyz	abcdefghijklmnopqrstuvwxyz	NNP	1
abce	abce	NNP	3
abcfamily	abcfamily	NNP	1
abcg	abcg	NNP	86
abcissa	abcissa	NN	1
abcnews	abcnew	NNP	4
abcnews	abcnew	NNS	3
abcs	abc	NNP	10
abcs	abcs	UNC	1
abd	abd	NNP	18
abd	abd	NN	2
abd-er	abd-er	NNP	3
abdalla	abdallum	NNP	6
abdallah	abdallah	NNP	10
abdalrahman	abdalrahman	NNP	1
abdel	abdel	NNP	47
abdelamir	abdelamir	NNP	1
abdelaziz	abdelaziz	NNP	2
abdelbari	abdelbarus	NNP	3
abdelghani	abdelghanus	NNP	14
abdeljaber	abdeljaber	NNP	12
abdelkader	abdelkader	NNP	1
abdellatif	abdellatif	NNP	1
abdelmajed	abdelmajed	NNP	1
abdelwahhab	abdelwahhab	NNP	1
abdera	abdera	NNP	1
abderrahman	abderrahman	NNP	2
abderraman	abderraman	NNP	1
abderraouf	abderraouf	NNP	4
abdessalem	abdessalem	NNP	2
abdf	abdf	NNP	3
abdi	abdus	NN	8
abdi	abdus	NNP	6
abdia	abdium	NNP	2
abdicate	abdicate	VBP	10
abdicated	abdicated	JJ	11
abdicating	abdicate	VBG	3
abdication	abdication	NN	20
abdication	abdication	NNP	1
abdications	abdication	NNS	1
abdil	abdil	NNP	2
abdnr	abdnr	NNP	1
abdnu	abdnu	NNP	1
abdoh	abdoh	NNP	4
abdolghassem	abdolghassem	NNP	3
abdomen	abdomen	NN	38
abdomen-crush	abdomen-crush	JJ	1
abdomens	abdomen	NNS	2
abdominal	abdominal	NN	120
abdominal	abdominal	NNP	4
abdominals	abdominal	NNS	4
abdominis	abdomini	NNS	2
abdoulaye	abdoulaye	NNP	1
abdoun	abdoun	NNP	3
abducens	abducen	NNP	3
abducens	abducen	NNS	2
abduct	abduct	NN	5
abducted	abducted	NN	49
abducted	abducted	NNP	1
abductee	abductee	NN	1
abductees	abductee	NNS	2
abducting	abduct	VBG	4
abduction	abduction	NN	38
abduction	abduction	NNP	3
abduction-molestation-murder	abduction-molestation-murder	JJ	1
abductions	abduction	NNS	43
abductions	abduction	NNP	2
abductor	abductor	NN	4
abductors	abductor	NNS	2
abducts	abduct	NNS	1
abdul	abdul	NNP	102
abdulaziz	abdulaziz	NNP	3
abdulla	abdullum	NNP	3
abdullah	abdullah	NNP	208
abdullah-recalled	abdullah-recalled	NNP	1
abdulmuttaleb	abdulmuttaleb	NNP	1
abdulrab	abdulrab	NNP	1
abdulsalam	abdulsalam	NNP	2
abdur	abdur	NNP	1
abdurraham	abdurraham	NNP	1
abdurrahman	abdurrahman	NNP	7
abdál	abdál	NN	1
abdül	abdül	NNP	8
abe	abe	NNP	59
abe	abe	NN	1
abeam	abeam	NN	1
abeautiful	abeautiful	NNP	1
abebe	abebe	NNP	1
abecedarium	abecedarium	NNP	4
abecedarius	abecedarius	JJ	2
abed	abed	NNP	4
abedi	abedus	NNP	2
abednego	abednego	NN	2
abednego	abednego	NNP	2
abeer	abeer	NNP	2
abel	abel	NNP	31
abelard	abelard	NNP	1
abele	abele	NNP	2
abeline	abeline	NNP	1
abell	abell	NNP	1
abelmoschus	abelmoschus	JJ	1
abelson	abelson	NNP	20
abelsonprofessor	abelsonprofessor	NNP	1
abencerrajes	abencerraje	NNP	2
abend	abend	NNP	1
abendgarderobe	abendgarderobe	NNP	3
aberamenthooulerthexanaxethreluoothnemareba	aberamenthooulerthexanaxethreluoothnemareba	NNP	1
abercombie	abercombie	NNP	1
abercrombie	abercrombie	NNP	24
abercrombie	abercrombie	NN	1
abercromby	abercromby	NNP	3
aberdeen	aberdeen	NNP	22
aberdonians	aberdonian	NNP	1
aberg	aberg	NNP	1
aberlour	aberlour	NNP	7
abernathy	abernathy	NNP	9
aberrancies	aberrancy	NNS	11
aberrancy	aberrancy	NN	3
aberrant	aberrant	NN	106
aberrant	aberrant	NNP	6
aberrantly	aberrantly	RB	14
aberration	aberration	NN	18
aberration	aberration	NNP	1
aberrational	aberrational	NN	3
aberrations	aberration	NNS	27
aberrations	aberration	NNP	1
abert	abert	NNP	1
abet	abet	NN	6
abets	abet	NNS	1
abetted	abet	VBN	13
abetted	abetted	NNP	2
abetted	abetted	UNC	1
abetter	abetter	NNP	1
abetting	abet	VBG	14
abettor	abettor	NN	1
abeyance	abeyance	NN	1
abf	abf	NNP	2
abfab	abfab	NNP	3
abg	abg	NNP	1
abgene	abgene	NNP	3
abh	abh	NNP	1
abhominable	abhominable	JJ	1
abhor	abhor	NN	11
abhorred	abhorred	JJ	6
abhorred	abhorred	UNC	1
abhorrence	abhorrence	NN	4
abhorrent	abhorrent	NN	7
abhors	abhor	NNS	10
abhors	abhor	NNP	1
abi	abus	NNP	119
abi	abus	NN	8
abi-prism	abi-prism	NNP	2
abia	abium	NNP	1
abiankapas	abiankapa	NNP	1
abicada	abicada	NNP	1
abid	abid	NNP	1
abide	abide	VB	58
abide-and	abide-and	JJ	1
abided	abided	JJ	5
abides	abide	NNS	2
abidin	abidin	NNP	1
abiding	abide	VBG	37
abiding	abiding	UNC	1
abidjan	abidjan	NNP	2
abie	abie	NNP	1
abierto	abierto	NN	1
abies	aby	NNS	2
abies	aby	NNP	1
abig	abig	NN	2
abigail	abigail	NNP	36
abigale	abigale	NNP	1
abil	abil	NN	1
abilene	abilene	NNP	38
abilites	abilite	NNS	1
abilities	abilities	UNC	2
abilities	ability	NNS	184
abilities	ability	NNP	2
ability	ability	NN	2493
ability	ability	NNP	9
ability	ability	UNC	3
ability	ability	JJ	1
ability-to-make-fire-in-rain	ability-to-make-fire-in-rain	JJ	1
abilityto	abilityto	NN	1
abim	abim	NNP	1
abingdon	abingdon	NNP	4
abiola	abiolum	NNP	9
abiotic	abiotic	JJ	26
abiotic	abiotic	NNP	1
abiotically	abiotically	RB	1
abiquiu	abiquiu	NNP	1
abir	abir	NNP	7
abir	abir	NN	1
abirdsworld	abirdsworld	NNP	1
abisco	abisco	NNP	1
abish	abish	NNP	1
abisynth	abisynth	NN	1
abit	abit	NN	1
abit	abit	NNP	1
abita	abita	NNP	2
abitation	abitation	NNP	2
abitur	abitur	NNP	1
abj	abj	NNP	1
abject	abject	NN	31
abjected	abjected	JJ	1
abjection	abjection	NN	2
abjection	abjection	UNC	1
abjectly	abjectly	RB	7
abjectness	abjectness	UNC	1
abjure	abjure	NN	5
abjured	abjured	JJ	1
abjures	abjure	NNS	2
abjuring	abjure	VBG	1
abkhazia	abkhazium	NNP	3
abl	abl	NNP	30
abl	abl	NN	2
abladen	abladen	NN	1
ablaqueate	ablaqueate	NN	1
ablaqueate	ablaqueate	NNP	1
ablasion	ablasion	NN	1
ablata	abla	NN	1
ablatable	ablatable	NNP	1
ablate	ablate	NN	6
ablated	ablated	JJ	19
ablates	ablate	NNS	2
ablating	ablate	VBG	3
ablation	ablation	NN	66
ablation	ablation	NNP	5
ablations	ablation	NNS	2
ablations	ablation	NNP	1
ablative	ablative	JJ	5
ablaze	ablaze	NN	17
ablaze	ablaze	NNP	1
able	able	JJ	5660
able	able	NNP	12
able-bodied	able-bodied	JJ	12
abled	abled	JJ	1
ableto	ableto	NN	2
ablidged	ablidged	JJ	1
ablities	ablity	NNS	1
abloom	abloom	NN	1
abluminal	abluminal	NN	5
abluted	abluted	JJ	1
ablution	ablution	NN	2
ablutions	ablutions	NNS	7
ably	ably	RB	13
abm	abm	NNP	14
abn	abn	NNP	1
abnaki	abnakus	NNP	2
abnegation	abnegation	NN	2
abner	abner	NNP	22
abnor	abnor	NN	1
abnormal	abnormal	JJ	281
abnormal	abnormal	NNP	10
abnormalities	abnormality	NNS	231
abnormalities	abnormality	NNP	5
abnormality	abnormality	NN	66
abnormally	abnormally	RB	32
abnormally	abnormally	NNP	1
abnormals	abnormal	NNS	1
abnr	abnr	NNP	2
abo	abo	NN	6
abo	abo	JJ	1
aboard	aboard	IN	201
aboard	aboard	NNP	4
aboard	aboard	RB	3
aboc	aboc	NNP	1
abode	abode	NN	10
abode	abode	NNP	1
abodes	abode	NNS	1
abodiement	abodiement	NN	1
abogadillo	abogadillo	NN	1
abogado	abogado	NN	1
abol	abol	NN	1
abolish	abolish	VB	65
abolish	abolish	NNP	4
abolished	abolish	VBN	68
abolished	abolish	VBD	56
abolished	abolished	UNC	1
abolished	abolished	NNP	1
abolishes	abolish	NNS	11
abolishing	abolish	VBG	40
abolishing	abolishing	NNP	1
abolition	abolition	NN	49
abolition	abolition	NNP	2
abolition	abolition	UNC	1
abolition-of-function	abolition-of-function	JJ	1
abolitionism	abolitionism	NN	2
abolitionist	abolitionist	NN	13
abolitionists	abolitionist	NNS	10
abolitionists	abolitionist	NNP	1
abomelic	abomelic	NNP	1
abominable	abominable	JJ	12
abominably	abominably	RB	2
abominated	abominated	JJ	1
abomination	abomination	NN	21
abomination	abomination	NNP	3
abomination	abomination	UNC	1
abominations	abomination	NNS	5
abominationvegetable	abominationvegetable	JJ	1
abominosus	abominosus	JJ	1
abonuses	abonus	NNS	1
aboot	aboot	NN	1
abootty	abootty	NNP	2
abooty	abooty	NNP	1
abor	abor	NN	1
aboriginal	aboriginal	NNP	49
aboriginal	aboriginal	NN	12
aborigine	aborigine	NNP	4
aborigine	aborigine	NN	1
aborigines	aborigine	NNP	24
aborigines	aborigine	NNS	5
aborigines	aborigines	UNC	1
aborigén	aborigén	NNP	1
abort	abort	NN	15
abort	abort	NNP	2
aborted	abort	VBN	2
aborted	aborted	JJ	25
aborted	aborted	UNC	1
abortifacent	abortifacent	NN	1
abortifacents	abortifacent	NNS	1
abortifacient	abortifacient	NN	2
aborting	abort	VBG	6
aborting	aborting	NNP	1
abortion	abortion	NN	651
abortion	abortion	NNP	26
abortion	abortion	UNC	9
abortion	abortion	JJ	1
abortion-abetting	abortion-abetting	JJ	1
abortion-clinic	abortion-clinic	JJ	2
abortion-clinic	abortion-clinic	NNP	1
abortion-free	abortion-free	JJ	1
abortion-neutral	abortion-neutral	JJ	1
abortion-related	abortion-related	JJ	5
abortion-reporting	abortion-reporting	JJ	1
abortion-rights	abortion-right	NNS	17
abortionist	abortionist	NN	4
abortionists	abortionist	NNS	2
abortionists	abortionist	NNP	2
abortions	abortion	NNS	146
abortions	abortion	NNP	4
abortions	abortions	UNC	7
abortions	abortions	JJ	1
abortive	abortive	JJ	30
abortive	abortive	NNP	1
aborto	aborto	NN	1
aborts	abort	NNS	1
abortus	abortus	JJ	35
abortuses	abortus	NNS	1
abortusvaccine	abortusvaccine	NN	1
aborville	aborville	NNP	1
abot	abot	NN	2
abotu	abotu	NN	3
abou	abou	NNP	4
abou	abou	NN	3
abouhalima	abouhalima	NNP	4
aboukir	aboukir	NNP	1
abound	abound	VBP	96
abound	abound	NNP	4
abounded	abound	VBD	9
aboundeth	aboundeth	NN	1
abounding	abound	VBG	1
abounds	abound	VBZ	24
abounds	abound	NNP	1
about	about	IN	58578
about	about	RB	243
about	about	RP	185
about	about	JJ	111
about	about	UNC	104
about	about	NNP	89
about-face	about-face	NN	18
about-to-be	about-to-be	JJ	2
about-to-be-announced	about-to-be-announced	JJ	2
about-to-be-born	about-to-be-born	JJ	2
about-to-be-created	about-to-be-created	JJ	1
about-to-be-published	about-to-be-published	JJ	2
about-to-be-released	about-to-be-released	JJ	1
about-to-be-resuscitated	about-to-be-resuscitated	JJ	1
about-town	about-town	JJ	1
abouts	about	NNS	6
aboutthem	aboutthem	NN	1
abouttheportauthority	abouttheportauthority	NNP	1
above	above	IN	3494
above	above	JJ	400
above	above	RB	23
above	above	UNC	13
above	above	NNP	6
above-average	above-average	JJ	9
above-defined	above-defined	JJ	1
above-described	above-described	JJ	4
above-detected	above-detected	JJ	1
above-discussed	above-discussed	JJ	1
above-ground	above-ground	JJ	5
above-has	above-ha	JJ	1
above-hurdle	above-hurdle	JJ	1
above-it-all	above-it-all	JJ	2
above-listed	above-listed	JJ	2
above-market	above-market	JJ	1
above-mentioned	above-mentioned	JJ	16
above-named	above-named	JJ	1
above-noted	above-noted	JJ	1
above-politics	above-politic	JJ	1
above-the-eyebrow	above-the-eyebrow	JJ	1
above-the-fold	above-the-fold	JJ	25
above-the-fold	above-the-fold	NNP	1
above-the-fray	above-the-fray	JJ	2
above-the-knee	above-the-knee	JJ	2
above-the-title	above-the-title	JJ	1
above-threshold	above-threshold	JJ	2
aboveboard	aboveboard	NN	4
aboveboard	aboveboard	NNP	1
abovedescribed	abovedescribed	JJ	1
aboveground	aboveground	NN	2
abovementioned	abovementioned	JJ	1
abox	abox	NN	1
abp	abp	NNP	35
abp-containing	abp-containing	NNP	1
abp-tg	abp-tg	NNP	37
abpnn	abpnn	NN	1
abr	abr	NNP	1
abra	abra	NNP	13
abracadabra	abracadabra	NN	2
abracadabra	abracadabra	NNP	1
abrading	abrade	VBG	1
abraham	abraham	NNP	138
abrahamowicz	abrahamowicz	NNP	1
abrahams	abraham	NNP	5
abrahamsen	abrahamsen	NNP	1
abrahms	abrahm	NNP	1
abrain	abrain	NN	1
abram	abram	NNP	1
abramovic	abramovic	NNP	1
abramovich	abramovich	NNP	1
abramovitz	abramovitz	NNP	2
abramowitz	abramowitz	NNP	4
abrams	abram	NNP	62
abrams	abrams	UNC	1
abramson	abramson	NNP	5
abrans	abran	NNS	1
abrant	abrant	NN	1
abrantes	abrant	NNP	1
abrase	abrase	NN	1
abrash	abrash	NNP	2
abrasion	abrasion	NN	7
abrasion-themed	abrasion-themed	JJ	1
abrasions	abrasion	NNS	6
abrasive	abrasive	JJ	23
abrasive	abrasive	NN	2
abrasive	abrasive	NNP	1
abrazo	abrazo	NN	1
abre	abre	NN	2
abre	abre	NNP	1
abre-like	abre-like	NNP	1
abreaction	abreaction	NN	1
abreast	abreast	NN	38
abreast	abreast	NNP	1
abrejo	abrejo	NNP	1
abrell	abrell	NNP	1
abres	abr	NNP	1
abreu	abreu	NNP	3
abreuvoir	abreuvoir	NNP	2
abri	abrus	NNP	1
abridge	abridge	NN	11
abridged	abridged	JJ	8
abridged	abridged	NNP	1
abridgement	abridgement	NN	1
abridges	abridge	NNS	1
abridging	abridge	VBG	3
abridgment	abridgment	NN	2
abridgment	abridgment	NNP	1
abriel	abriel	NN	1
abrigo	abrigo	NN	1
abrigo	abrigo	NNP	1
abrikosov	abrikosov	NNP	1
abril	abril	NNP	8
abril	abril	NN	1
abroad	abroad	RB	431
abroad	abroad	NNP	6
abroad	abroad	UNC	3
abroad	abroad	JJ	1
abroad-limits	abroad-limit	JJ	1
abrode	abrode	NN	1
abrogate	abrogate	NN	11
abrogated	abrogated	JJ	15
abrogates	abrogate	NNS	2
abrogating	abrogate	VBG	5
abrogation	abrogation	NN	8
abrotanum	abrotanum	NNP	3
abrou	abrou	NN	1
abrupt	abrupt	JJ	82
abrupta	abrupta	NN	1
abruptly	abruptly	RB	101
abruptly	abruptly	NNP	2
abruptness	abruptness	NNS	2
abruzzi	abruzzus	NNP	2
abs	ab	NNS	28
abs	ab	NNP	22
abs	abs	NN	1
absalom	absalom	NNP	6
absaroka	absaroka	NNP	1
abscam	abscam	NNP	2
abscence	abscence	NN	1
abscene	abscene	NN	1
abscess	abscess	NNS	9
abscess-like	abscess-like	JJ	1
abscessed	abscessed	JJ	1
abscesses	abscess	NNS	9
abscesses	abscess	NNP	1
abscessus	abscessus	JJ	1
abscisic	abscisic	JJ	6
abscisic	abscisic	NNP	1
abscissa	abscissa	NN	3
abscond	abscond	NN	3
absconded	absconded	JJ	4
absconding	abscond	VBG	1
abscondment	abscondment	NN	1
absdata	absda	NN	3
abse	abse	NNP	1
absence	absence	NN	1441
absence	absence	NNP	18
absence	absence	UNC	1
absence-minded	absence-minded	NNP	1
absences	absence	NNS	31
absense	absense	NN	1
absent	absent	JJ	379
absent	absent	VB	72
absent	absent	UNC	1
absent-minded	absent-minded	JJ	1
absent-mindedly	absent-mindedly	JJ	3
absente	absente	NNP	1
absented	absented	JJ	1
absentee	absentee	NN	47
absentee	absentee	NNP	2
absenteeism	absenteeism	NN	17
absenteeism	absenteeism	NNP	1
absentees	absentee	NNS	2
absenthe	absenthe	NNP	1
absentia	absentia	NN	6
absentia	absentia	NNP	3
absentionists	absentionist	NNS	1
absently	absently	RB	9
absentminded	absentminded	JJ	2
absentmindedly	absentmindedly	RB	1
abshire	abshire	NNP	1
absinth	absinth	NN	1
absinthe	absinthe	NN	8
absinthe	absinthe	NNP	2
absinthe-fueled	absinthe-fueled	JJ	1
absinthium	absinthium	NNP	13
absit	absit	NNP	1
absloutely	absloutely	NNP	1
abso-bleeding-lutely	abso-bleeding-lutely	NNP	1
abso-freakin-lutely	abso-freakin-lutely	NNP	1
abso-friggin	abso-friggin	JJ	1
abso-fucking-lutely	abso-fucking-lutely	NNP	1
abso-fucking-lutely	abso-fucking-lutely	JJ	1
absofxxxinglutely	absofxxxinglutely	NNP	1
absolete	absolete	NN	1
absolom	absolom	NNP	1
absolu	absolu	NN	1
absolut	absolut	NNP	4
absolute	absolute	JJ	745
absolute	absolute	UNC	1
absolute	absolute	NNP	1
absolute-beginners	absolute-beginner	JJ	1
absolutely	absolutely	RB	1404
absolutely	absolutely	JJ	1
absolutely	absolutely	NNP	1
absoluteness	absoluteness	NNS	5
absolutes	absolute	NNS	9
absolution	absolution	NN	11
absolutism	absolutism	NN	11
absolutisms	absolutisms	UNC	1
absolutist	absolutist	NN	14
absolutists	absolutist	NNS	1
absolutists	absolutist	NNP	1
absolutly	absolutly	RB	1
absolve	absolve	VBP	9
absolve	absolve	NNP	1
absolved	absolved	JJ	9
absolver	absolver	NN	1
absolves	absolve	NNS	3
absolves	absolve	NNP	1
absolving	absolve	VBG	2
absolyutno	absolyutno	NN	1
absorb	absorb	VB	113
absorb	absorb	VBP	13
absorb	absorb	NN	1
absorb	absorb	NNP	1
absorbable	absorbable	JJ	2
absorbance	absorbance	NN	133
absorbance	absorbance	NNP	8
absorbances	absorbance	NNS	4
absorbed	absorb	VBN	154
absorbed	absorb	VBD	43
absorbed	absorbed	UNC	3
absorbency	absorbency	NN	8
absorbency	absorbency	NNP	1
absorbent	absorbent	JJ	10
absorbent	absorbent	NNP	1
absorber	absorber	NN	61
absorber	absorber	NNP	2
absorber-module	absorber-module	JJ	2
absorbers	absorber	NNS	32
absorbing	absorb	VBG	63
absorbing	absorbing	NNP	2
absorbs	absorb	VBZ	28
absorptiometry	absorptiometry	NNP	2
absorption	absorption	NN	277
absorption	absorption	NNP	7
absorption	absorption	UNC	1
absorptions	absorption	NNS	1
absorptive	absorptive	JJ	3
absorptivities	absorptivity	NNS	1
abstain	abstain	NN	22
abstained	abstain	VBD	9
abstainers	abstainer	NNS	3
abstaining	abstain	VBG	6
abstains	abstain	NNS	2
abstemious	abstemious	JJ	2
abstemiousness	abstemiousness	NNS	1
abstention	abstention	NN	3
abstentions	abstention	NNS	5
abstinence	abstinence	NN	55
abstinence	abstinence	NNP	10
abstinence	abstinence	UNC	1
abstinence-based	abstinence-based	JJ	2
abstinence-only	abstinence-only	JJ	8
abstinence-oriented	abstinence-oriented	JJ	1
abstinence-plus	abstinence-plus	JJ	1
abstinent	abstinent	NN	3
abstinent	abstinent	NNP	1
abstract	abstract	JJ	263
abstract	abstract	NNP	30
abstract	abstract	UNC	2
abstractdataadapter	abstractdataadapter	NNP	1
abstracted	abstracted	JJ	36
abstracting	abstract	VBG	4
abstracting	abstracting	NNP	1
abstraction	abstraction	NN	58
abstraction	abstraction	NNP	1
abstractionist	abstractionist	NN	2
abstractions	abstraction	NNS	13
abstractly	abstractly	RB	8
abstractness	abstractness	NNS	1
abstractors	abstractor	NNS	3
abstracts	abstract	NNS	74
abstracts	abstract	NNP	12
abstruse	abstruse	NN	13
abstruse-seeming	abstruse-seeming	JJ	1
absurd	absurd	JJ	227
absurd	absurd	UNC	4
absurd	absurd	NNP	4
absurd-looking	absurd-looking	JJ	1
absurd-sounding	absurd-sounding	JJ	1
absurder	absurder	NNP	1
absurdism	absurdism	NN	1
absurdist	absurdist	NN	13
absurdist	absurdist	NNP	1
absurdist-tinged	absurdist-tinged	JJ	1
absurdities	absurdity	NNS	12
absurdity	absurdity	NN	51
absurdity	absurdity	NNP	3
absurdity	absurdity	UNC	1
absurdly	absurdly	RB	38
absurdly	absurdly	UNC	2
absurdum	absurdum	NN	3
absurdus	absurdus	NNP	1
absures	absure	NNP	1
abt	abt	NNP	19
abtei	abteus	NNP	1
abts	abt	NNP	4
abu	abu	NNP	218
abubakar	abubakar	NNP	12
abuela	abuelum	NN	1
abuela	abuelum	NNP	1
abuelo	abuelo	NN	7
abuelo	abuelo	NNP	4
abuen	abuen	NNP	1
abuja	abuja	NNP	1
abukayak	abukayak	NNP	1
abukhalil	abukhalil	NNP	3
abulia	abulium	NN	2
abulous	abulous	JJ	1
abumhrad	abumhrad	NNP	1
abundance	abundance	NN	399
abundance	abundance	NNP	3
abundances	abundance	NNS	27
abundant	abundant	JJ	292
abundant	abundant	NNP	12
abundantly	abundantly	RB	46
abundence	abundence	NN	1
abuot	abuot	NN	1
aburdeineh	aburdeineh	NNP	1
abusaad	abusaad	NNP	1
abusaid	abusaid	NNP	2
abuse	abuse	NN	970
abuse	abuse	NNP	106
abuse	abuse	VB	45
abuse	abuse	UNC	9
abuse-of-fiction	abuse-of-fiction	JJ	1
abuse-programs	abuse-program	JJ	1
abuse-suggesting	abuse-suggesting	JJ	1
abused	abuse	VBN	168
abused	abuse	VBD	21
abused	abused	NNP	10
abused	abused	JJ	2
abused	abused	UNC	1
abuseinfederal	abuseinfederal	NNP	2
abuseofpower	abuseofpower	NN	1
abuser	abuser	NN	18
abusers	abuser	NNS	35
abusers	abuser	NNP	4
abusers	abusers	UNC	1
abuses	abuse	NNS	206
abuses	abuse	NNP	7
abuses	abuses	UNC	1
abusing	abuse	VBG	86
abusing	abusing	NNP	4
abusive	abusive	JJ	146
abusive	abusive	NNP	2
abusive-cum-substance-abusive-cum-mooching	abusive-cum-substance-abusive-cum-mooching	JJ	1
abusively	abusively	RB	1
abut	abut	NN	11
abutments	abutment	NNS	1
abuts	abut	NNS	3
abutted	abutted	JJ	2
abutting	abut	VBG	5
abutting	abutting	NNP	1
abuturab	abuturab	NNP	1
abuzz	abuzz	JJ	7
abwab	abwab	NN	1
abwender	abwender	NNP	1
abx	abx	NNP	1
aby	aby	NN	1
abydos	abydo	NNP	1
abymes	abyme	NNP	1
abysii	abysius	NN	1
abysinth	abysinth	NN	1
abysmal	abysmal	NN	21
abysmally	abysmally	RB	3
abyss	abyss	NNS	17
abyss	abyss	NN	2
abyss	abyss	UNC	1
abyss-gazing	abyss-gazing	JJ	1
abyssi	abyssus	NN	11
abyssinia	abyssinium	NNP	7
abyssinian	abyssinian	NNP	2
abyssmally	abyssmally	RB	1
abzug	abzug	NNP	3
ab­bey	ab­bey	NN	1
ac	ac	NNP	245
ac	ac	NN	43
ac-hoteles	ac-hotele	JJ	2
aca	aca	NNP	31
aca	aca	NN	1
aca-limpia	aca-limpium	NNP	1
acaa	acaa	NNP	8
acaa	acaa	NN	2
acaaaaacc	acaaaaacc	NNP	1
acaaataggggttccgcgcaca	acaaataggggttccgcgcaca	NNP	1
acaacaaagggcagcaacaacacc	acaacaaagggcagcaacaacacc	NNP	1
acaacaccgtg	acaacaccgtg	NNP	1
acaaccagtttgctctgcttatc	acaaccagtttgctctgcttatc	NNP	1
acaba	acaba	NN	1
acacagataagttgctggcc	acacagataagttgctggcc	NNP	1
acacia	acacia	NN	6
acacia	acacia	NNP	2
acacia-like	acacia-like	JJ	1
acad	acad	NNP	19
academe	academe	NN	8
academe	academe	NNP	2
academese	academese	NN	1
academia	academia	NN	57
academia	academia	NNP	3
academic	academic	JJ	693
academic	academic	NNP	100
academic	academic	NN	39
academic	academic	UNC	3
academic-seeming	academic-seeming	JJ	1
academic-sounding	academic-sounding	JJ	1
academic-types	academic-type	JJ	1
academically	academically	RB	35
academician	academician	NN	2
academicians	academician	NNS	7
academicians	academician	NNP	1
academicism	academicism	NN	1
academics	academic	NNS	116
academics	academic	NNP	7
academic–industrial	academic–industrial	NN	1
academie	academie	NNP	4
academies	academy	NNS	12
academies	academy	NNP	4
academy	academy	NNP	356
academy	academy	NN	71
academy	academy	UNC	1
academywomen	academywoman	NN	1
acadia	acadium	NNP	14
acadia	acadium	NN	1
acadian	acadian	NNP	7
acadians	acadian	NNP	11
acadm	acadm	NNP	2
académica	académica	NNP	1
académie	académie	NNP	11
académie	académie	NN	1
académies	académies	NNP	1
acadé­mie	acadé­mie	NNP	1
acagcctgaccgtggagaag	acagcctgaccgtggagaag	NNP	1
acagtgaagagtagtggtcg	acagtgaagagtagtggtcg	NNP	1
acalda	acalda	NN	1
acampado	acampado	NN	1
acampora	acampora	NNP	2
acan	acan	NNP	1
acanthaceae	acanthacea	NNP	1
acanthamoeba	acanthamoeba	NNP	2
acanthomoeba	acanthomoeba	NNP	1
acanthostega	acanthostega	NNP	2
acanthus	acanthus	JJ	4
acap	acap	NN	1
acapella	acapellum	NN	2
acapulco	acapulco	NNP	90
acarbon	acarbon	NN	1
acarbose	acarbose	NN	1
acars	acar	NNP	7
acas	aca	NNP	2
acass	acass	NNP	1
acat	acat	NNP	1
acatccaaacagaacgtgcc	acatccaaacagaacgtgcc	NNP	1
acatcher	acatcher	NNP	1
acatggactgaggagtag	acatggactgaggagtag	NNP	1
acatgggacgtaacagatac	acatgggacgtaacagatac	NNP	1
acatgtccagcatcaaagcgg	acatgtccagcatcaaagcgg	NNP	1
acathala	acathala	NNP	1
acatitla	acatitlum	NNP	1
acatn	acatn	NNP	1
acaule	acaule	NN	1
acauses	acause	NNP	1
aca­demy	aca­demy	NNP	1
aca­dé­mie	aca­dé­mie	NNP	1
acbd	acbd	NNP	1
acc	acc	NNP	71
acc	acc	NN	3
accaccgtggacaccttctdtdt	accaccgtggacaccttctdtdt	NNP	1
accademia	accademium	NNP	14
accademia	accademium	NN	1
accadian	accadian	NNP	1
accaggacgatcaactgggcttc	accaggacgatcaactgggcttc	NNP	1
accagtcgactctacagtgc	accagtcgactctacagtgc	NNP	1
accattgagctcttcactgatgaacttcacc	accattgagctcttcactgatgaacttcacc	NNP	1
acccaagatacctcatcacag	acccaagatacctcatcacag	NNP	1
acccatgtcaaacccatcag	acccatgtcaaacccatcag	NNP	1
acccccatctcactaattcc	acccccatctcactaattcc	NNP	1
accclaimed	accclaimed	JJ	1
accctctccaaaatcccataa	accctctccaaaatcccataa	NNP	1
accede	accede	VB	11
acceded	accede	VBD	14
acceding	accede	VBG	4
accelerate	accelerate	VB	100
accelerate	accelerate	VBP	1
accelerate	accelerate	NNP	1
accelerate-the	accelerate-the	JJ	1
accelerated	accelerate	VBN	86
accelerated	accelerate	VBD	58
accelerated	accelerated	JJ	9
accelerated	accelerated	NNP	6
accelerates	accelerate	VBZ	17
accelerating	accelerate	VBG	58
acceleration	acceleration	NN	69
acceleration	acceleration	NNP	3
acceleration	acceleration	UNC	1
accelerations	acceleration	NNS	1
accelerator	accelerator	NN	17
accelerator	accelerator	NNP	2
accelerod	accelerod	NN	2
accelerometer	accelerometer	NN	1
accelerometer-based	accelerometer-based	JJ	3
accelerometers	accelerometer	NNS	1
acceleromyography	acceleromyography	NN	1
accelrys	accelry	NNP	1
accent	accent	NN	419
accent	accent	NNP	23
accent	accent	UNC	8
accent-free	accent-free	JJ	1
accent-reduction	accent-reduction	JJ	1
accent-training	accent-training	JJ	2
accented	accented	JJ	14
accenting	accent	VBG	6
accents	accent	NNS	130
accents	accent	NNP	15
accents-fighting-and-sweating-in-the-desert	accents-fighting-and-sweating-in-the-desert	JJ	1
accentservices	accentservice	NNP	1
accentuate	accentuate	NN	15
accentuate	accentuate	NNP	1
accentuated	accentuated	JJ	18
accentuated	accentuated	UNC	1
accentuates	accentuate	NNS	5
accentuating	accentuate	VBG	7
accenture	accenture	NNP	9
accep-tance	accep-tance	JJ	1
accept	accept	VB	865
accept	accept	VBP	150
accept	accept	NNP	15
accept	accept	UNC	2
accepta	accepta	NN	1
acceptab	acceptab	NN	1
acceptability	acceptability	NN	43
acceptability	acceptability	NNP	9
acceptable	acceptable	JJ	536
acceptable	acceptable	NNP	5
acceptable	acceptable	UNC	2
acceptableî	acceptableî	NN	1
acceptably	acceptably	RB	5
acceptance	acceptance	NN	323
acceptance	acceptance	NNP	18
acceptance	acceptance	UNC	2
acceptance-speech	acceptance-speech	JJ	1
acceptanceprocedures	acceptanceprocedure	NNS	1
acceptances	acceptance	NNS	10
accepted	accept	VBN	459
accepted	accept	VBD	447
accepted	accepted	NNP	18
accepted	accepted	JJ	9
accepted	accepted	UNC	5
accepter	accepter	NN	1
accepters	accepter	NNS	1
acceptible	acceptible	JJ	1
accepting	accept	VBG	272
accepting	accepting	NNP	9
accepting	accepting	UNC	1
acceptive	acceptive	JJ	1
acceptor	acceptor	NN	67
acceptor	acceptor	UNC	1
acceptors	acceptor	NNS	9
accepts	accept	VBZ	109
accepts	accept	NNP	1
accesorized	accesorized	JJ	1
access	access	NN	2085
access	access	NNP	226
access	access	VB	182
access	access	UNC	10
access	access	JJ	1
access-restriction	access-restriction	JJ	1
access-that	access-that	JJ	1
access-to-justice	access-to-justice	JJ	1
access-to-records	access-to-record	JJ	1
accessable	accessable	JJ	1
accessdata	accessda	NN	1
accessed	accessed	JJ	69
accessed	accessed	NNP	4
accessed-like	accessed-like	JJ	1
accesses	access	NNS	5
accessibilities	accessibility	NNS	1
accessibility	accessibility	NN	67
accessibility	accessibility	NNP	3
accessible	accessible	JJ	379
accessible	accessible	NNP	3
accessible	accessible	UNC	1
accessibly	accessibly	RB	3
accessing	access	VBG	42
accessing	accessing	NNP	3
accession	accession	NN	308
accession	accession	NNP	58
accession	accession	UNC	1
accessioned	accessioned	JJ	1
accessions	accession	NNS	14
accessionsperassembly	accessionsperassembly	RB	1
accessit	accessit	NN	1
accessories	accessories	UNC	1
accessories	accessory	NNS	75
accessories	accessory	NNP	1
accessorise	accessorise	NNP	1
accessorise	accessorise	NN	1
accessorize	accessorize	NN	6
accessorize	accessorize	NNP	1
accessorized	accessorized	JJ	3
accessorizing	accessorize	VBG	1
accessors	accessor	NNS	1
accessory	accessory	JJ	73
accessory	accessory	NNP	3
accessto	accessto	NN	1
accessworld	accessworld	NNP	1
accgtgaaaagatgatgacccag	accgtgaaaagatgatgacccag	NNP	1
accgtgaccg	accgtgaccg	NNP	1
acch	acch	NNP	1
accha	accha	NN	1
accham	accham	NNP	1
acci	acci	NN	1
acci	accus	NNP	1
accid	accid	NNP	1
accident	accident	NN	631
accident	accident	NNP	39
accident	accident	UNC	2
accident	accident	JJ	1
accident-prone	accident-prone	JJ	2
accident-related	accident-related	JJ	1
accidental	accidental	NN	113
accidental	accidental	NNP	18
accidentalis	accidentali	NNS	1
accidentally	accidentally	RB	206
accidentally	accidentally	NNP	2
accidently	accidently	RB	14
accidents	accident	NNS	226
accidents	accident	NNP	7
accidents	accidents	UNC	2
accidents	accidents	JJ	1
acciderant	acciderant	NN	1
accidnet	accidnet	NN	1
accio	accio	NN	1
accipiens	accipien	NNS	1
accipitrine	accipitrine	NN	1
accival	accival	NNP	1
acclaim	acclaim	NN	51
acclaim	acclaim	NNP	3
acclaim	acclaim	UNC	1
acclaim	acclaim	VB	1
acclaimed	acclaimed	JJ	83
acclaimed	acclaimed	NNP	3
acclamabant	acclamabant	NN	1
acclamation	acclamation	NN	4
acclimatation	acclimatation	NNP	3
acclimate	acclimate	NN	8
acclimated	acclimated	JJ	19
acclimating	acclimate	VBG	6
acclimating	acclimating	NNP	1
acclimation	acclimation	NN	21
acclimation	acclimation	NNP	2
acclimatization	acclimatization	NN	4
acclimatize	acclimatize	NN	4
acclimatized	acclimatized	JJ	1
accn	accn	NNP	1
accnewsmedia	accnewsmedium	NN	1
accnu	accnu	NNP	1
acco	acco	NNP	12
acco	acco	NN	1
accoberry	accoberry	NNP	1
accolade	accolade	NN	11
accolades	accolade	NNS	24
accom	accom	NN	1
accomadating	accomadate	VBG	1
accommodate	accommodate	VB	211
accommodate	accommodate	VBP	8
accommodated	accommodate	VBN	33
accommodates	accommodate	NNS	19
accommodating	accommodate	VBG	37
accommodating	accommodating	NNP	1
accommodatingly	accommodatingly	NNP	1
accommodation	accommodation	NN	83
accommodation	accommodation	NNP	2
accommodation	accommodation	UNC	1
accommodationism	accommodationism	NN	2
accommodationist	accommodationist	NN	5
accommodationists	accommodationist	NNS	1
accommodations	accommodation	NNS	104
accommodations	accommodation	NNP	7
accommodations	accommodations	UNC	1
accomodate	accomodate	VB	8
accomodation	accomodation	NN	5
accomodationists	accomodationist	NNS	1
accomodations	accomodation	NNS	2
accompanied	accompanied	NNP	7
accompanied	accompanied	UNC	3
accompanied	accompany	VBN	380
accompanied	accompany	VBD	58
accompanies	accompany	VBZ	62
accompanies	accompany	NNP	1
accompaniment	accompaniment	NN	26
accompaniments	accompaniment	NNS	3
accompaniments	accompaniment	NNP	3
accompanist	accompanist	NN	3
accompany	accompany	VB	118
accompany	accompany	NNP	3
accompanying	accompany	VBG	261
accompanying	accompanying	NNP	12
accompianied	accompianied	JJ	1
accompianment	accompianment	NN	2
accompli	accompli	NN	10
accomplice	accomplice	NN	31
accomplice	accomplice	UNC	1
accomplices	accomplice	NNS	19
accomplis	accompli	NNS	1
accomplish	accomplish	VB	277
accomplish	accomplish	NNP	1
accomplish	accomplish	JJ	1
accomplish-easily	accomplish-easily	JJ	1
accomplished	accomplish	VBN	360
accomplished	accomplished	JJ	4
accomplished	accomplished	NNP	2
accomplished	accomplished	UNC	1
accomplishes	accomplish	VBZ	17
accomplishing	accomplish	VBG	47
accomplishment	accomplishment	NN	117
accomplishment	accomplishment	UNC	2
accomplishment	accomplishment	NNP	1
accomplishments	accomplishment	NNS	138
accomplishments	accomplishment	NNP	5
accomplit	accomplit	NN	1
accompong	accompong	NNP	1
accord	accord	NN	132
accord	accord	NNP	44
accord	accord	VB	4
accord	accord	JJ	1
accord	accord	UNC	1
accordance	accordance	NN	386
accordance	accordance	NNP	2
accordancewith	accordancewith	NN	1
accordant	accordant	NN	1
accorded	accord	VBN	32
accorded	accord	VBD	16
accordence	accordence	NN	1
accordianist	accordianist	NN	1
accordians	accordian	NNS	1
according	accord	VBG	5106
according	according	UNC	7
accordingly	accordingly	RB	275
accordingly	accordingly	UNC	1
accordion	accordion	NN	29
accordion	accordion	NNP	3
accordion-laced	accordion-laced	JJ	1
accordion-like	accordion-like	JJ	1
accordionated	accordionated	NNP	1
accordionist	accordionist	NN	4
accordions	accordion	NNS	12
accords	accord	NNS	67
accords	accord	NNPS	14
accords	accords	UNC	1
accoring	accore	VBG	1
accorsi	accorsus	NNP	1
accosted	accosted	JJ	11
accosting	accost	VBG	3
accosts	accost	NNS	1
account	account	NN	1604
account	account	VB	406
account	account	VBP	158
account	account	NNP	36
account	account	UNC	10
account	account	JJ	1
accountabilities	accountability	NNS	2
accountability	accountability	NN	380
accountability	accountability	NNP	85
accountability-can	accountability-can	JJ	1
accountability-with	accountability-with	JJ	1
accountabilitycontrol	accountabilitycontrol	NNP	1
accountabilityreportis	accountabilityreporti	NNP	1
accountable	accountable	JJ	224
accountable	accountable	NNP	6
accountable	accountable	UNC	1
accountancy	accountancy	NN	9
accountancy	accountancy	NNP	3
accountant	accountant	NN	109
accountant	accountant	NNP	7
accountant-client	accountant-client	JJ	1
accountantand	accountantand	NN	1
accountants	accountant	NNS	118
accountants	accountant	NNPS	61
accountants	accountant	NNP	2
accountants	accountants	NNP	2
accountants	accountants	UNC	1
accountants-www	accountants-www	NNP	2
accounted	account	VBD	161
accounted	account	VBN	115
accounted	accounted	NNP	1
accounting	account	VBG	91
accounting	accounting	NN	1446
accounting	accounting	NNP	536
accounting	accounting	UNC	2
accounting-fraud	accounting-fraud	JJ	1
accounting-oversight	accounting-oversight	JJ	1
accountingmalpractice	accountingmalpractice	NNP	1
accountingrelated	accountingrelated	JJ	1
accounts	account	NNS	908
accounts	account	NNPS	60
accounts	account	VBZ	60
accounts	account	NNP	8
accounts	accounts	UNC	3
accounts-and	accounts-and	JJ	1
accounts-and	accounts-and	NNP	1
accounts-discussed	accounts-discussed	JJ	1
accounts-to	accounts-to	JJ	1
accout	accout	NN	1
accouterment	accouterment	NN	2
accouterments	accouterment	NNS	5
accoutred	accoutred	JJ	1
accoutrements	accoutrements	NNS	12
accra	accra	NNP	12
accreditation	accreditation	NN	22
accreditation	accreditation	NNP	15
accreditation	accreditation	UNC	1
accreditations	accreditation	NNS	1
accredited	accredited	JJ	25
accrediting	accredit	VBG	5
accredits	accredit	NNS	3
accreted	accrete	VBN	2
accreting	accrete	VBG	1
accretion	accretion	NN	17
accretions	accretion	NNS	3
accross	accross	NNS	1
accrual	accrual	NN	10
accrual	accrual	NNP	2
accrue	accrue	VB	35
accrue	accrue	UNC	1
accrued	accrue	VBN	42
accrues	accrue	VBZ	8
accruing	accrue	VBG	9
acct	acct	NN	2
acctcccaaactatagattgggtg	acctcccaaactatagattgggtg	NNP	1
acctgcactc	acctgcactc	NNP	1
acctran	acctran	NNP	2
accttattttaaaaataaagttaa	accttattttaaaaataaagttaa	NNP	1
accttggaagaaccaaatc	accttggaagaaccaaatc	NNP	1
accu	accu	NN	1
accucam	accucam	NNP	1
accueillir	accueillir	NN	1
accugel	accugel	NNP	1
acculturated	acculturated	JJ	3
acculturating	acculturate	VBG	2
acculturation	acculturation	NN	6
acculturation	acculturation	NNP	1
accumbens	accumben	NNS	5
accumbens	accumbens	UNC	1
accumen	accuman	NN	1
accummulated	accummulated	JJ	1
accumulate	accumulate	VBP	169
accumulated	accumulate	VBN	200
accumulated	accumulated	NNP	3
accumulates	accumulate	NNS	60
accumulating	accumulate	VBG	73
accumulating	accumulating	NNP	7
accumulation	accumulation	NN	483
accumulation	accumulation	NNP	4
accumulations	accumulation	NNS	16
accumulations	accumulation	NNP	2
accumulative	accumulative	JJ	1
accumulators	accumulator	NNS	2
accupressure	accupressure	NN	2
accur	accur	NN	1
accurac	accurac	NN	1
accuracies	accuracy	NNS	7
accuracy	accuracy	NN	642
accuracy	accuracy	NNP	25
accuracy-the	accuracy-the	JJ	1
accuradio	accuradio	NNP	2
accurate	accurate	JJ	868
accurate	accurate	NNP	28
accurate	accurate	UNC	3
accurately	accurately	RB	366
accurately	accurately	UNC	2
accurately	accurately	NNP	2
accuratelymodel	accuratelymodel	NN	1
accuray	accuray	NN	1
accurist	accurist	NNP	1
accurs	accur	NNS	1
accursed	accursed	JJ	2
accursed	accursed	NNP	1
accus	accus	NN	1
accusation	accusation	NN	108
accusation	accusation	NNP	1
accusational	accusational	NN	1
accusations	accusation	NNS	202
accusations	accusation	NNP	6
accusations	accusations	UNC	3
accusative	accusative	JJ	6
accusatory	accusatory	JJ	9
accuse	accuse	VBP	75
accuse	accuse	VB	69
accuse	accuse	NNP	2
accused	accuse	VBN	575
accused	accuse	VBD	304
accused	accused	NNP	21
accused	accused	UNC	2
accuser	accuser	NN	31
accuser	accuser	UNC	1
accusers	accuser	NNS	25
accuses	accus	NNP	1
accuses	accusee	VBZ	109
accuses	accuses	UNC	1
accusing	accuse	VBG	151
accusing	accusing	NNP	2
accusing	accusing	UNC	1
accusingly	accusingly	RB	4
accusitive	accusitive	JJ	3
accustom	accustom	NN	3
accustomed	accustom	VBN	142
accustomed	accustomed	JJ	6
accustomed	accustomed	NNP	1
accutron	accutron	NNP	20
accutrons	accutron	NNP	4
accuvue	accuvue	NNP	1
accuweather	accuweather	NNP	4
accuzyme	accuzyme	NNP	1
accytnarggt	accytnarggt	NNP	1
acd	acd	NNP	8
acdcrocks	acdcrock	NNS	1
ace	ace	NNP	87
ace	ace	NN	75
ace-i	ace-us	NNP	4
ace-inhibitor	ace-inhibitor	NNP	2
ace-inhibitors	ace-inhibitor	NNP	7
acea	acea	NNP	1
acebuche	acebuche	NNP	1
acecray	acecray	NN	1
aced	aced	JJ	6
acedb	acedb	NNP	6
aceee	aceee	NNP	3
aceh	aceh	NNP	14
acehnese	acehnese	NNP	4
aceisms	aceism	NNP	2
aceitunasoliveslangostaspiny	aceitunasoliveslangostaspiny	NN	1
acela	acelum	NNP	10
acellular	acellular	NN	1
acentric	acentric	JJ	1
aceous	aceous	NNP	1
acequia	acequium	NN	1
acer	acer	NNP	4
aceralia	aceralium	NNP	1
acerbic	acerbic	JJ	14
acerbity	acerbity	NN	1
acert	acert	NNP	1
aces	ace	VBZ	30
aces	ace	NNP	9
acess	acess	NNS	1
acesulfame	acesulfame	NN	2
acetabularia	acetabularium	NNP	4
acetabulum	acetabulum	NN	2
acetaminophen	acetaminophen	NN	14
acetaminophen	acetaminophen	NNP	1
acetate	acetate	NN	180
acetate	acetate	NNP	10
acetates	acetate	NNS	1
acetazolamide	acetazolamide	NN	23
acetazolamide	acetazolamide	NNP	3
acetazolamide-induced	acetazolamide-induced	JJ	1
acetazolamide-induced	acetazolamide-induced	NNP	1
acetic	acetic	JJ	49
acetic	acetic	NNP	1
acetivorans	acetivoran	NNS	4
acetobutylicum	acetobutylicum	NN	13
acetol	acetol	NN	1
acetomeniphin	acetomeniphin	NN	1
acetominophen	acetominophen	NN	1
acetone	acetone	NN	41
acetone	acetone	NNP	3
acetone-dried	acetone-dried	JJ	5
acetone-dry	acetone-dry	JJ	1
acetonitrile	acetonitrile	NN	22
acetonitrile	acetonitrile	NNP	1
acetoxylmethyl	acetoxylmethyl	NN	1
acetoxymethyl	acetoxymethyl	NN	8
acetoxymethylester	acetoxymethylester	NN	2
acetyl	acetyl	NN	64
acetyl-leu-leu-norleucinal	acetyl-leu-leu-norleucinal	JJ	1
acetyl-leucyl-leucyl-norleucinal	acetyl-leucyl-leucyl-norleucinal	NNP	1
acetyl-leucyl-leucyl-norleucinal	acetyl-leucyl-leucyl-norleucinal	JJ	1
acetyl-transferase	acetyl-transferase	JJ	1
acetyl-transferases	acetyl-transferase	JJ	1
acetylase	acetylase	NN	2
acetylated	acetylated	JJ	20
acetylation	acetylation	NN	33
acetylbarlerin	acetylbarlerin	NN	1
acetylcholine	acetylcholine	NN	69
acetylcholine	acetylcholine	NNP	4
acetylcholine-mediated	acetylcholine-mediated	JJ	1
acetylcholine-stimulated	acetylcholine-stimulated	JJ	1
acetylcholinesterase	acetylcholinesterase	NN	4
acetylcysteine	acetylcysteine	NN	3
acetylenic	acetylenic	JJ	1
acetylglucosamine	acetylglucosamine	NN	1
acetylhydorolase	acetylhydorolase	NNP	1
acetyllysines	acetyllysine	NNS	1
acetylmuramate	acetylmuramate	NN	3
acetylornithine	acetylornithine	NN	1
acetyloxy	acetyloxy	NN	2
acetylsalicylic	acetylsalicylic	JJ	1
acetylserine	acetylserine	NN	1
acetylshanzhiside	acetylshanzhiside	NN	1
acetyltransferase	acetyltransferase	NN	35
acetyltransferases	acetyltransferase	NNS	3
acevedo	acevedo	NNP	3
aceves	aceve	NNP	2
acf	acf	NNP	15
acf	acf	NN	1
acfirmi	acfirmus	NNP	7
acg	acg	NNP	20
acg	acg	NN	2
acgaacagcatctcct	acgaacagcatctcct	NNP	1
acgcgcggagttggc	acgcgcggagttggc	NNP	1
acgcgttgcgtatcgcgcg	acgcgttgcgtatcgcgcg	NNP	1
acggcttttcc	acggcttttcc	NNP	1
acgme	acgme	NNP	3
acgtca	acgtca	NNP	1
acgtgc	acgtgc	NNP	1
acgttgcgagctgctgcggc	acgttgcgagctgctgcggc	NNP	2
ach	ach	NNP	80
ach	ach	NN	5
achada	achada	NNP	4
achaean	achaean	NNP	1
achaeans	achaean	NNP	3
achaiac	achaiac	NNP	1
achange	achange	NN	1
achapman	achapman	NN	2
achbp	achbp	NNP	33
ache	ache	NN	37
ache	ache	NNP	1
achebe	achebe	NNP	4
ached	ached	JJ	5
acheh	acheh	NNP	2
acheive	acheive	JJ	3
acheived	acheived	JJ	3
acheivement	acheivement	NN	2
achenbach	achenbach	NNP	4
aches	ache	NNS	27
acheson	acheson	NNP	52
achey	achey	NN	11
acheyness	acheyness	NNS	1
achh	achh	NNP	1
achiasmatic	achiasmatic	JJ	22
achievable	achievable	JJ	33
achievable	achievable	NNP	3
achieve	achieve	VB	877
achieve	achieve	VBP	60
achieve	achieve	NNP	11
achieved	achieve	VBN	615
achieved	achieve	VBD	152
achieved	achieved	NNP	6
achieved	achieved	UNC	2
achieved-can	achieved-can	JJ	1
achievedby	achievedby	NN	1
achievement	achievement	NN	331
achievement	achievement	NNP	19
achievement	achievement	JJ	2
achievement	achievement	UNC	1
achievements	achievement	NNS	154
achievements	achievement	NNP	15
achievements	achievements	UNC	3
achiever	achiever	NN	3
achiever	achiever	NNP	1
achievers	achiever	NNS	9
achievers	achievers	UNC	1
achieves	achieve	VBZ	67
achieves	achieve	NNP	1
achieves	achieves	NN	1
achieving	achieve	VBG	279
achieving	achieving	NNP	28
achieving	achieving	UNC	1
achille	achille	NNP	1
achillea	achillea	NN	1
achilles	achille	NNP	41
achilles	achille	NNS	2
aching	ache	VBG	42
achingly	achingly	RB	6
achingly-long	achingly-long	JJ	1
achiron	achiron	NNP	1
achives	achive	NNS	1
achla	achlum	NNP	1
achlamu	achlamu	NNP	1
achmed	achmed	NNP	38
achner	achner	NN	1
achomawi	achomawus	NNP	2
achomawi	achomawus	NN	1
achondroplastic	achondroplastic	UNC	1
achoo	achoo	NN	1
achos	acho	NNS	1
achr	achr	NNP	26
achromatic	achromatic	JJ	1
achromatopic	achromatopic	JJ	1
achromatopsia	achromatopsia	UNC	1
achromatopsia	achromatopsium	NN	1
achrs	achr	NNP	13
acht	acht	NNP	1
achterburg	achterburg	NNP	1
achtgroschenjunge	achtgroschenjunge	NNP	2
achtung	achtung	NNP	3
achy	achy	NN	6
achy	achy	NNP	1
aci	aci	NN	1
aci	acus	NNP	113
acid	acid	NN	2030
acid	acid	NNP	105
acid	acid	UNC	2
acid	acid	JJ	1
acid-albumin-dextrose-catalase	acid-albumin-dextrose-catalase	JJ	1
acid-alcohol-formalin	acid-alcohol-formalin	JJ	1
acid-base	acid-base	JJ	3
acid-based	acid-based	JJ	5
acid-binding	acid-binding	JJ	4
acid-blooded	acid-blooded	JJ	1
acid-citrate-dextrose	acid-citrate-dextrose	JJ	1
acid-containing	acid-containing	JJ	1
acid-denatured	acid-denatured	JJ	1
acid-fast	acid-fast	JJ	4
acid-filled	acid-filled	JJ	1
acid-free	acid-free	JJ	2
acid-induced	acid-induced	JJ	4
acid-long	acid-long	JJ	1
acid-mediated	acid-mediated	JJ	2
acid-nucleotide	acid-nucleotide	JJ	1
acid-phenol	acid-phenol	JJ	1
acid-phosphate	acid-phosphate	JJ	1
acid-reactive	acid-reactive	JJ	2
acid-rich	acid-rich	JJ	1
acid-soaked	acid-soaked	JJ	1
acid-stable	acid-stable	JJ	1
acid-stimulated	acid-stimulated	JJ	1
acid-tolerant	acid-tolerant	JJ	3
acid-tolerant	acid-tolerant	NNP	1
acid-tongued	acid-tongued	JJ	2
acid-transporting	acid-transporting	JJ	2
acid-treated	acid-treated	JJ	8
acid-tris	acid-tri	JJ	2
acid-urea	acid-urea	JJ	2
acid-washing	acid-washing	JJ	1
acid-worded	acid-worded	JJ	1
acidarmanus	acidarmanus	JJ	1
acidemia	acidemium	NN	4
acidemias	acidemia	NNS	2
acidic	acidic	JJ	167
acidic	acidic	NNP	4
acidification	acidification	NN	14
acidification	acidification	NNP	3
acidified	acidify	VBN	13
acidify	acidify	NN	2
acidimetry	acidimetry	NN	1
acidiphilum	acidiphilum	NNP	1
acidithiobacillus	acidithiobacillus	NNP	1
acidity	acidity	NN	37
acidly	acidly	RB	4
acidogenic	acidogenic	JJ	1
acidop	acidop	NN	1
acidophilous	acidophilous	JJ	1
acidophilum	acidophilum	NN	35
acidophiluma-atpase	acidophiluma-atpase	JJ	1
acidophilumintein	acidophilumintein	NN	1
acidophilus	acidophilus	JJ	4
acidopholus	acidopholus	JJ	1
acidosis	acidosis	NNS	27
acidosis	acidosis	NNP	1
acids	acid	NNS	1075
acids	acid	NNP	4
acids	acids	UNC	3
aciduria	acidurium	NN	18
acid–	acid–	NN	2
acid–glutamic	acid–glutamic	JJ	1
acid–leucine	acid–leucine	NN	1
acinar	acinar	NN	4
acinetobacter	acinetobacter	NNP	12
acing	ace	VBG	3
acing	acing	NNP	1
acini	acinus	NN	14
acipenser	acipenser	NNP	3
acipenseriformes	acipenseriform	NNP	2
acis	aci	NNP	1
acitivy	acitivy	NN	1
acitotinase	acitotinase	NN	1
acitrate	acitrate	NN	1
aciv	aciv	NNP	1
ack	ack	NNP	72
ack	ack	NN	9
ackab	ackab	NN	3
ackee	ackee	NN	4
acker	acker	NNP	33
ackerly	ackerly	NNP	2
ackerman	ackerman	NNP	13
ackermann	ackermann	NNP	9
ackil	ackil	NNP	3
ackland	ackland	NNP	1
acklins	acklin	NNP	4
acknolwedge	acknolwedge	NN	1
acknowledge	acknowledge	VB	165
acknowledge	acknowledge	VBP	116
acknowledge	acknowledge	UNC	1
acknowledge	acknowledge	NNP	1
acknowledged	acknowledge	VBD	332
acknowledged	acknowledge	VBN	114
acknowledged	acknowledged	JJ	1
acknowledgedly	acknowledgedly	RB	1
acknowledgement	acknowledgement	NN	38
acknowledgement	acknowledgement	NNP	2
acknowledgements	acknowledgement	NNP	10
acknowledgements	acknowledgement	NNS	7
acknowledges	acknowledge	VBZ	134
acknowledges	acknowledge	NNP	1
acknowledges	acknowledges	UNC	1
acknowledging	acknowledge	VBG	96
acknowledging	acknowledging	NNP	8
acknowledgment	acknowledgment	NN	46
acknowledgment	acknowledgment	UNC	3
acknowledgment	acknowledgment	NNP	2
acknowledgments	acknowledgment	NNS	10
acknowledgments	acknowledgment	NNP	9
acknowlnotes	acknowlnote	NN	1
ackroyd	ackroyd	NNP	6
acl	acl	NNP	17
acl	acl	NN	4
acland	acland	NNP	1
acleod	acleod	NN	1
aclivmfy	aclivmfy	NNP	2
acls	acl	NNP	2
aclu	aclu	NNP	48
aclu	aclu	UNC	1
acly	acly	NNP	10
acm	acm	NNP	14
acmb	acmb	NNP	9
acmb-like	acmb-like	NNP	2
acme	acme	NNP	8
acme	acme	NN	2
acmed	acmed	NNP	1
acmepet	acmepet	NNP	1
acmm	acmm	NNP	1
acmnpv	acmnpv	NNP	4
acn	acn	NNP	2
acnab	acnab	NN	4
acne	acne	NN	8
acne	acne	NNP	1
acne-free	acne-free	JJ	1
acno	acno	NN	1
acnv	acnv	NNP	1
aco	aco	NNP	2
acoa	acoa	NNP	2
acocella	acocellum	NNP	2
acocmplish	acocmplish	NN	1
acoel	acoel	NN	1
acoelomate	acoelomate	NN	1
acog	acog	NN	2
acog	acog	NNP	1
acoh	acoh	NNP	1
acolman	acolman	NNP	1
acolyte	acolyte	NN	7
acolytes	acolyte	NNS	13
acoma	acoma	NNP	4
acombined	acombined	JJ	1
acompany	acompany	NNP	1
acompared	acompared	NNP	1
acompares	acompare	NNP	1
acondition	acondition	NN	1
aconfession	aconfession	NNP	1
aconfirms	aconfirm	NNP	1
aconi	aconi	NN	1
aconicitrate	aconicitrate	NN	1
aconitase	aconitase	NN	11
aconitase	aconitase	NNP	1
aconite	aconite	NN	1
acononate	acononate	NN	1
acord	acord	NNP	1
acorn	acorn	NN	7
acorn	acorn	NNP	2
acorn-shape	acorn-shape	JJ	1
acorns	acorn	NNS	6
acosta	acosta	NNP	5
acosts	acost	NNS	1
acoustic	acoustic	JJ	72
acoustic	acoustic	NNP	8
acoustical	acoustical	JJ	5
acoustical	acoustical	NNP	1
acoustically	acoustically	RB	9
acoustics	acoustic	NNS	42
acoustics	acoustic	NNP	1
acoustiguide	acoustiguide	NN	1
acoustra	acoustra	NNP	1
acovers	acover	NNS	1
acp	acp	NNP	9
acpa	acpa	NN	2
acps	acp	NNP	1
acq	acq	NNP	1
acqua	acqua	NN	1
acquaint	acquaint	NN	5
acquaintance	acquaintance	NN	88
acquaintance	acquaintance	NNP	1
acquaintances	acquaintance	NNS	49
acquaintances	acquaintance	NNP	7
acquaintanceship	acquaintanceship	NN	1
acquaintanceships	acquaintanceship	NNS	1
acquainted	acquaint	VBN	59
acquainted	acquainted	NNP	1
acquainting	acquaint	VBG	1
acquaints	acquaint	NNS	1
acquiesce	acquiesce	VB	4
acquiesced	acquiesce	VBD	9
acquiescence	acquiescence	NN	12
acquiescent	acquiescent	NN	3
acquiesces	acquiesce	NNS	1
acquiescing	acquiesce	VBG	3
acquiesence	acquiesence	NN	1
acquire	acquire	VB	319
acquire	acquire	NN	13
acquire	acquire	NNP	5
acquire	acquire	UNC	2
acquireagency	acquireagency	NN	1
acquired	acquire	VBN	499
acquired	acquire	VBD	207
acquired	acquired	JJ	2
acquired	acquired	UNC	1
acquiree	acquiree	NN	1
acquirees	acquiree	NNS	1
acquirer	acquirer	NN	7
acquirers	acquirer	NNS	5
acquires	acquire	VBZ	24
acquires	acquire	NNP	1
acquiring	acquire	VBG	182
acquiring	acquiring	NNP	14
acquisition	acquisition	NN	642
acquisition	acquisition	NNP	144
acquisition-driven	acquisition-driven	JJ	1
acquisition-in-process	acquisition-in-process	JJ	1
acquisitionas	acquisitiona	NNS	1
acquisitionofficials	acquisitionofficial	NNS	1
acquisitions	acquisition	NNS	142
acquisitions	acquisitions	UNC	1
acquisitive	acquisitive	JJ	4
acquisitiveness	acquisitiveness	NNS	3
acquit	acquit	VB	18
acquits	acquit	NNS	3
acquits	acquit	NNP	1
acquittal	acquittal	NN	46
acquittal	acquittal	UNC	1
acquittal	acquittal	NNP	1
acquittals	acquittal	NNS	8
acquitted	acquit	VBN	60
acquitted	acquitted	NNP	2
acquitted	acquitted	UNC	1
acquitting	acquit	VBG	4
acqusitive	acqusitive	JJ	1
acr	acr	NNP	32
acr	acr	NN	1
acral	acral	NN	2
acrasin	acrasin	NN	2
acre	acre	NN	231
acre	acre	NNP	23
acreage	acreage	NN	18
acreage	acreage	NNP	1
acreman	acreman	NN	1
acres	acre	NNS	395
acres	acre	NNP	17
acres	acres	UNC	1
acrid	acrid	NN	13
acridine	acridine	NN	13
acrimonious	acrimonious	JJ	9
acrimony	acrimony	NN	10
acrimony	acrimony	NNP	1
acrisius	acrisius	NNP	2
acritude	acritude	NN	1
acro	acro	NN	2
acrobat	acrobat	NNP	13
acrobat	acrobat	NN	7
acrobatic	acrobatic	JJ	17
acrobatic	acrobatic	NNP	2
acrobatically	acrobatically	RB	2
acrobatics	acrobatics	NNS	12
acrobatics	acrobatics	NNP	3
acrobats	acrobat	NNS	4
acrobats	acrobat	NNP	4
acrocentric	acrocentric	JJ	4
acrocentrics	acrocentric	NNS	1
acrocomia	acrocomium	NNP	2
acrocorinth	acrocorinth	NNP	1
acrolein	acrolein	NN	1
acromegaly	acromegaly	RB	4
acronical	acronical	JJ	1
acronym	acronym	NN	76
acronym	acronym	NNP	6
acronym	acronym	JJ	1
acronym-farm	acronym-farm	NNP	1
acronymalicious	acronymalicious	JJ	1
acronymed	acronymed	JJ	2
acronymic	acronymic	JJ	2
acronymized	acronymized	JJ	1
acronyms	acronym	NNS	56
acronyms	acronym	NNP	6
acronyms	acronyms	UNC	1
acropolis	acropoli	NNP	49
acropolis	acropoli	NNS	3
acropper	acropper	NN	1
acros	acro	NNS	1
acrosomal	acrosomal	NN	1
acrosome	acrosome	NN	1
across	across	IN	4338
across	across	UNC	8
across	across	RP	6
across	across	NNP	6
across-array	across-array	JJ	1
across-array-design	across-array-design	JJ	1
across-sites	across-site	JJ	1
across-study	across-study	NNP	4
across-the-board	across-the-board	JJ	31
across-the-board-pay	across-the-board-pay	JJ	1
across-the-top	across-the-top	JJ	2
acrosss	acrosss	NNS	1
acrossthe	acrossthe	NN	1
acrostic	acrostic	JJ	3
acrostics	acrostic	NNS	2
acrostics	acrostic	NNP	1
acrybp	acrybp	NNP	1
acrydite	acrydite	NN	1
acrylamide	acrylamide	NN	22
acrylamide-urea	acrylamide-urea	JJ	1
acrylate	acrylate	NN	1
acrylic	acrylic	JJ	9
acrylic	acrylic	NNP	2
acrylics	acrylic	NNS	1
acr­oss	acr­oss	NNS	1
acs	ac	NNP	59
acs-grade	acs-grade	NNP	1
acse	acse	NN	4
acse-hp	acse-hp	JJ	4
acsension	acsension	NNP	1
acsf	acsf	NNP	6
acshun	acshun	NN	1
acsp	acsp	NNP	1
act	act	NNP	2070
act	act	NN	1117
act	act	VB	671
act	act	VBP	176
act	act	UNC	12
act	act	JJ	1
act-containing	act-containing	JJ	2
act-expressing	act-expressing	JJ	2
act-like	act-like	NNP	1
act-strategic	act-strategic	NNP	1
act-up-style	act-up-style	NNP	1
act-which	act-which	NNP	4
acta	acta	NN	20
acta	acta	NNP	2
acta-dependent	acta-dependent	NNP	2
actaatgctag	actaatgctag	NNP	1
actaea	actaea	NNP	6
actaeas	actaea	NNS	1
actaeon	actaeon	NNP	2
actagtctcgagt	actagtctcgagt	NNP	1
actastrains	actastrain	NNS	1
actate	actate	NN	1
actb	actb	NNP	4
actccaaggctctcaacgaa	actccaaggctctcaacgaa	NNP	1
actd	actd	NNP	7
acted	act	VBD	255
acted	act	VBN	104
acted	acted	UNC	1
actess	actess	NNS	1
acteylated	acteylated	JJ	1
actgacgaattcagccaccatggcgctcctgctgtgc	actgacgaattcagccaccatggcgctcctgctgtgc	NNP	1
actgattttg	actgattttg	NNP	1
actgcgaagatccactga	actgcgaagatccactga	NNP	1
actggt	actggt	NNP	1
actgtg	actgtg	NNP	1
actgtggctactcagctgtg	actgtggctactcagctgtg	NNP	1
acth	acth	NNP	41
actifed	actifed	NNP	1
actillume	actillume	NNP	5
actin	actin	NN	395
actin	actin	NNP	14
actin-?-galactosidase	actin-?-galactosidase	JJ	1
actin-activated	actin-activated	JJ	2
actin-associated	actin-associated	JJ	1
actin-based	actin-based	JJ	12
actin-based	actin-based	NNP	1
actin-binding	actin-binding	JJ	17
actin-containing	actin-containing	JJ	1
actin-cytoskeletal	actin-cytoskeletal	JJ	1
actin-dependent	actin-dependent	JJ	3
actin-depolymerizing	actin-depolymerizing	JJ	1
actin-filament	actin-filament	JJ	1
actin-filled	actin-filled	JJ	1
actin-fragmin	actin-fragmin	JJ	1
actin-like	actin-like	JJ	1
actin-modulating	actin-modulating	JJ	1
actin-myosin	actin-myosin	JJ	5
actin-rich	actin-rich	JJ	3
acting	act	VBG	849
acting	acting	NN	138
acting	acting	NNP	31
acting	acting	UNC	9
acting-class	acting-class	JJ	2
acting-out	acting-out	JJ	2
acting-wise	acting-wise	JJ	4
actinic	actinic	JJ	7
actinic	actinic	NNP	1
actinide	actinide	NNP	1
actinin	actinin	NNP	1
actinobacillus	actinobacillus	NNP	1
actinobacteria	actinobacterium	NNP	5
actinobacteria	actinobacterium	NN	2
actinobacterial	actinobacterial	NN	1
actinomycetales	actinomycetale	NNP	2
actinomycete	actinomycete	NN	3
actinomycete	actinomycete	NNP	1
actinomycetemcomitans	actinomycetemcomitan	NNS	2
actinomycetes	actinomycete	NNS	4
actinomycetes	actinomycete	NNP	4
actinomycetes	actinomycetes	NNP	1
actinomycin	actinomycin	NN	16
actinomycin	actinomycin	NNP	2
actinomycin-based	actinomycin-based	JJ	1
actinopterygian	actinopterygian	NN	2
actinopterygians	actinopterygian	NNS	1
actinopterygii	actinopterygius	NNP	1
actinorhodin	actinorhodin	NN	1
actins	actin	NNS	1
actin–myosin	actin–myosin	NN	1
action	action	NN	2939
action	action	NNP	220
action	action	UNC	12
action-adventure	action-adventure	JJ	4
action-and-doing	action-and-doing	JJ	2
action-and-goal	action-and-goal	JJ	1
action-comedy	action-comedy	JJ	1
action-figure	action-figure	JJ	3
action-filled	action-filled	JJ	1
action-film	action-film	JJ	1
action-movie	action-movie	NNP	1
action-oriented	action-oriented	JJ	2
action-packed	action-packed	JJ	9
action-performance	action-performance	JJ	1
action-plan	action-plan	JJ	1
action-related	action-related	JJ	1
action-the	action-the	JJ	1
action-thriller	action-thriller	JJ	1
actionable	actionable	JJ	20
actionalert	actionalert	NN	1
actioner	actioner	NN	1
actioners	actioner	NNS	1
actionless	actionless	JJ	1
actionmeasurement	actionmeasurement	NN	2
actions	action	NNS	1169
actions	action	NNP	54
actions	actions	UNC	5
actions-spending	actions-spending	JJ	1
actiony	actiony	NN	1
activa	activa	NNP	4
activase	activase	NN	2
activatable	activatable	JJ	1
activate	activate	VBP	319
activate	activate	NNP	2
activated	activate	VBN	773
activated	activated	NNP	36
activates	activate	NNS	140
activates	activate	NNP	1
activating	activate	VBG	109
activating	activating	NNP	2
activation	activation	NN	1684
activation	activation	NNP	66
activation-induced	activation-induced	JJ	13
activation-regulated	activation-regulated	JJ	1
activation-related	activation-related	JJ	1
activations	activation	NNS	1
activations	activation	NNP	1
activationâ	activationâ	NN	1
activator	activator	NN	127
activator	activator	NNP	3
activators	activator	NNS	71
activats	activat	NNS	1
active	active	JJ	1693
active	active	NNP	7
active-control	active-control	JJ	1
active-controlled	active-controlled	JJ	3
active-duty	active-duty	JJ	15
active-site	active-site	JJ	10
actively	actively	RB	279
actively	actively	UNC	2
actively-traded	actively-traded	JJ	1
activelytraded	activelytraded	JJ	1
activeperl	activeperl	NNP	1
actives	active	NNS	3
actives	active	NNP	1
activestate	activestate	NNP	1
activewear	activewear	NNP	1
activewear	activewear	NN	1
activex	activex	NNP	9
activie	activie	NN	1
activies	activy	NNS	1
activin	activin	NN	5
activision	activision	NNP	1
activism	activism	NN	77
activism	activism	NNP	1
activist	activist	NN	165
activist	activist	NNP	6
activist	activist	JJ	1
activists	activist	NNS	256
activists	activists	JJ	1
activites	activite	NNS	1
activities	activities	UNC	7
activities	activities	NNP	2
activities	activity	NNS	2104
activities	activity	NNPS	85
activities	activity	NNP	1
activities-taking	activities-taking	JJ	1
activities-terrorist	activities-terrorist	JJ	1
activity	activity	NN	4286
activity	activity	UNC	12
activity	activity	NNP	6
activity-based	activity-based	JJ	4
activity-based	activity-based	NNP	1
activity-center	activity-center	JJ	1
activity-dependent	activity-dependent	JJ	9
activity-dependent	activity-dependent	NNP	2
activity-independent	activity-independent	JJ	2
activity-induced	activity-induced	JJ	1
activity-labeling	activity-labeling	JJ	1
activity-plasmid	activity-plasmid	JJ	1
activity-regarded	activity-regarded	JJ	1
activitybased	activitybased	JJ	1
activization	activization	NNP	1
activty	activty	NN	1
actly	actly	RB	1
actmutation	actmutation	NN	1
acto	acto	NN	2
actof	actof	NNP	2
actogram	actogram	NN	2
actograms	actogram	NNS	2
actograms	actogram	NNP	1
actomyosin	actomyosin	NN	11
acton	acton	NNP	19
actonel	actonel	NNP	3
actor	actor	NN	768
actor	actor	NNP	53
actor	actor	UNC	4
actor-director	actor-director	JJ	3
actor-director	actor-director	NNP	1
actor-director-writer	actor-director-writer	NNP	1
actor-essayist-blogger	actor-essayist-blogger	JJ	1
actor-lossage	actor-lossage	JJ	1
actor-politician	actor-politician	JJ	1
actorboy	actorboy	NN	1
actorcasting	actorcast	VBG	1
actors	actor	NNS	653
actors	actor	NNP	40
actors	actors	UNC	9
actors	actors	JJ	1
actors-playing-the-same-characters	actors-playing-the-same-character	JJ	1
actors-turned-directors	actors-turned-director	JJ	1
actory	actory	NN	2
actos	acto	NNS	3
actovegin	actovegin	NNP	1
actprotein	actprotein	NN	1
actr	actr	NNP	5
actr	actr	NN	1
actr-i	actr-us	NNP	1
actr-ii	actr-ius	NNP	1
actress	actress	NN	440
actress	actress	NNP	27
actress	actress	JJ	3
actress	actress	UNC	2
actress-waitress	actress-waitress	JJ	2
actresses	actress	NNS	85
actresses	actress	NNP	2
actresses	actresses	UNC	3
actresss	actresss	NNS	1
actressy	actressy	NN	1
acts	act	NNS	607
acts	act	VBZ	88
acts	act	NNP	64
acts	acts	UNC	4
actttggatcattctatgcag	actttggatcattctatgcag	NNP	1
actu	actu	NN	1
actua	actua	NN	1
actual	actual	JJ	1935
actual	actual	NNP	9
actual	actual	UNC	2
actual	actual	NN	1
actual-vampire-seeing-and-slaying	actual-vampire-seeing-and-slaying	JJ	1
actuality	actuality	NN	9
actualize	actualize	NN	1
actualized	actualized	JJ	2
actually	actually	RB	9366
actually	actually	UNC	23
actually	actually	NNP	10
actually	actually	JJ	3
actually	actually	NN	2
actuallyl	actuallyl	NN	1
actuals	actual	NNS	1
actualy	actualy	RB	3
actualy	actualy	NNP	1
actuarial	actuarial	JJ	37
actuarial	actuarial	NNP	12
actuarial-based	actuarial-based	JJ	1
actuaries	actuary	NNS	19
actuaries	actuary	NNP	3
actuaristas	actuarista	NNS	2
actuary	actuary	NN	13
actuary	actuary	NNP	12
actuates	actuate	NNS	2
actuator	actuator	NN	6
actuators	actuator	NNS	1
actully	actully	RB	1
actus	actus	JJ	2
actwas	actwa	NNP	1
actwith	actwith	NN	2
actwu	actwu	UNC	1
acuesta	acuesta	NN	2
acuestén	acuestén	NN	1
acuff	acuff	NNP	1
acuity	acuity	NN	18
aculeatus	aculeatus	JJ	1
acumen	acumen	NN	29
acuolation	acuolation	NN	1
acupressure	acupressure	NN	2
acupuncture	acupuncture	NN	15
acupuncture	acupuncture	NNP	1
acupuncturist	acupuncturist	NN	1
acupuncturists	acupuncturist	NNS	2
acura	acura	NNP	11
acure	acure	NNP	1
acutally	acutally	NNP	4
acutally	acutally	RB	1
acute	acute	JJ	716
acute	acute	NNP	83
acute-care	acute-care	JJ	3
acute-phase	acute-phase	JJ	3
acutee	acutee	NN	1
acutely	acutely	RB	48
acutely	acutely	NNP	2
acuto	acuto	NNP	1
acuview	acuview	NNP	1
acuvue	acuvue	NNP	4
acuvue-vision	acuvue-vision	NNP	2
acuático	acuático	NNP	1
acuña	acuña	NNP	2
acv	acv	NNP	40
acv-resistant	acv-resistant	NNP	2
acv-susceptible	acv-susceptible	NNP	1
acvb	acvb	NNP	4
acvtivated	acvtivated	JJ	1
acyclic	acyclic	JJ	5
acyclovir	acyclovir	NN	3
acyclovir	acyclovir	NNP	2
acyl	acyl	NN	27
acyl	acyl	NNP	1
acyl-acyl	acyl-acyl	JJ	1
acyl-chain	acyl-chain	JJ	1
acyl-enzyme	acyl-enzyme	JJ	1
acylation	acylation	NN	1
acylcarnitine	acylcarnitine	NN	2
acylcarnitines	acylcarnitine	NNS	3
acylethanolamine	acylethanolamine	NN	2
acylethanolamines	acylethanolamine	NNS	1
acylglycerophospho-ethanolamine	acylglycerophospho-ethanolamine	JJ	1
acyltransferase	acyltransferase	NN	3
acyltransferases	acyltransferase	NNS	1
acyrthosiphon	acyrthosiphon	NNP	2
acá	acá	NNP	1
acánsa	acánsa	NNP	1
ad	ad	NN	1230
ad	ad	NNP	410
ad	ad	UNC	5
ad	ad	JJ	2
ad-adsx	ad-adsx	NNP	5
ad-based	ad-based	JJ	1
ad-busting	ad-busting	JJ	1
ad-column	ad-column	NNP	4
ad-daar	ad-daar	JJ	1
ad-driven	ad-driven	JJ	1
ad-e	ad-e	NNP	8
ad-exec	ad-exec	JJ	1
ad-free	ad-free	JJ	2
ad-git	ad-git	NNP	1
ad-hoc	ad-hoc	JJ	6
ad-in	ad-in	JJ	1
ad-laden	ad-laden	JJ	1
ad-lib	ad-lib	JJ	3
ad-libbed	ad-libbed	JJ	1
ad-libbing	ad-libbing	JJ	1
ad-libitum	ad-libitum	JJ	1
ad-libs	ad-lib	JJ	1
ad-m	ad-m	NNP	55
ad-maker	ad-maker	JJ	1
ad-makers	ad-maker	JJ	2
ad-nad	ad-nad	NNP	2
ad-prey	ad-prey	NNP	1
ad-revenue-sharing	ad-revenue-sharing	JJ	1
ad-sales	ad-sale	JJ	1
ad-serving	ad-serving	JJ	1
ad-skipping	ad-skipping	JJ	3
ad-snatchers	ad-snatcher	JJ	1
ad-supported	ad-supported	JJ	1
ad-tracking	ad-tracking	JJ	1
ad-transduced	ad-transduced	NNP	9
ad?	ad?	NN	1
ad?rvan	ad?rvan	NN	1
ada	ada	NNP	40
ada	ada	NN	1
adade	adade	NNP	1
adage	adage	NN	21
adages	adage	NNS	4
adagia	adagium	NNP	2
adagio	adagio	NN	1
adair	adair	NNP	5
adaja	adaja	NNP	1
adalar	adalar	NNP	1
adam	adam	NNP	428
adamance	adamance	NN	1
adamant	adamant	JJ	58
adamantium	adamantium	NNP	1
adamantly	adamantly	RB	17
adamao	adamao	NN	1
adame	adame	NNP	1
adament	adament	NN	1
adami	adamus	NNP	4
adamo	adamo	NNP	6
adamov	adamov	NNP	2
adams	adam	NNP	326
adams	adams	UNC	2
adams	adams	NNP	2
adamson	adamson	NNP	1
adamu	adamu	NNP	1
adana	adana	NNP	1
adao	adao	NNP	2
adapator	adapator	NN	1
adaped	adaped	JJ	1
adapt	adapt	VB	127
adapt	adapt	NNP	69
adapt	adapt	VBP	14
adaptability	adaptability	NN	13
adaptable	adaptable	JJ	23
adaptable	adaptable	NNP	2
adaptamer	adaptamer	NN	6
adaptamers	adaptamer	NNS	3
adaptation	adaptation	NN	234
adaptation	adaptation	NNP	9
adaptation-and	adaptation-and	NNP	1
adaptations	adaptation	NNS	64
adaptations	adaptation	NNP	5
adaptec	adaptec	NNP	1
adapted	adapt	VBN	209
adapted	adapt	VBD	35
adapted	adapted	UNC	3
adapted	adapted	NNP	2
adapter	adapter	NN	64
adapter	adapter	NNP	1
adapter-linked	adapter-linked	JJ	2
adapter-related	adapter-related	NNP	1
adapter-specific	adapter-specific	JJ	1
adapterized	adapterized	JJ	1
adapters	adapter	NNS	18
adapters	adapter	NNP	1
adapting	adapt	VBG	51
adapting	adapting	NNP	2
adapting	adapting	NN	1
adaption	adaption	NN	1
adaptive	adaptive	JJ	98
adaptive	adaptive	NNP	6
adaptiveha	adaptiveha	NN	3
adaptively	adaptively	RB	6
adaptivity	adaptivity	NN	1
adaptor	adaptor	NN	50
adaptor	adaptor	NNP	1
adaptor-amplified	adaptor-amplified	JJ	1
adaptor-ligated	adaptor-ligated	JJ	1
adaptor-specific	adaptor-specific	JJ	1
adaptors	adaptor	NNS	24
adapts	adapt	NNS	11
adar	adar	NNP	4
adas	ada	NNP	1
adas-cog	adas-cog	NNP	31
adas?	adas?	NN	8
adas?	adas?	NNP	1
adata	ada	NN	2
aday	aday	NNP	1
adb	adb	NNP	2
adblock	adblock	NN	1
adbul	adbul	NNP	1
adbusters	adbuster	NNP	1
adc	adc	NNP	4
adcaps	adcap	NNP	4
adcc	adcc	NNP	2
adcell	adcell	NNP	1
adco	adco	NNP	1
adcock	adcock	NNP	4
adcose	adcose	NN	1
add	add	VB	1484
add	add	VBP	274
add	add	NNP	18
add	add	UNC	4
add	add	NN	2
add-a-bead	add-a-bead	JJ	1
add-in	add-in	JJ	1
add-on	add-on	JJ	23
add-ons	add-on	JJ	4
addaia	addaium	NNP	1
addams	addam	NNP	25
addario	addario	NNP	2
adddecorations	adddecoration	NNP	1
added	add	VBD	1683
added	add	VBN	1456
added	added	JJ	40
added	added	NNP	4
added	added	UNC	3
added-soul	added-soul	JJ	1
addeled	addeled	JJ	1
addend	addend	NNP	2
addenda	addendum	NN	11
addenda	addendum	NNP	10
addends	addend	NNS	2
addendum	addendum	NN	14
addendum	addendum	NNP	5
addendums	addendum	NNS	1
adder	adder	NNP	7
adderal	adderal	NNP	1
adderall	adderall	NNP	1
adderley	adderley	NNP	1
addhighlights	addhighlight	NNP	1
addicated	addicated	JJ	1
addicition	addicition	NN	1
addict	addict	NN	62
addict	addict	NNP	9
addict	addict	UNC	1
addicted	addict	VBN	122
addicted	addicted	NNP	14
addicted	addicted	JJ	1
addicting	addict	VBG	5
addiction	addiction	NN	187
addiction	addiction	NNP	24
addiction	addiction	UNC	1
addiction-related	addiction-related	JJ	1
addictions	addiction	NNS	24
addictions	addiction	NNP	1
addictions	addictions	UNC	2
addictive	addictive	JJ	85
addictive	addictive	NNP	2
addictive	addictive	UNC	1
addictiveness	addictiveness	NNS	2
addicts	addict	NNS	64
addicts	addict	NNP	3
addicts	addicts	UNC	2
addie	addie	NNP	2
addie	addie	NN	1
addies	addy	NNS	1
adding	add	VBG	959
adding	adding	UNC	3
adding	adding	NNP	1
adding	adding	NN	1
addington	addington	NNP	1
addison	addison	NNP	45
addition	addition	NN	3722
addition	addition	NNP	44
additional	additional	JJ	4298
additional	additional	NNP	15
additionally	additionally	RB	395
additionaly	additionaly	RB	2
additionnal	additionnal	NN	1
additions	addition	NNS	87
additions	addition	NNP	4
additive	additive	JJ	129
additive	additive	NNP	2
additive-plus-multiplicative	additive-plus-multiplicative	JJ	1
additively	additively	RB	7
additives	additive	NNS	30
additives	additive	NNP	9
additivity	additivity	NN	6
additized	additized	JJ	1
additon	additon	NN	1
additonal	additonal	NN	12
addization	addization	NN	1
addizione	addizione	NNP	1
addi­tional	addi­tional	NNP	1
addle	addle	NN	1
addle-brained	addle-brained	JJ	1
addled	addled	JJ	24
addlepated	addlepated	JJ	4
addlistener	addlistener	NN	1
addo	addo	NNP	22
addopark	addopark	NN	1
address	address	VB	1121
address	address	NN	1067
address	address	NNP	368
address	address	VBP	115
address	address	UNC	6
address	address	JJ	1
address-book	address-book	JJ	1
address-change	address-change	JJ	1
addressable	addressable	JJ	2
addressc	addressc	NNP	1
addressed	address	VBN	468
addressed	address	VBD	148
addressed	addressed	NNP	12
addressed	addressed	UNC	5
addressee	addressee	NN	2
addressee	addressee	NNP	1
addressees	addressee	NNS	2
addresses	address	NNS	244
addresses	address	VBZ	121
addresses	address	NNP	13
addresses-one	addresses-one	JJ	1
addressin	addressin	NN	6
addressinformation	addressinformation	NN	1
addressing	address	VBG	336
addressing	addressing	UNC	2
addressing	addressing	NNP	1
addressins	addressin	NNS	2
addresss	addresss	NNS	1
addrln	addrln	NNP	1
adds	add	VBZ	654
adds	add	NNP	7
adds	adds	UNC	2
addsol	addsol	NNP	1
addtodesignreview	addtodesignreview	NNP	1
adduce	adduce	NN	2
adduced	adduced	JJ	10
adduces	adduce	NNS	4
adducing	adduce	VBG	4
adducins	adducin	NNS	1
adduct	adduct	NN	10
adducted	adducted	JJ	1
adducting	adduct	VBG	1
adductor	adductor	NN	1
adducts	adduct	NNS	23
adduxerunt	adduxerunt	NN	1
addy	addy	NN	54
addy	addy	NNP	2
ade	ade	NN	28
ade	ade	NNP	22
adeasy	adeasy	NNP	2
adecco	adecco	NNP	2
adecrease	adecrease	NN	1
adega	adega	NNP	2
adegas	adega	NNP	2
adeje	adeje	NNP	2
adel	adel	NNP	1
adelaide	adelaide	NNP	13
adelantado	adelantado	NNP	1
adele	adele	NNP	21
adeliae	adelia	NN	1
adelie	adelie	NNP	1
adelina	adelina	NNP	2
adelita	adelita	NNP	18
adelitas	adelita	NNP	3
adelman	adelman	NNP	3
adelphia	adelphium	NNP	69
adelson	adelson	NNP	1
adelstein	adelstein	NNP	2
adema	adema	NNP	2
ademonstrates	ademonstrate	NNS	3
aden	aden	NNP	16
adena	adena	NNP	12
adenauer	adenauer	NNP	1
adenine	adenine	NN	30
adenine	adenine	NNP	2
adenine-labeled	adenine-labeled	JJ	1
adenine-like	adenine-like	JJ	1
adenine-requiring	adenine-requiring	JJ	2
adenines	adenine	NNS	7
adeno	adeno	NN	17
adeno	adeno	NNP	2
adeno-?	adeno-?	JJ	2
adeno-?gal	adeno-?gal	JJ	3
adeno-?gal	adeno-?gal	NNP	2
adeno-associated	adeno-associated	JJ	1
adenocarcinoma	adenocarcinoma	NN	45
adenocarcinomas	adenocarcinoma	NNS	26
adenoidal	adenoidal	NN	2
adenoids	adenoids	NNS	1
adenoma	adenoma	NN	29
adenomas	adenoma	NNS	16
adenomas	adenoma	NNP	1
adenomatous	adenomatous	JJ	7
adenomatous	adenomatous	NNP	1
adenosine	adenosine	NN	51
adenosine	adenosine	NNP	1
adenosine-binding	adenosine-binding	JJ	1
adenosines	adenosine	NNS	12
adenosinetriphosphatase	adenosinetriphosphatase	NN	1
adenosis	adenosis	NNS	1
adenosylhomocysteine	adenosylhomocysteine	NN	2
adenosylmethionine	adenosylmethionine	NN	3
adenoviral	adenoviral	NN	167
adenoviral	adenoviral	NNP	15
adenoviral-mediated	adenoviral-mediated	JJ	5
adenoviral-mediated	adenoviral-mediated	NNP	1
adenoviral-resistant	adenoviral-resistant	JJ	1
adenovirally	adenovirally	RB	2
adenovirus	adenovirus	JJ	82
adenovirus	adenovirus	NNP	5
adenovirus	adenovirus	NN	1
adenovirus-based	adenovirus-based	JJ	1
adenovirus-infected	adenovirus-infected	JJ	1
adenovirus-mediated	adenovirus-mediated	JJ	11
adenovirus-microbead	adenovirus-microbead	JJ	4
adenoviruses	adenovirus	NNS	11
adenoviruses	adenovirus	NNP	2
adenylate	adenylate	NN	16
adenylate-uridylate-rich	adenylate-uridylate-rich	NNP	1
adenylated	adenylated	JJ	2
adenylates	adenylate	NNS	2
adenylation	adenylation	NN	5
adenyly	adenyly	RB	1
adenylyl	adenylyl	NN	35
adenylyl	adenylyl	NNP	1
adenylylated	adenylylated	JJ	4
adeo	adeo	NN	1
adepicts	adepict	NNS	4
adepicts	adepict	NNP	3
adept	adept	JJ	69
adept	adept	NNP	8
adeptly	adeptly	RB	3
adeptness	adeptness	NNS	1
adepts	adept	NNS	1
adequacy	adequacy	NN	42
adequacy	adequacy	NNP	3
adequate	adequate	JJ	483
adequate	adequate	NNP	13
adequate-to-great	adequate-to-great	JJ	1
adequately	adequately	RB	221
adequately	adequately	NNP	2
adescription	adescription	NN	1
adeshem	adeshem	NN	1
adesktop	adesktop	NN	1
adeus	adeus	NNP	2
adf	adf	NNP	2
adflugasdemo	adflugasdemo	NN	1
adge	adge	NNP	63
adgemicroarray	adgemicroarray	NNP	1
adger	adger	NNP	2
adh	adh	NNP	31
adh	adh	NN	1
adh-f	adh-f	NNP	1
adh-r	adh-r	NNP	1
adha	adha	NNP	1
adhd	adhd	NNP	114
adhd-obesity	adhd-obesity	NNP	1
adherants	adherant	NNS	1
adhere	adhere	VB	96
adhered	adhere	VBD	29
adherence	adherence	NN	123
adherence	adherence	NNP	4
adherens	adheren	NNS	2
adherent	adherent	NN	105
adherent	adherent	NNP	11
adherents	adherent	NNS	32
adherents	adherent	NNP	1
adheres	adhere	NNS	13
adherin	adherin	NN	1
adhering	adhere	VBG	28
adhering	adhering	NNP	1
adhesin	adhesin	NN	3
adhesins	adhesin	NNS	2
adhesion	adhesion	NN	272
adhesion	adhesion	NNP	15
adhesion-related	adhesion-related	JJ	1
adhesions	adhesion	NNS	7
adhesive	adhesive	NN	65
adhesiveness	adhesiveness	NNS	2
adhesives	adhesive	NNS	2
adhoc	adhoc	NN	4
adhoccery	adhoccery	NN	2
adhocist	adhocist	NN	1
adhr	adhr	NNP	1
adhregion	adhregion	NNP	1
adhuc	adhuc	NN	1
adhumbla	adhumblum	NNP	2
adi	adus	NNP	68
adiabatic	adiabatic	JJ	2
adiabne	adiabne	NNP	1
adiantaceae	adiantacea	NNP	2
adiantum	adiantum	NNP	2
adidas	adida	NNP	15
adieu	adieu	NN	13
adieu	adieu	NNP	6
adieus	adieus	JJ	1
adieux	adieu	NN	1
adifferent	adifferent	NNP	1
adifferent	adifferent	NN	1
adige	adige	NNP	6
adiii	adiius	NNP	2
adil	adil	NNP	5
adin	adin	NNP	3
adina	adina	NNP	3
adinath	adinath	NNP	3
adinspection	adinspection	NNP	1
adioh	adioh	NN	1
adios	adio	NNS	6
adios	adio	NNP	4
adipic	adipic	JJ	1
adipocyte	adipocyte	NN	11
adipocyte-derived	adipocyte-derived	JJ	1
adipocytes	adipocyte	NNS	26
adipocytic	adipocytic	JJ	2
adipocytic	adipocytic	NNP	2
adipogenesis	adipogenesis	NNS	2
adipogenic	adipogenic	JJ	2
adiponectin	adiponectin	NN	10
adiponectin	adiponectin	NNP	2
adipose	adipose	NN	27
adiposity	adiposity	NN	19
adirondack	adirondack	NNP	15
adirondack	adirondack	NN	2
adirondacks	adirondack	NNP	14
adirondacks	adirondack	NNS	2
adis	adi	NNP	9
adisease-detection	adisease-detection	JJ	1
aditional	aditional	NN	3
adivinanzas	adivinanza	NNP	3
adiyaman	adiyaman	NNP	1
adiós	adiós	NNS	1
adj	adj	NN	47
adj	adj	NNP	6
adjacencies	adjacency	NNS	2
adjacency	adjacency	NN	1
adjacent	adjacent	JJ	628
adjacent	adjacent	NNP	39
adjacenting	adjacent	VBG	1
adjacently	adjacently	RB	1
adjangba	adjangba	NNP	1
adjani	adjanus	NNP	2
adjectival	adjectival	NN	12
adjectivally	adjectivally	RB	4
adjective	adjective	NN	123
adjective	adjective	NNP	5
adjective-abuser	adjective-abuser	JJ	1
adjective-names	adjective-name	JJ	1
adjectives	adjective	NNS	84
adjectives	adjective	NNP	9
adjectivewise	adjectivewise	NN	1
adjectivising	adjectivise	VBG	2
adjoin	adjoin	NN	2
adjoined	adjoined	JJ	2
adjoining	adjoining	JJ	94
adjoining	adjoining	NNP	10
adjoins	adjoin	NNS	12
adjourn	adjourn	NN	14
adjourned	adjourn	VBN	11
adjourning	adjourn	VBG	3
adjournment	adjournment	NN	5
adjourns	adjourn	NNS	6
adjourns	adjourn	NNP	1
adjrun	adjrun	NN	1
adjudged	adjudged	JJ	3
adjudges	adjudge	NNS	1
adjudicate	adjudicate	NN	13
adjudicate	adjudicate	NNP	1
adjudicated	adjudicated	JJ	30
adjudicates	adjudicate	NNS	3
adjudicating	adjudicate	VBG	2
adjudication	adjudication	NN	29
adjudication	adjudication	NNP	2
adjudicative	adjudicative	JJ	4
adjudicator	adjudicator	NN	4
adjudicatory	adjudicatory	NN	3
adjudicatory	adjudicatory	NNP	1
adjunct	adjunct	NN	36
adjunct	adjunct	NNP	2
adjunctive	adjunctive	JJ	1
adjuncts	adjunct	NNS	4
adjuncts	adjunct	NNP	1
adjured	adjured	JJ	1
adjurn	adjurn	NN	1
adjust	adjust	VB	243
adjust	adjust	VBP	40
adjustability	adjustability	NN	2
adjustable	adjustable	JJ	57
adjustable	adjustable	NNP	2
adjusted	adjust	VBN	527
adjusted	adjust	VBD	80
adjusted	adjusted	NNP	16
adjusted	adjusted	JJ	3
adjusted	adjusted	UNC	1
adjusted-rates	adjusted-rate	JJ	1
adjuster	adjuster	NN	8
adjuster	adjuster	NNP	1
adjusters	adjuster	NNS	5
adjusting	adjust	VBG	159
adjusting	adjusting	NNP	11
adjusting	adjusting	NN	8
adjustment	adjustment	NN	310
adjustment	adjustment	NNP	24
adjustments	adjustment	NNS	174
adjustments	adjustment	NNP	13
adjustn	adjustn	NN	2
adjusts	adjust	VBZ	39
adjusts	adjust	NNP	1
adjustvar	adjustvar	NN	2
adjutant	adjutant	NN	3
adjuvant	adjuvant	NN	66
adjuvant	adjuvant	NNP	4
adjuvant-induced	adjuvant-induced	JJ	2
adjuvants	adjuvant	NNS	5
adkins	adkin	NNP	34
adl	adl	NNP	6
adlai	adlaus	NNP	15
adler	adler	NNP	43
adlestrop	adlestrop	NNP	11
adlestrop	adlestrop	UNC	1
adleta	adleta	NNP	1
adlon	adlon	NNP	1
adlum	adlum	NNP	2
adm	adm	NNP	28
admaker	admaker	NN	1
admakers	admaker	NNS	1
adman	adman	NN	7
adman	adman	NNP	1
adme	adme	NNP	4
admen	adman	NNS	1
admen	adman	NNP	1
admin	admin	NN	21
admin	admin	NNP	6
administaff	administaff	NN	1
administer	administer	VB	96
administer	administer	NNP	1
administered	administer	VBN	331
administered	administered	NNP	5
administering	administer	VBG	66
administering	administering	NNP	3
administers	administer	VBZ	38
administrate	administrate	NN	4
administrated	administrated	JJ	2
administrating	administrate	VBG	3
administration	administration	NN	2691
administration	administration	NNP	713
administration	administration	UNC	7
administration	administration	JJ	1
administration-sponsored	administration-sponsored	NNP	1
administrationn	administrationn	NNP	1
administrations	administration	NNS	80
administrations	administration	NNP	4
administrative	administrative	JJ	367
administrative	administrative	NNP	117
administrative-type	administrative-type	JJ	1
administratively	administratively	RB	13
administrator	administrator	NNP	479
administrator	administrator	NN	143
administrator	administrator	UNC	1
administratorand	administratorand	NNP	1
administrators	administrator	NNS	166
administrators	administrator	NNPS	15
administrators	administrators	UNC	1
administratorshall	administratorshall	NNP	4
administrivia	administrivium	NN	2
administrtation	administrtation	NN	1
admins	admin	NNS	5
adminster	adminster	NN	1
adminstration	adminstration	NNP	1
adminstration	adminstration	NN	1
adminstrator	adminstrator	NN	1
adminwise	adminwise	NN	1
adminy	adminy	NN	1
admirable	admirable	JJ	110
admirable	admirable	NNP	4
admirable	admirable	UNC	2
admirably	admirably	RB	42
admirably	admirably	NNP	2
admiral	admiral	NN	34
admiral	admiral	NNP	34
admirals	admiral	NNS	5
admirals	admiral	NNP	2
admiralty	admiralty	NNP	4
admiralty	admiralty	NN	1
admirans	admiran	NNS	1
admirari	admirarus	NN	1
admiration	admiration	NN	107
admire	admire	NN	217
admire	admire	NNP	2
admire	admire	UNC	1
admired	admire	VBN	107
admired	admire	VBD	45
admired	admired	UNC	2
admired	admired	NNP	1
admirer	admirer	NN	20
admirers	admirer	NNS	55
admires	admire	VBZ	21
admiring	admire	VBG	63
admiring	admiring	NNP	2
admiringly	admiringly	RB	10
admir­able	admir­able	JJ	1
admissibility	admissibility	NN	8
admissibility	admissibility	NNP	5
admissible	admissible	JJ	13
admission	admission	NN	498
admission	admission	NNP	36
admission	admission	UNC	2
admissions	admission	NNS	302
admissions	admission	NNP	25
admissions	admissions	UNC	3
admissions	admissions	NN	1
admissionsall	admissionsall	NNP	1
admisssions	admisssion	NNS	1
admist	admist	NNP	1
admit	admit	VB	601
admit	admit	VBP	203
admit	admit	NNP	12
admit	admit	JJ	2
admit	admit	UNC	1
admitedly	admitedly	RB	1
admitprecisely	admitprecisely	RB	1
admits	admit	VBZ	249
admits	admit	NNP	8
admits	admit	NNS	3
admits	admits	UNC	3
admittance	admittance	NN	5
admittance	admittance	NNP	1
admitted	admit	VBN	402
admitted	admit	VBD	238
admitted	admitted	UNC	3
admitted	admitted	NNP	2
admittedly	admittedly	RB	167
admittedly	admittedly	UNC	2
admittedpostoperatively	admittedpostoperatively	RB	1
admittedto	admittedto	NN	1
admittees	admittee	NNS	1
admitting	admit	VBG	136
admitting	admitting	NNP	8
admixed	admixed	JJ	1
admixture	admixture	NN	11
admixture	admixture	NNP	1
admixtures	admixture	NNS	2
admnistration	admnistration	NN	1
admonish	admonish	NN	6
admonished	admonished	JJ	22
admonishes	admonish	NNS	7
admonishes	admonish	NNP	1
admonishing	admonish	VBG	4
admonishment	admonishment	NN	2
admonition	admonition	NN	22
admonition	admonition	JJ	1
admonitione	admonitione	NN	1
admonitions	admonition	NNS	8
admonitor	admonitor	NN	1
admonitory	admonitory	NN	4
adn	adn	NN	10
adn	adn	NNP	1
adna	adna	NN	21
adnan	adnan	NNP	9
adnd	adnd	NNP	2
ado	ado	NN	9
ado	ado	NNP	6
adobe	adobe	NNP	67
adobe	adobe	NN	33
adobepdf	adobepdf	NN	1
adoberas	adobera	NNS	1
adobo	adobo	NN	1
adobo	adobo	NNP	1
adoke	adoke	NNP	1
adol	adol	NNP	5
adolesc	adolesc	NNP	3
adolescence	adolescence	NN	75
adolescence	adolescence	NNP	3
adolescence	adolescence	UNC	2
adolescencia	adolescencium	NNP	1
adolescent	adolescent	JJ	119
adolescent	adolescent	NN	19
adolescent	adolescent	NNP	2
adolescent	adolescent	UNC	1
adolescent-adventure	adolescent-adventure	JJ	1
adolescent-angsty	adolescent-angsty	JJ	1
adolescent-use	adolescent-use	JJ	1
adolescents	adolescent	NNS	109
adolescents	adolescent	NNP	10
adolescents-at-heart	adolescents-at-heart	JJ	1
adolesence	adolesence	NN	1
adolf	adolf	NNP	51
adolfo	adolfo	NNP	4
adolph	adolph	NNP	12
adolphe	adolphe	NNP	3
adolsecent	adolsecent	NN	1
adomet	adomet	NNP	5
adonais	adonai	NNP	1
adonay	adonay	NN	1
adone	adone	NN	1
adone	adone	NNP	1
adonis	adoni	NNP	5
adonitol	adonitol	NN	1
adopt	adopt	VB	262
adopt	adopt	VBP	44
adopt	adopt	NNP	8
adopt	adopt	NN	1
adopt-a	adopt-a	NNP	1
adoptable	adoptable	NNP	1
adopted	adopt	VBN	495
adopted	adopt	VBD	209
adopted	adopted	NNP	4
adopted	adopted	UNC	2
adopted-to	adopted-to	JJ	1
adoptee	adoptee	NN	1
adoptees	adoptee	NNS	3
adopter	adopter	NN	3
adopters	adopter	NNS	8
adopting	adopt	VBG	135
adoption	adoption	NN	189
adoption	adoption	NNP	10
adoption-related	adoption-related	JJ	2
adoptions	adoption	NNS	11
adoptive	adoptive	JJ	46
adoptive	adoptive	NNP	6
adoptively	adoptively	RB	7
adoptively-transferred	adoptively-transferred	JJ	1
adopts	adopt	VBZ	48
adopts	adopt	NNP	2
adopts	adopts	UNC	1
adoquín	adoquín	NNP	1
adora	adora	NNP	2
adorability	adorability	NN	3
adorable	adorable	JJ	156
adorable	adorable	NNP	12
adorable	adorable	UNC	1
adorableness	adorableness	NNS	5
adorableness	adorableness	NNP	1
adorably	adorably	RB	2
adorably	adorably	UNC	1
adorably	adorably	NNP	1
adoran	adoran	NN	1
adoration	adoration	NN	18
adoration	adoration	NNP	10
adorations	adoration	NNS	1
adorble	adorble	JJ	1
adore	adore	NN	129
adore	adore	NNP	8
adored	adored	JJ	62
adored	adored	NNP	6
adores	adore	NNS	21
adoring	adore	VBG	30
adoring	adoring	NNP	2
adoringly	adoringly	RB	2
adorn	adorn	VB	38
adorned	adorn	VBD	22
adorned	adorn	VBN	12
adorned	adorned	NNP	3
adorning	adorn	VBG	7
adornment	adornment	NN	4
adornment	adornment	NNP	1
adornments	adornment	NNS	6
adorno	adorno	NNP	10
adorns	adorn	NNS	13
adowe	adowe	NNP	1
adp	adp	NNP	49
adp-glucose	adp-glucose	NNP	1
adp-ribose	adp-ribose	NNP	1
adp-ribosylates	adp-ribosylate	NNP	1
adp-ribosylation	adp-ribosylation	NNP	14
adpase	adpase	NNP	4
adpated	adpated	JJ	1
adpativeh	adpativeh	NN	4
adpnp	adpnp	NNP	9
adprt	adprt	NNP	3
adr	adr	NNP	71
adr	adr	NN	1
adr-res	adr-re	NNP	2
adr-sensitive	adr-sensitive	NNP	1
adra	adra	NNP	2
adrelevance	adrelevance	NNP	3
adrenal	adrenal	NN	60
adrenal	adrenal	NNP	2
adrenalectomized	adrenalectomized	JJ	25
adrenalectomized	adrenalectomized	NN	1
adrenalectomized-streptozotocin-injected-ad	adrenalectomized-streptozotocin-injected-ad	JJ	1
adrenalectomized-streptozotocin-injected-fasted	adrenalectomized-streptozotocin-injected-fasted	JJ	1
adrenalectomy	adrenalectomy	NN	87
adrenalectomy	adrenalectomy	NNP	13
adrenalin	adrenalin	NN	12
adrenaline	adrenaline	NN	27
adrenaline	adrenaline	NNP	1
adrenaline-happy	adrenaline-happy	JJ	1
adrenaline-induced	adrenaline-induced	JJ	1
adrenaline-pumping	adrenaline-pumping	JJ	1
adrenaline-rush	adrenaline-rush	JJ	1
adrenaline-soaked	adrenaline-soaked	JJ	1
adrenaline-swamped	adrenaline-swamped	JJ	1
adrenals	adrenal	NNS	1
adrenergic	adrenergic	JJ	57
adrenergic-receptor	adrenergic-receptor	JJ	1
adrenergic-renin-angiotensin	adrenergic-renin-angiotensin	JJ	1
adrenergicand	adrenergicand	NN	1
adrenoceptor	adrenoceptor	NN	2
adrenocortical	adrenocortical	JJ	3
adrenocorticotrophic	adrenocorticotrophic	JJ	1
adrenocorticotrophin	adrenocorticotrophin	NN	2
adrenocorticotropic	adrenocorticotropic	JJ	2
adrenoreceptor	adrenoreceptor	NN	1
adressing	adress	VBG	2
adriaen	adriaen	NNP	3
adriaensz	adriaensz	NNP	1
adriamycin	adriamycin	NNP	3
adriamycin	adriamycin	NN	2
adrian	adrian	NNP	63
adriana	adriana	NNP	6
adriane	adriane	NNP	1
adrianne	adrianne	NNP	3
adriano	adriano	NNP	1
adrianople	adrianople	NNP	2
adrianou	adrianou	NNP	6
adrian­ople	adrian­ople	NNP	1
adriatic	adriatic	NNP	20
adrien	adrien	NNP	13
adrienne	adrienne	NNP	8
adrift	adrift	NN	27
adrift	adrift	NNP	1
adroit	adroit	JJ	8
adroitly	adroitly	RB	14
ads	ad	NNS	813
ads	ad	NNPS	10
ads	ad	NNP	8
ads	ad	NN	3
ads	ads	UNC	7
ads	ads	JJ	2
ads-no	ads-no	JJ	1
adscendit	adscendit	NN	2
adsiduos	adsiduo	NNS	1
adsl	adsl	NNP	4
adsorb	adsorb	NN	2
adsorbed	adsorbed	JJ	15
adsorbent	adsorbent	NN	1
adsorption	adsorption	NN	27
adsp	adsp	NN	1
adsubtract	adsubtract	NNP	2
adsurdity	adsurdity	NN	1
adsx	adsx	NNP	20
adsx-nad	adsx-nad	NNP	1
adu	adu	NNP	1
aduana	aduana	NNP	3
adubato	adubato	NNP	4
adulation	adulation	NN	13
adulation	adulation	NNP	1
adulatory	adulatory	NN	8
adult	adult	NN	1360
adult	adult	NNP	105
adult	adult	JJ	15
adult	adult	UNC	2
adult-acting	adult-acting	JJ	1
adult-book	adult-book	JJ	1
adult-care	adult-care	NNP	1
adult-child	adult-child	JJ	3
adult-development	adult-development	JJ	1
adult-directed	adult-directed	JJ	1
adult-emergence	adult-emergence	JJ	1
adult-film	adult-film	JJ	1
adult-flavored	adult-flavored	JJ	1
adult-free	adult-free	JJ	1
adult-imposed	adult-imposed	JJ	1
adult-incest	adult-incest	JJ	1
adult-like	adult-like	JJ	1
adult-onset	adult-onset	JJ	3
adult-organized	adult-organized	JJ	1
adult-oriented	adult-oriented	JJ	5
adult-quality	adult-quality	JJ	1
adult-relationship	adult-relationship	JJ	1
adult-specific	adult-specific	JJ	1
adult-structured	adult-structured	JJ	1
adult-supervised	adult-supervised	JJ	1
adult-supremacy	adult-supremacy	JJ	1
adult-themed	adult-themed	JJ	1
adulterant	adulterant	NN	1
adulterated	adulterated	JJ	1
adulterating	adulterate	VBG	2
adulteration	adulteration	NN	1
adulterator	adulterator	NN	1
adulterer	adulterer	NN	13
adulterer	adulterer	UNC	1
adulterers	adulterer	NNS	8
adulterers	adulterer	NNP	1
adulteress	adulteress	NNS	2
adulterous	adulterous	JJ	34
adultery	adultery	NN	128
adultery	adultery	NNP	33
adultery	adultery	UNC	5
adulthood	adulthood	NN	121
adulthood	adulthood	UNC	2
adulthood	adulthood	NNP	1
adultiness	adultiness	NNS	1
adultless	adultless	JJ	1
adults	adult	NNS	1051
adults	adult	NNP	3
adults	adults	UNC	6
adults-only	adults-only	JJ	5
adulty	adulty	NN	2
adult–	adult–	NNP	3
adult–	adult–	NN	1
adult–child	adult–child	NN	29
adult–child	adult–child	NNP	1
adulyadeh	adulyadeh	NNP	1
adumbrated	adumbrated	JJ	4
adumbrations	adumbration	NNS	3
adumim	adumim	NNP	1
aduncity	aduncity	NN	1
adup	adup	NNP	4
adur	adur	NNP	1
adurt	adurt	NNP	1
adustion	adustion	NN	1
aduuka	aduuka	NN	1
adv	adv	NNP	103
adv-t	adv-t	NNP	1
advance	advance	NN	622
advance	advance	VB	150
advance	advance	NNP	51
advance	advance	VBP	16
advance	advance	UNC	5
advance-purchase	advance-purchase	JJ	3
advance-royalty	advance-royalty	JJ	1
advanced	advance	VBD	295
advanced	advance	VBN	230
advanced	advanced	NNP	112
advanced	advanced	JJ	75
advanced-country	advanced-country	JJ	1
advanced-placement	advanced-placement	JJ	1
advanced-stage	advanced-stage	JJ	1
advancement	advancement	NN	59
advancement	advancement	NNP	26
advancements	advancement	NNS	21
advancepcs	advancepc	NNP	1
advances	advance	NNS	298
advances	advance	NNP	5
advances	advances	UNC	1
advances	advances	JJ	1
advancing	advance	VBG	118
advancing	advancing	NNP	1
advanta	advanta	NNP	1
advantage	advantage	NN	1305
advantage	advantage	NNP	34
advantage	advantage	UNC	4
advantage	advantage	VB	2
advantage-we	advantage-we	JJ	1
advantaged	advantaged	JJ	9
advantageous	advantageous	JJ	69
advantageously	advantageously	RB	4
advantages	advantage	NNS	358
advantages	advantage	NNP	21
advantages	advantages	UNC	4
advective	advective	JJ	1
advenissent	advenissent	NN	1
advent	advent	NN	147
advent	advent	NNP	8
adventis	adventi	NNP	1
adventist	adventist	NNP	4
adventists	adventist	NNP	2
adventitia	adventitium	NN	11
adventitial	adventitial	NN	1
adventitious	adventitious	JJ	1
advents	advent	NNP	1
adventure	adventure	NN	243
adventure	adventure	NNP	40
adventure	adventure	UNC	2
adventure-drama	adventure-drama	JJ	1
adventure-tourism	adventure-tourism	JJ	1
adventured	adventured	JJ	1
adventureland	adventureland	NNP	3
adventurer	adventurer	NN	18
adventurer	adventurer	NNP	1
adventurers	adventurer	NNS	18
adventurers	adventurer	NNP	3
adventures	adventure	NNS	124
adventures	adventure	NNP	57
adventuresome	adventuresome	NN	8
adventuring	adventure	VBG	3
adventurism	adventurism	NN	6
adventurous	adventurous	JJ	79
adventurous	adventurous	NNP	2
adventurously	adventurously	RB	1
adver	adver	NN	1
adverb	adverb	NN	29
adverb	adverb	NNP	2
adverb-adjective	adverb-adjective	JJ	1
adverbial	adverbial	NN	3
adverbial	adverbial	NNP	2
adverbially	adverbially	RB	1
adverbs	adverb	NNS	27
adversarial	adversarial	JJ	20
adversaries	adversary	NNS	43
adversary	adversary	NN	33
adversary	adversary	UNC	1
adversary	adversary	NNP	1
adverse	adverse	JJ	437
adversely	adversely	RB	55
adversities	adversity	NNS	1
adversity	adversity	NN	37
adversity	adversity	NNP	3
adversitycakes	adversitycake	NNS	1
advert	advert	NN	1
adverting	advert	VBG	1
advertise	advertise	VB	77
advertise	advertise	VBP	35
advertised	advertise	VBN	102
advertised	advertise	VBD	34
advertised	advertised	UNC	1
advertised	advertised	NNP	1
advertisement	advertisement	NN	122
advertisement	advertisement	JJ	1
advertisement-free	advertisement-free	JJ	1
advertisementb	advertisementb	NN	1
advertisements	advertisement	NNS	126
advertisements	advertisement	NNP	4
advertisements	advertisements	UNC	1
advertiser	advertiser	NN	18
advertiser	advertiser	NNP	2
advertisers	advertiser	NNS	173
advertisers	advertiser	NNPS	1
advertisers	advertisers	UNC	3
advertises	advertise	VBZ	15
advertising	advertise	VBG	63
advertising	advertising	NN	821
advertising	advertising	NNP	63
advertising	advertising	UNC	7
advertising-based	advertising-based	JJ	1
advertising-copywriter-cum-pope	advertising-copywriter-cum-pope	JJ	1
advertising-driven	advertising-driven	JJ	1
advertising-supported	advertising-supported	JJ	2
advertisser	advertisser	NNP	1
advertizing	advertize	VBG	1
advertorial	advertorial	JJ	5
advertorials	advertorial	NNS	4
advertrise	advertrise	NN	1
adverts	advert	NNP	1
advi	advi	NN	1
advice	advice	NN	1066
advice	advice	NNP	46
advice	advice	UNC	7
advice-giving	advice-giving	JJ	1
advice-hounds	advice-hound	JJ	1
advice-seeker	advice-seeker	JJ	1
advices	advice	NNP	2
advil	advil	NNP	8
advil	advil	NN	2
advino	advino	NNP	1
adviosed	adviosed	JJ	1
advis	advis	NNP	1
advisability	advisability	NN	4
advisable	advisable	JJ	55
advise	advise	VB	154
advise	advise	VBP	29
advise	advise	UNC	1
advise	advise	NNP	1
advised	advise	VBD	162
advised	advise	VBN	146
advised	advised	NNP	1
advisedly	advisedly	RB	2
advisement	advisement	NN	2
adviser	adviser	NN	258
adviser	adviser	NNP	38
adviser	adviser	UNC	1
advisers	adviser	NNS	240
advisers	adviser	NNPS	22
advisers	adviser	NNP	5
advisers	advisers	UNC	1
advises	advise	VBZ	107
advising	advise	VBG	87
advising	advising	NNP	5
advising	advising	NN	3
advisings	advising	NNS	1
advisor	advisor	NN	118
advisor	advisor	NNP	38
advisories	advisory	NNS	30
advisories	advisory	NNP	1
advisors	advisor	NNS	121
advisors	advisor	NNP	25
advisors	advisors	UNC	1
advisory	advisory	JJ	151
advisory	advisory	NNP	110
advisory	advisory	NN	7
advocacy	advocacy	NN	198
advocacy	advocacy	NNP	46
advocate	advocate	NN	197
advocate	advocate	VB	46
advocate	advocate	NNP	36
advocate	advocate	VBP	34
advocate	advocate	UNC	1
advocate-expressed	advocate-expressed	NNP	1
advocated	advocate	VBN	48
advocated	advocate	VBD	45
advocates	advocate	NNS	412
advocates	advocate	VBZ	28
advocates	advocate	NNP	1
advocates	advocates	UNC	2
advocating	advocate	VBG	82
advocating	advocating	NNP	3
advoctaes	advoctae	NNS	1
advokaat	advokaat	NNP	2
advt	advt	NNP	1
adwan	adwan	NNP	26
adwatch	adwatch	NNP	1
adweek	adweek	NNP	2
adx-stz	adx-stz	NNP	3
adx-stz-fast	adx-stz-fast	NNP	4
adygea	adygea	NNP	1
adze	adze	NN	1
adzuki	adzukus	NN	1
ad­­vanced	ad­­vanced	JJ	1
adán	adán	NNP	1
adèle	adèle	NNP	1
adélie	adélie	NNP	3
adélies	adélies	NNP	4
ae	ae	NNP	81
ae	ae	NN	8
ae	ae	UNC	1
aea	aea	NNP	4
aeaea	aeaea	NNP	1
aebersole	aebersole	NNP	1
aebi	aebus	NNP	1
aebsf	aebsf	NNP	1
aec	aec	NNP	15
aecer	aecer	NN	1
aecom	aecom	NN	5
aecom	aecom	NNP	1
aect	aect	NN	7
aected	aected	JJ	5
aecting	aect	VBG	5
aection	aection	NN	4
aection	aection	UNC	1
aectionate	aectionate	NN	2
aects	aect	NNS	6
aedes	aede	NNP	3
aedicule	aedicule	NN	1
aeegintrs	aeegintr	NNP	1
aeesome	aeesome	NNP	1
aeg	aeg	NNP	6
aegean	aegean	NNP	109
aegina	aegina	NNP	4
aegis	aegis	NN	6
aegis	aegis	NNP	1
aegon	aegon	NNP	1
aegypti	aegyptus	NN	1
aehy	aehy	NNP	1
aei	aeus	NNP	7
aek	aek	NNP	1
ael	ael	NN	1
aelfric	aelfric	NNP	4
aelfwine	aelfwine	NNP	3
aelia	aelium	NNP	3
aeneid	aeneid	NNP	4
aeneus	aeneus	JJ	1
aenlle	aenlle	NNP	1
aeo	aeo	NNP	19
aeolians	aeolian	NNP	1
aeolicus	aeolicus	JJ	17
aeon	aeon	NN	2
aeon	aeon	NNP	2
aeons	aeon	NNS	1
aeons	aeon	NNP	1
aep	aep	NNP	4
aer	aer	NNP	7
aer-a	aer-a	NNP	1
aer-d	aer-d	NNP	2
aerate	aerate	NNP	7
aerate	aerate	NN	3
aerated	aerated	JJ	16
aeration	aeration	NN	23
aeration	aeration	NNP	11
aerial	aerial	JJ	58
aerial	aerial	NNP	11
aerialist	aerialist	NN	1
aerially	aerially	RB	2
aerials	aerial	NNS	1
aerie	aerie	NN	5
aeries	aerie	NNS	1
aerio	aerio	NNP	1
aero	aero	NNP	10
aero	aero	NN	2
aero-engine	aero-engine	JJ	2
aerobatics	aerobatics	NNS	1
aerobed	aerobed	NNP	2
aerobes	aerobe	NNS	1
aerobic	aerobic	JJ	80
aerobic	aerobic	NNP	9
aerobic-type	aerobic-type	JJ	1
aerobically	aerobically	RB	4
aerobicise	aerobicise	NN	1
aerobics	aerobic	NN	157
aerobics	aerobic	NNP	4
aerodigestive	aerodigestive	JJ	3
aerodium	aerodium	NNP	1
aerodrome	aerodrome	NNP	3
aerodynamic	aerodynamic	JJ	12
aerodynamics	aerodynamics	NNS	7
aerodyne	aerodyne	NNP	1
aerogenes	aerogene	NNS	2
aeromax	aeromax	NNP	1
aerometric	aerometric	NNP	1
aeromonas	aeromona	NNP	9
aeromousse	aeromousse	NNP	1
aeronautic	aeronautic	NNP	3
aeronautic	aeronautic	JJ	1
aeronautical	aeronautical	JJ	16
aeronautical	aeronautical	NNP	8
aeronautics	aeronautics	NNP	16
aeronautics	aeronautics	NNS	4
aeroperu	aeroperu	NNP	1
aerophilum	aerophilum	NN	3
aeroplane	aeroplane	NNP	2
aeroplane	aeroplane	NN	1
aeroplane	aeroplane	UNC	1
aeroporto	aeroporto	NNP	1
aeropyrum	aeropyrum	NNP	9
aeros	aero	NNP	1
aerosmith	aerosmith	NNP	28
aerosol	aerosol	NN	56
aerosol	aerosol	NNP	3
aerosoles	aerosole	NNP	9
aerosolization	aerosolization	NN	6
aerosolization	aerosolization	NNP	1
aerosolized	aerosolized	JJ	8
aerosols	aerosol	NNS	13
aerosols	aerosol	NNP	9
aerospace	aerospace	NN	51
aerospace	aerospace	NNP	15
aerospatiale	aerospatiale	NNP	1
aerostar	aerostar	NNP	1
aerpe	aerpe	NNP	1
aertoercken	aertoercken	NN	1
aerts	aert	NNP	14
aeruginos	aerugino	NNS	1
aeruginosa	aeruginosa	NN	145
aeruginosaand	aeruginosaand	NN	1
aeruginosaperiplasm	aeruginosaperiplasm	NN	2
aerugionsa	aerugionsa	NN	1
aeryn	aeryn	NNP	7
aeryn-oost	aeryn-oost	NNP	1
aes	ae	NNP	10
aes-drafted	aes-drafted	NNP	1
aeschbacher	aeschbacher	NNP	1
aeschylus	aeschylus	NNP	3
aesculap	aesculap	NNP	1
aeshma	aeshma	NNP	7
aesop	aesop	NNP	8
aesopian	aesopian	NNP	1
aestheic	aestheic	JJ	1
aesthete	aesthete	NN	8
aesthete-mystic	aesthete-mystic	JJ	1
aesthetes	aesthete	NNS	1
aesthetic	aesthetic	JJ	174
aesthetic	aesthetic	NN	30
aesthetic	aesthetic	NNP	10
aesthetic	aesthetic	UNC	2
aesthetically	aesthetically	RB	20
aesthetically	aesthetically	NNP	1
aestheticienne	aestheticienne	NN	1
aestheticism	aestheticism	NN	2
aestheticism	aestheticism	NNP	1
aestheticizing	aestheticize	VBG	4
aesthetics	aesthetics	NNS	48
aesthetics	aesthetics	NNP	4
aesthetics	aesthetics	UNC	1
aestivum	aestivum	NN	2
aeterna	aeterna	NNP	1
aetheistic	aetheistic	JJ	1
aether	aether	NN	1
aethiopis	aethiopi	NNS	1
aetiological	aetiological	JJ	1
aetiology	aetiology	NN	7
aetna	aetna	NNP	37
aev	aev	NNP	5
ae­gean	ae­gean	NNP	1
af	af	NNP	254
af	af	NN	12
afa	afa	NNP	39
afa	afa	NN	1
afac	afac	NN	1
afacility	afacility	NN	1
afaic	afaic	NNP	3
afaict	afaict	NNP	1
afaik	afaik	NNP	29
afaik	afaik	NN	2
afar	afar	NN	35
afar	afar	NNP	4
afarensis	afarensis	NNS	1
afatk	afatk	NNP	1
afb	afb	NNP	12
afc	afc	NNP	24
afca	afca	NNP	1
afcs	afc	NNP	1
afdc	afdc	NNP	28
afdc-unemployed	afdc-unemployed	NNP	1
afeared	afeared	JJ	6
afer	afer	NN	1
aferguson	aferguson	NNP	1
afew	afew	NNP	3
afewerki	afewerkus	NNP	1
aff	aff	NN	1
aff	aff	NNP	1
affability	affability	NN	4
affable	affable	JJ	19
affably	affably	RB	3
affair	affair	NN	629
affair	affair	NNP	49
affair	affair	UNC	4
affaire	affaire	NN	22
affaire	affaire	NNP	1
affaires	affaire	NNS	3
affairs	affair	NNS	401
affairs	affair	NNP	202
affairs	affair	NNPS	78
affairs	affairs	UNC	3
affairspartnership	affairspartnership	NN	1
affairsthe	affairsthe	NNP	1
affarisc	affarisc	NNP	1
affc	affc	NNP	1
affeared	affeared	JJ	1
affect	affect	VB	984
affect	affect	VBP	264
affect	affect	NN	87
affect	affect	NNP	23
affect	affect	UNC	1
affectation	affectation	NN	7
affectation	affectation	NNP	1
affectations	affectation	NNS	4
affected	affect	VBN	1169
affected	affect	VBD	152
affected	affected	JJ	22
affected	affected	NNP	19
affected	affected	UNC	1
affectedunits	affectedunit	NNS	1
affecting	affect	VBG	333
affecting	affecting	NNP	8
affectingly	affectingly	RB	1
affection	affection	NN	192
affection	affection	NNP	7
affectionat	affectionat	NN	1
affectionate	affectionate	JJ	51
affectionate	affectionate	NNP	2
affectionately	affectionately	RB	22
affectionately	affectionately	NNP	2
affections	affection	NNS	22
affections	affection	NNP	3
affective	affective	JJ	12
affectivity	affectivity	NN	1
affectless	affectless	JJ	8
affectless	affectless	UNC	1
affectlessness	affectlessness	NNS	3
affects	affect	VBZ	397
affects	affects	UNC	1
affects	affects	NN	1
affen	affen	NNP	1
afferent	afferent	NN	44
afferents	afferent	NNS	57
afferents	afferent	NNP	2
afffection	afffection	NN	1
affi	affi	NNP	2
affianced	affianced	JJ	1
affiche	affiche	NNP	1
afficionado	afficionado	NN	1
affictions	affiction	NNS	1
affidavit	affidavit	NN	99
affidavit	affidavit	UNC	2
affidavit	affidavit	NNP	1
affidavits	affidavit	NNS	15
affigel	affigel	NNP	6
affiliate	affiliate	NN	72
affiliate	affiliate	NNP	1
affiliated	affiliate	VBN	104
affiliated	affiliated	NNP	3
affiliated	affiliated	JJ	1
affiliateid	affiliateid	NN	1
affiliates	affiliate	NNS	44
affiliates	affiliate	NNP	1
affiliating	affiliate	VBG	1
affiliation	affiliation	NN	57
affiliation	affiliation	NNP	6
affiliations	affiliation	NNS	13
affine	affine	NN	1
affinities	affinity	NNS	61
affinities	affinity	NNP	1
affinity	affinity	NN	497
affinity	affinity	NNP	17
affinity-purification	affinity-purification	JJ	1
affinity-purified	affinity-purified	JJ	17
affinity-purified	affinity-purified	NNP	5
affirm	affirm	NN	35
affirm	affirm	NNP	4
affirmation	affirmation	NN	39
affirmation	affirmation	NNP	1
affirmations	affirmation	NNS	3
affirmative	affirmative	JJ	287
affirmative	affirmative	NNP	25
affirmative	affirmative	UNC	2
affirmative-action	affirmative-action	NN	20
affirmative-action-friendly	affirmative-action-friendly	JJ	1
affirmatively	affirmatively	RB	6
affirmed	affirm	VBD	39
affirmed	affirmed	NNP	4
affirmed	affirmed	UNC	1
affirming	affirm	VBG	28
affirming	affirming	NNP	1
affirms	affirm	NNS	12
affix	affix	NN	14
affix	affix	NNP	3
affixations	affixation	NNP	3
affixed	affixed	JJ	24
affixes	affix	NNS	5
affixing	affix	VBG	4
afflatus	afflatus	JJ	2
affleck	affleck	NNP	88
afflecks	affleck	NNP	2
afflerbach	afflerbach	NNP	3
affliate	affliate	NN	1
afflict	afflict	VB	17
afflicted	afflict	VBN	73
afflicted	afflicted	NNP	3
afflicting	afflict	VBG	15
affliction	affliction	NN	20
affliction	affliction	NNP	11
afflictions	affliction	NNS	9
afflicts	afflict	VBZ	18
afflicts	afflict	NNP	1
affluence	affluence	NN	20
affluent	affluent	JJ	107
affluent	affluent	NN	5
affluent	affluent	NNP	3
affluentials	affluential	NNS	1
affluents	affluent	NNS	1
affluenza	affluenza	NN	1
afford	afford	VB	878
afford	afford	VBP	37
afford	afford	NNP	4
affordability	affordability	NN	14
affordability	affordability	NNP	2
affordabilty	affordabilty	NN	1
affordable	affordable	JJ	164
affordable	affordable	NNP	6
affordable	affordable	UNC	1
affordably	affordably	RB	6
afforded	afford	VBN	74
affording	afford	VBG	24
affords	afford	NNS	51
affricate	affricate	NN	1
affront	affront	NN	38
affronted	affronted	JJ	2
affronts	affront	NNS	1
affusion	affusion	NN	2
affusions	affusion	NNS	1
affx	affx	NN	1
affx	affx	NNP	1
affy	affy	NNP	1
affymetirx	affymetirx	NNP	1
affymetnx	affymetnx	NNP	1
affymetrix	affymetrix	NNP	357
affymetrix	affymetrix	NN	8
affymetrx	affymetrx	NNP	1
afg	afg	NNP	3
afganistan	afganistan	NNP	2
afge	afge	NNP	2
afghan	afghan	JJ	212
afghan	afghan	NNP	36
afghan	afghan	NN	6
afghan-army	afghan-army	NNP	2
afghan-austin	afghan-austin	NNP	1
afghan-based	afghan-based	NNP	2
afghan-bomb	afghan-bomb	NNP	3
afghan-islam	afghan-islam	NNP	1
afghan-journal	afghan-journal	NNP	2
afghan-military	afghan-military	NNP	1
afghan-security	afghan-security	NNP	1
afghan-u	afghan-u	NNP	1
afghan-valley	afghan-valley	NNP	1
afghani	afghanus	NNP	13
afghani	afghanus	NN	1
afghania	afghanium	NNP	1
afghanis	afghani	NNP	3
afghanistan	afghanistan	NNP	899
afghanistan	afghanistan	NN	2
afghanistan	afghanistan	UNC	1
afghanistan-a	afghanistan-a	NNP	1
afghanistan-based	afghanistan-based	NNP	3
afghanistan-in	afghanistan-in	NNP	1
afghanistanis	afghanistani	NNP	1
afghans	afghan	NNPS	30
afghans	afghan	NNS	6
afghans	afghan	NNP	2
afghans-meet	afghans-meet	NNP	2
afgp	afgp	NNP	2
afi	afi	UNC	2
afi	afus	NNP	30
afia	afium	NNP	1
aficionado	aficionado	NN	10
aficionado	aficionado	UNC	1
aficionado	aficionado	NNP	1
aficionados	aficionado	NNS	40
aficionados	aficionado	NNP	2
afield	afield	RB	25
afif	afif	NNP	1
afilliate	afilliate	NN	1
afire	afire	RB	4
afire	afire	NNP	1
afits	afit	NNS	1
afix	afix	NN	1
afl	afl	NNP	8
afl-cio	afl-cio	NNP	75
afl-cio-organized	afl-cio-organized	NNP	1
afl-nfl	afl-nfl	NNP	1
aflac	aflac	NNP	2
aflame	aflame	NN	3
aflame	aflame	NNP	1
aflii	aflius	NNP	3
aflitos	aflito	NNP	3
afloat	afloat	RB	50
afloat	afloat	UNC	1
afloat	afloat	NNP	1
aflp	aflp	NNP	19
aflp-based	aflp-based	NNP	1
aflps	aflp	NNP	1
aflutter	aflutter	NN	3
afm	afm	NNP	2
afmb	afmb	NNP	1
afmd	afmd	NNP	1
afo	afo	NN	1
afonsin	afonsin	NNP	1
afonso	afonso	NNP	15
afoot	afoot	RB	32
afoot	afoot	NNP	3
afor	afor	NN	3
afor	afor	NNP	2
afore	afore	NN	2
afore-mentioned	afore-mentioned	JJ	1
aforementioned	aforementioned	JJ	87
aforementioned	aforementioned	NNP	1
aforesaid	aforesaid	NN	5
aforethought	aforethought	JJ	5
aform	aform	NN	1
afoul	afoul	NN	34
afp	afp	NNP	2
afquarterly	afquarterly	RB	1
afr	afr	NNP	1
afraid	afraid	JJ	889
afraid	afraid	NNP	24
afraid	afraid	UNC	4
aframomum	aframomum	NNP	5
afresh	afresh	NN	11
afri	afri	NNP	1
afri	afrus	NNP	2
afriad	afriad	NN	1
africa	africa	NNP	912
africa	africa	UNC	6
africa-wide	africa-wide	NNP	1
africa-with-intention-of-getting-soul	africa-with-intention-of-getting-soul	NNP	1
africaine	africaine	NNP	1
african	african	NNP	681
african	african	JJ	465
african	african	NN	2
african-american	african-american	JJ	2
african-artifacts	african-artifact	NNP	1
african-descended	african-descended	NNP	1
african-grown	african-grown	NNP	1
african-style	african-style	NNP	1
africana	africana	NNP	39
africanamericans	africanamerican	NNP	1
africanism	africanism	NNP	1
africanist	africanist	NNP	2
africanity	africanity	NNP	2
africanize	africanize	NNP	1
africanoodian	africanoodian	NNP	1
africans	african	NNPS	85
africans	african	NNS	1
africare	africare	NNP	1
africas	africa	NNP	1
africaworld	africaworld	NNP	1
afridi	afridus	NNP	1
afriend	afriend	NNP	2
afriend	afriend	NN	1
afrika	afrika	NNP	1
afrikaans	afrikaan	NNP	17
afrikan	afrikan	NNP	1
afrikaner	afrikaner	JJ	3
afrikaners	afrikaner	NNPS	2
afrikaners	afrikaners	UNC	1
afrikas	afrika	NNP	1
afriyachts	afriyacht	NNP	1
afro	afro	NNP	44
afro	afro	NN	3
afro-futurist	afro-futurist	NNP	1
afro-pop	afro-pop	NNP	2
afroamerican	afroamerican	NNP	1
afrocentric	afrocentric	NNP	7
afrocentrism	afrocentrism	NNP	3
afrocentrist	afrocentrist	NNP	1
afrocentrists	afrocentrist	NNP	3
afroed	afroed	NNP	1
afront	afront	NNP	1
afrophile	afrophile	NNP	2
afropick	afropick	NN	1
afros	afro	NNS	1
afs	af	NNP	2
afsa	afsa	NNP	3
afsc	afsc	NNP	1
afscme	afscme	NNP	1
afshin	afshin	NNP	1
afsluitdijk	afsluitdijk	NNP	2
aft	aft	JJ	10
aft	aft	NNP	5
aft	aft	NN	1
afta	afta	NN	1
afta	afta	NNP	1
after	after	IN	23925
after	after	NNP	76
after	after	UNC	57
after	after	RB	52
after	after	NN	3
after-action	after-action	JJ	5
after-after-party	after-after-party	JJ	1
after-birth	after-birth	JJ	1
after-care	after-care	JJ	1
after-college	after-college	JJ	1
after-dark	after-dark	JJ	4
after-days	after-day	JJ	1
after-death	after-death	JJ	1
after-dinner	after-dinner	JJ	10
after-effect	after-effect	JJ	1
after-effects	after-effect	JJ	2
after-hours	after-hour	JJ	21
after-life	after-life	JJ	2
after-market	after-market	JJ	2
after-movie	after-movie	JJ	1
after-office	after-office	JJ	1
after-party	after-party	JJ	1
after-purchase	after-purchase	JJ	6
after-sales	after-sale	JJ	3
after-school	after-school	JJ	21
after-school	after-school	NNP	1
after-shave	after-shave	JJ	1
after-tax	after-tax	JJ	12
after-tax	after-tax	NNP	1
after-the-fact	after-the-fact	JJ	3
after-the-rapture	after-the-rapture	JJ	1
after-wit	after-wit	JJ	1
after-work	after-work	JJ	4
afteraction	afteraction	NN	1
afteraffects	afteraffect	NNS	1
afterall	afterall	NN	3
afterall	afterall	NNP	2
afterbirth	afterbirth	NN	1
afterburn	afterburn	NN	1
afterburner	afterburner	NN	3
afterburners	afterburner	NNS	2
aftercare	aftercare	NN	1
aftercare-follow-up	aftercare-follow-up	JJ	1
afterday	afterday	NN	1
aftereffect	aftereffect	NN	2
aftereffects	aftereffect	NNS	6
afterewards	aftereward	NNS	1
afterglow	afterglow	NN	10
afterglow	afterglow	NNP	6
afterimage	afterimage	NN	2
afterlife	afterlife	NN	38
afterlife	afterlife	NNP	3
afterload	afterload	NN	4
aftermarket	aftermarket	NN	3
aftermarkof	aftermarkof	NN	1
aftermath	aftermath	NN	171
aftermath	aftermath	NNP	2
aftermath	aftermath	UNC	1
aftermaths	aftermath	NNS	1
afternoon	afternoon	NN	1064
afternoon	afternoon	NNP	23
afternoon	afternoon	UNC	3
afternoon-drive	afternoon-drive	JJ	1
afternoons	afternoon	NNS	72
afternoons	afternoon	NNP	3
afternovember	afternovember	NN	1
afteroon	afteroon	NN	1
afterparties	afterparty	NNS	1
afterplay	afterplay	NN	1
afters	afters	NNS	1
afterschool	afterschool	NN	4
afterschool	afterschool	NNP	1
aftershave	aftershave	NN	1
aftershock	aftershock	NN	5
aftershocks	aftershock	NNS	19
aftertaste	aftertaste	NN	13
aftertaste	aftertaste	UNC	1
aftertaste	aftertaste	NNP	1
aftertax	aftertax	JJ	2
afterthefact	afterthefact	NN	1
afterthought	afterthought	NN	23
afterthought	afterthought	NNP	1
afterthoughts	afterthought	NNS	2
afterthoughts	afterthought	NNP	2
afterward	afterward	RB	202
afterward	afterward	UNC	1
afterwards	afterward	RB	227
afterwards	afterwards	UNC	1
afterword	afterword	NN	5
afterword	afterword	NNP	3
afterwords	afterword	NNS	1
afterwork	afterwork	NN	1
afteryou	afteryou	NN	1
aftra	aftra	NNP	1
aftrer	aftrer	NN	1
aftyr	aftyr	NN	1
afu	afu	NNP	1
afu	afu	NN	1
afuer	afuer	NNP	1
afuera	afuera	NN	1
aful	aful	NNP	1
afunny	afunny	NNP	1
afw	afw	NNP	1
afx	afx	NNP	1
afyon	afyon	NNP	1
ag	ag	NNP	217
ag	ag	NN	3
ag-gt	ag-gt	NNP	1
ag-pandering	ag-pandering	JJ	1
ag-specific	ag-specific	NNP	1
ag-stuff	ag-stuff	JJ	1
aga	aga	NNP	48
aga	aga	NN	3
agaa	agaa	NNP	1
agaaattgccgttgcagtgac	agaaattgccgttgcagtgac	NNP	1
agaacagcaagtgct	agaacagcaagtgct	NNP	1
agaaggagcaggacaccagc	agaaggagcaggacaccagc	NNP	1
agac	agac	NNP	3
agacacaatcgactgaagg	agacacaatcgactgaagg	NNP	1
agacattgacttagctgtggat	agacattgacttagctgtggat	NN	1
agacgfm	agacgfm	NN	2
agacuugaggucggucaacguguac	agacuugaggucggucaacguguac	NNP	1
agaete	agaete	NNP	3
agaetis	agaeti	NNP	2
agaggaagacactgttgagtag	agaggaagacactgttgagtag	NNP	1
agaggtgctggtgccaac	agaggtgctggtgccaac	NNP	1
agahi	agahus	NNP	8
agahst	agahst	NN	1
again	again	RB	8138
again	again	UNC	49
again	again	NNP	48
again	again	JJ	8
again	again	NN	1
again-it	again-it	JJ	1
again-off	again-off	JJ	1
againand	againand	NN	1
againe	againe	NN	1
against	against	IN	9446
against	against	NNP	33
against	against	UNC	8
against-the-odds	against-the-odd	JJ	1
agaion	agaion	NN	1
agambiae	agambia	NN	1
agame	agame	NNP	1
agamemnon	agamemnon	NNP	14
agamenmon	agamenmon	NNP	1
agammaglobulinemia	agammaglobulinemium	NN	3
agammemnon	agammemnon	NNP	3
aganda	aganda	NN	1
aganist	aganist	NN	1
agapanthus	agapanthus	JJ	4
agape	agape	NN	11
agape	agape	NNP	2
agapemone	agapemone	NNP	1
agar	agar	NN	142
agar	agar	NNP	5
agarase	agarase	NN	1
agarcia	agarcium	NN	3
agaricus	agaricus	NNP	1
agarose	agarose	NN	220
agarose	agarose	NNP	10
agarose-cast	agarose-cast	NNP	1
agarose-coated	agarose-coated	JJ	1
agarose-formaldehyde	agarose-formaldehyde	JJ	3
agarose-gel	agarose-gel	JJ	1
agarrar	agarrar	NN	1
agarwal	agarwal	NNP	8
agarwals	agarwal	NNP	1
agas	aga	NNP	2
agassi	agassus	NNP	74
agassiz	agassiz	NNP	1
agastache	agastache	NNP	1
agat	agat	NNP	5
agatcc	agatcc	NNP	1
agatcccaggggtctgtgaaaatggagtgt	agatcccaggggtctgtgaaaatggagtgt	NNP	1
agatct	agatct	NNP	1
agatctgattctaaccatatcgagtgg	agatctgattctaaccatatcgagtgg	NNP	1
agate	agate	NN	6
agate-type	agate-type	NNP	1
agatep	agatep	NNP	1
agateware	agateware	NN	1
agatgcgggcacggctgttcaagga	agatgcgggcacggctgttcaagga	NNP	1
agatgctggccatcataggg	agatgctggccatcataggg	NNP	1
agatha	agatha	NNP	11
agathe-des	agathe-des	NNP	1
agathism	agathism	NN	1
agathistic	agathistic	JJ	1
agavachado	agavachado	NNP	1
agavachado	agavachado	NN	1
agave	agave	NN	7
agave	agave	NNP	1
agaves	agave	NNS	1
agawan	agawan	NNP	1
agayne	agayne	NN	1
agazine	agazine	NN	1
agbayani	agbayanus	NNP	2
agbout	agbout	NN	1
agc	agc	NNP	19
agc	agc	NN	2
agc-related	agc-related	NNP	1
agcactgtgttggcgtacag	agcactgtgttggcgtacag	NNP	1
agcagatgtaggtcctgcacttg	agcagatgtaggtcctgcacttg	NNP	1
agccac	agccac	NNP	1
agccagcagccggaaaactccagt	agccagcagccggaaaactccagt	NNP	2
agccatcaatgataggatcca	agccatcaatgataggatcca	NNP	1
agccccccagcgtaaagat	agccccccagcgtaaagat	NNP	1
agcccgtgcagccatcagcc	agcccgtgcagccatcagcc	NNP	2
agcctggatggctacgtaca	agcctggatggctacgtaca	NNP	1
agcn	agcn	NNP	3
agcop	agcop	NNP	2
agcp	agcp	NN	5
agct	agct	NNP	2
agctcagggagtacttcaaga	agctcagggagtacttcaaga	NN	1
agctcatcatgcagctcat	agctcatcatgcagctcat	NNP	1
agctctgcagcacaaactttaataaatccgaaac	agctctgcagcacaaactttaataaatccgaaac	NNP	1
agctg	agctg	NNP	1
agctgaattccacaaactttaataaatccgaaac	agctgaattccacaaactttaataaatccgaaac	NNP	1
agctgcggccgccctgaaccggttgggtgccac	agctgcggccgccctgaaccggttgggtgccac	NNP	2
agctggccctggcactgctctgctct	agctggccctggcactgctctgctct	NNP	1
agde	agde	NNP	6
age	age	NN	4624
age	age	NNP	503
age	age	VBP	46
age	age	UNC	11
age	age	JJ	2
age-adjusted	age-adjusted	JJ	33
age-adjusted	age-adjusted	NNP	2
age-appropriate	age-appropriate	JJ	6
age-appropriate	age-appropriate	NNP	1
age-associated	age-associated	JJ	3
age-at-onset	age-at-onset	JJ	2
age-based	age-based	JJ	6
age-blip	age-blip	JJ	1
age-bsa	age-bsa	NNP	27
age-bsa-induced	age-bsa-induced	NNP	1
age-conditional	age-conditional	JJ	8
age-darkened	age-darkened	JJ	1
age-dependent	age-dependent	JJ	5
age-discrimination	age-discrimination	JJ	1
age-eligible	age-eligible	JJ	2
age-emphasizing	age-emphasizing	JJ	1
age-gender-matched	age-gender-matched	JJ	1
age-group	age-group	JJ	3
age-groups	age-group	JJ	1
age-inappropriate	age-inappropriate	JJ	1
age-intensity	age-intensity	JJ	1
age-matched	age-matched	JJ	29
age-modified	age-modified	JJ	8
age-old	age-old	JJ	40
age-peers	age-peer	JJ	2
age-range	age-range	JJ	1
age-ravaged	age-ravaged	JJ	1
age-related	age-related	JJ	52
age-retardation	age-retardation	JJ	1
age-smoking	age-smoking	JJ	2
age-specific	age-specific	JJ	50
age-specific	age-specific	NNP	3
age-specificity	age-specificity	JJ	1
age-squared	age-squared	JJ	2
age-stratified	age-stratified	NNP	1
age-structured	age-structured	JJ	2
aged	age	VBN	389
aged	aged	NNP	6
aged	aged	JJ	1
aged	aged	UNC	1
aged-based	aged-based	JJ	1
aged-matched	aged-matched	JJ	3
agedly	agedly	RB	1
agee	agee	NNP	3
agei	ageus	NNP	3
agei-nhei	agei-nheus	NNP	1
ageing	age	VBG	26
ageing	ageing	UNC	2
ageing	ageing	NNP	1
ageing-can-be-regulated	ageing-can-be-regulated	JJ	1
ageism	ageism	NN	2
ageist	ageist	NN	7
ageless	ageless	JJ	9
ageless	ageless	NNP	1
agellon	agellon	NNP	3
agemates	agemate	NNS	13
agemates	agemates	UNC	1
agemilestone	agemilestone	NNP	1
agen	agen	NN	2
agenbite	agenbite	NN	1
agenbroad	agenbroad	NNP	1
agence	agence	NNP	10
agencies	agencies	UNC	10
agencies	agencies	NN	1
agencies	agencies	JJ	1
agencies	agency	NNS	2141
agencies	agency	NNPS	122
agencies	agency	NNP	9
agencies-and	agencies-and	JJ	1
agencies-away	agencies-away	JJ	1
agencies-missionary	agencies-missionary	JJ	1
agencies-the	agencies-the	JJ	1
agencies-unaccustomed	agencies-unaccustomed	JJ	1
agencies-while	agencies-while	JJ	1
agenciesacquisition	agenciesacquisition	NN	1
agenciesgsa	agenciesgsa	NN	1
agency	agency	NN	2507
agency	agency	NNP	549
agency	agency	UNC	1
agency-are	agency-are	JJ	1
agency-based	agency-based	JJ	2
agency-believed	agency-believed	JJ	1
agency-designated	agency-designated	JJ	8
agency-determined	agency-determined	JJ	1
agency-specific	agency-specific	JJ	5
agencydesignated	agencydesignated	JJ	3
agencyoffice	agencyoffice	NNP	2
agencyprotocols	agencyprotocol	NNP	2
agencyspecific	agencyspecific	JJ	2
agencyusers	agencyuser	NNS	1
agencywide	agencywide	NN	17
agend	agend	NN	1
agenda	agenda	NN	524
agenda	agenda	NNP	20
agenda	agenda	UNC	4
agenda	agenda	JJ	1
agenda-driven	agenda-driven	JJ	1
agenda-save	agenda-save	JJ	1
agenda-setting	agenda-setting	JJ	1
agendas	agenda	NNS	48
agendas	agenda	NNP	1
agendum	agendum	NN	2
agendum	agendum	NNP	1
agenerase	agenerase	NNP	1
ageneration	ageneration	NNP	1
agenes	agene	NNP	1
agenesis	agenesis	NNS	3
agenesis	agenesis	NNP	1
agenseeing	agensee	VBG	2
agent	agent	NN	1140
agent	agent	NNP	58
agent	agent	UNC	4
agent-based	agent-based	JJ	1
agent-noun	agent-noun	JJ	1
agent-provocateur	agent-provocateur	NNP	1
agent-speak	agent-speak	JJ	1
agent-y	agent-y	NNP	1
agentdom	agentdom	NN	1
agentries	agentry	NNS	1
agentry	agentry	NNP	1
agentry	agentry	NN	1
agents	agent	NNS	1404
agents	agent	NNPS	9
agents	agents	UNC	4
agents-even	agents-even	JJ	1
agentur	agentur	NNP	1
agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle	agenuineredrydercarbineactiontwohundredshotlightningloaderrangemodelairrifle	NNP	1
ager	ager	NNP	3
ager	ager	NN	1
ager	ager	UNC	1
agere	agere	NNP	2
agers	ager	NNP	7
agers	agers	UNC	2
ages	age	NNS	656
ages	age	NNPS	105
ages	age	NNP	4
ages	ages	UNC	4
ages-old	ages-old	JJ	1
agettin	agettin	NN	1
agewise	agewise	NN	1
agey	agey	NNP	8
agey	agey	NN	2
age–bovine	age–bovine	NNP	1
agfa	agfa	NNP	1
agg	agg	NNP	35
agg	agg	NN	1
aggaccaaagaagaagtagga	aggaccaaagaagaagtagga	NNP	1
aggaccctcatggccttg	aggaccctcatggccttg	NNP	1
aggactttgatggaacacgg	aggactttgatggaacacgg	NNP	1
aggaggcggttagccctg	aggaggcggttagccctg	NNP	1
aggcacacaagcccaaaaagac	aggcacacaagcccaaaaagac	NNP	1
aggcactccgaggctagaccag	aggcactccgaggctagaccag	NNP	1
aggccca	aggccca	NNP	1
agggaccggg	agggaccggg	NNP	1
agggagctctgacatcggg	agggagctctgacatcggg	NNP	1
agggah	agggah	NNP	1
agggataacaatatcgccaa	agggataacaatatcgccaa	NNP	1
agggcagt	agggcagt	NNP	3
agggctgctaattgctggta	agggctgctaattgctggta	NNP	1
agggghhhh	agggghhhh	NNP	1
agggh	agggh	NNP	1
aggie	aggie	NNP	3
aggies	aggy	NNP	11
agglomerans	agglomeran	NNS	2
agglomerate	agglomerate	NN	2
agglomeration	agglomeration	NN	4
agglomerations	agglomeration	NNS	1
agglomerative	agglomerative	JJ	12
agglomerative	agglomerative	NNP	2
agglutination	agglutination	NN	2
agglutinative	agglutinative	JJ	1
agglutinin	agglutinin	NN	1
agglutinins	agglutinin	NNS	4
aggrandize	aggrandize	NN	1
aggrandized	aggrandized	JJ	1
aggrandizement	aggrandizement	NN	5
aggrandizements	aggrandizement	NNS	3
aggrandizing	aggrandize	VBG	1
aggrastat	aggrastat	NNP	2
aggravate	aggravate	VB	9
aggravate	aggravate	VBP	2
aggravated	aggravate	VBN	32
aggravated	aggravate	VBD	9
aggravated	aggravated	NNP	1
aggravates	aggravate	VBZ	8
aggravating	aggravate	VBG	5
aggravating	aggravating	JJ	37
aggravating	aggravating	NNP	1
aggravatingly	aggravatingly	RB	1
aggravation	aggravation	NN	11
aggravation	aggravation	NNP	2
aggravations	aggravation	NNS	3
aggravator	aggravator	NNP	1
aggrecan	aggrecan	NN	11
aggrecan	aggrecan	NNP	1
aggrecanase	aggrecanase	NN	1
aggregata	aggrega	NN	2
aggregate	aggregate	JJ	202
aggregate	aggregate	NN	33
aggregate	aggregate	NNP	12
aggregated	aggregated	JJ	46
aggregates	aggregate	NNS	260
aggregates	aggregate	NNP	2
aggregating	aggregate	VBG	25
aggregating	aggregating	NNP	2
aggregation	aggregation	NN	166
aggregation	aggregation	NNP	5
aggregation-compatible	aggregation-compatible	JJ	1
aggregation-competent	aggregation-competent	JJ	1
aggregation-prone	aggregation-prone	JJ	1
aggregations	aggregation	NNS	7
aggregator	aggregator	NN	2
aggregrate	aggregrate	NN	1
aggresive	aggresive	JJ	1
aggresome	aggresome	NN	1
aggresome-like	aggresome-like	JJ	4
aggresomes	aggresome	NNS	1
aggress	aggress	NNS	1
aggression	aggression	NN	138
aggression	aggression	NNP	7
aggression	aggression	UNC	4
aggression-burner	aggression-burner	JJ	1
aggression-inducing	aggression-inducing	JJ	1
aggressions	aggression	NNS	3
aggressive	aggressive	JJ	550
aggressive	aggressive	NNP	19
aggressively	aggressively	RB	160
aggressively	aggressively	NNP	3
aggressively	aggressively	UNC	2
aggressiveness	aggressiveness	NN	14
aggressiveness	aggressiveness	UNC	1
aggressor	aggressor	NN	10
aggressor	aggressor	UNC	1
aggressors	aggressor	NNS	10
aggressors	aggressor	NNP	1
aggressosexual	aggressosexual	NNP	1
aggrievance	aggrievance	NN	1
aggrieved	aggrieved	JJ	29
aggrievement	aggrievement	NN	2
aggrievor	aggrievor	NN	1
aggrivate	aggrivate	NN	2
aggrivates	aggrivate	NNS	1
aggrivating	aggrivate	VBG	1
aggro	aggro	NN	2
aggtca	aggtca	NNP	1
aggtcacattgccgaacct	aggtcacattgccgaacct	NNP	1
aggtcgccggctccctaatatttaggg-tamra	aggtcgccggctccctaatatttaggg-tamra	NNP	1
agh	agh	NNP	1
agha	agha	NNP	1
aghajari	aghajarus	NNP	1
aghanistan	aghanistan	NNP	1
aghast	aghast	JJ	32
aghiasos	aghiaso	NNP	2
aghion	aghion	NNP	1
aghlaghlaghlaghlaghl	aghlaghlaghlaghlaghl	NN	1
aghlghlghlghhgll	aghlghlghlghhgll	NNP	1
aghía	aghía	NNP	1
agi	agus	NNP	5
agi	agus	NN	1
agia	agium	NNP	5
agian	agian	NN	2
agie-bp	agie-bp	NNP	1
agiero	agiero	NN	1
agii	agius	NNP	1
agikuyu	agikuyu	NNP	1
agile	agile	NN	18
agile	agile	FW	1
agilent	agilent	NNP	11
agilis	agili	NNS	1
agility	agility	NN	20
agility	agility	NNP	2
agin	agin	NN	2
agina	agina	JJ	1
agincourt	agincourt	NNP	8
aging	age	VBG	322
aging	aging	NN	55
aging	aging	NNP	49
aging	aging	UNC	1
aging-at	aging-at	JJ	1
aging-boomer	aging-boomer	JJ	1
aging-friendly	aging-friendly	JJ	1
aging-in	aging-in	NNP	1
aging-related	aging-related	JJ	1
agins	agin	NNP	7
agios	agio	NNP	2
agiou	agiou	NNP	1
agita	agita	NN	1
agitans	agitan	NNS	1
agitate	agitate	NN	5
agitated	agitate	VBN	43
agitated	agitated	NNP	2
agitated	agitated	UNC	1
agitatedly	agitatedly	RB	1
agitates	agitate	NNS	2
agitating	agitate	VBG	10
agitating	agitating	NNP	1
agitation	agitation	NN	59
agitation	agitation	NNP	4
agitator	agitator	NN	6
agitator	agitator	UNC	1
agitators	agitator	NNS	5
agitoxin	agitoxin	NN	1
agitpop	agitpop	NN	1
agitprop	agitprop	NN	8
agkistrodon	agkistrodon	NNP	1
agkpqetfld	agkpqetfld	NNP	1
aglint	aglint	NN	1
aglitter	aglitter	NN	1
aglow	aglow	NN	7
aglozenge	aglozenge	NNP	1
aglt	aglt	NN	1
aglycone	aglycone	NN	1
agmon	agmon	NNP	6
agne	agne	NNP	1
agnelli	agnellus	NNP	33
agnellis	agnelli	NNPS	5
agnes	agn	NNP	29
agnese	agnese	NNP	1
agnew	agnew	NNP	5
agnieszka	agnieszka	NNP	2
agnodice	agnodice	NNP	1
agnolo	agnolo	NNP	1
agnondas	agnonda	NNP	1
agnos	agno	NNP	1
agnostic	agnostic	JJ	17
agnostic	agnostic	NNP	1
agnosticism	agnosticism	NN	5
agnosticism	agnosticism	NNP	1
agnostics	agnostic	NNS	7
agnst	agnst	NN	1
agnsty	agnsty	NN	2
agnus	agnus	NNP	3
agnv	agnv	NNP	1
ago	ago	RB	6437
ago	ago	UNC	38
ago	ago	IN	15
ago	ago	NNP	11
ago	ago	JJ	6
ago	ago	NN	2
ago-are	ago-are	JJ	1
ago-before	ago-before	JJ	1
ago-what	ago-what	JJ	1
agodoa	agodoa	NNP	1
agog	agog	NN	9
agoggle	agoggle	NN	1
agon	agon	NN	1
agona	agona	NNP	1
agonale	agonale	NNP	1
agonalis	agonali	NNP	1
agone	agone	NNP	2
agone	agone	NN	1
agonia	agonium	NNP	1
agonies	agony	NNS	3
agonism	agonism	NN	9
agonism	agonism	NNP	2
agonist	agonist	NN	278
agonist	agonist	NNP	9
agonist-activated	agonist-activated	JJ	1
agonist-antagonist	agonist-antagonist	JJ	2
agonist-antagonists	agonist-antagonist	JJ	1
agonist-bound	agonist-bound	JJ	5
agonist-dependent	agonist-dependent	JJ	6
agonist-derivative	agonist-derivative	JJ	1
agonist-induced	agonist-induced	JJ	15
agonist-induced	agonist-induced	NNP	1
agonist-mediated	agonist-mediated	JJ	3
agonist-regulated	agonist-regulated	JJ	1
agonist-selective	agonist-selective	JJ	2
agonist-specific	agonist-specific	JJ	1
agonist-stimulated	agonist-stimulated	JJ	1
agonist-stimulation	agonist-stimulation	JJ	1
agonist-treated	agonist-treated	JJ	1
agonistic	agonistic	JJ	8
agonistic	agonistic	NNP	2
agonists	agonist	NNS	174
agonists	agonist	NNP	1
agonize	agonize	VB	10
agonized	agonized	JJ	19
agonizer	agonizer	NN	1
agonizers	agonizer	NNS	1
agonizes	agonize	NNS	1
agonizing	agonizing	JJ	44
agonizingly	agonizingly	RB	4
agony	agony	NN	56
agony	agony	NNP	10
agony-making	agony-making	JJ	1
agood	agood	NNP	1
agora	agora	NNP	23
agora	agora	NN	7
agora	agora	UNC	1
agora-like	agora-like	JJ	1
agoraphobia	agoraphobia	NN	2
agoraphobics	agoraphobic	NNS	1
agoras	agora	NNP	2
agordon	agordon	NN	24
agostino	agostino	NNP	2
agotataki	agotatakus	NN	1
agoura	agoura	NNP	4
agouti	agoutus	NN	13
agouti	agoutus	NNP	3
agouti-related	agouti-related	JJ	3
agoutis	agouti	NNS	1
agp	agp	NNP	1
agpr	agpr	NNP	1
agr	agr	NN	2
agra	agra	NNP	25
agramonte	agramonte	NNP	3
agranulocytosis	agranulocytosis	NNS	5
agrarian	agrarian	NN	14
agrarian	agrarian	NNP	1
agrarians	agrarian	NNS	1
agrawal	agrawal	NNP	2
agre	agre	NNP	1
agreda	agreda	NNP	4
agredo	agredo	NNP	1
agree	agree	VBP	1987
agree	agree	VB	862
agree	agree	NNP	17
agree	agree	UNC	10
agree	agree	NN	3
agree-imo	agree-imo	JJ	1
agreeable	agreeable	JJ	44
agreeably	agreeably	RB	12
agreeance	agreeance	NN	2
agreed	agree	VBD	1115
agreed	agree	VBN	343
agreed	agreed	NN	5
agreed	agreed	UNC	3
agreed	agreed	NNP	2
agreed-on	agreed-on	JJ	2
agreed-to	agreed-to	JJ	1
agreed-upon	agreed-upon	JJ	31
agreed-upon	agreed-upon	NNP	1
agreeement	agreeement	NN	1
agreein	agreein	NN	1
agreeing	agree	VBG	145
agreeing	agreeing	NNP	4
agreement	agreement	NN	1514
agreement	agreement	NNP	58
agreement	agreement	UNC	8
agreement-to-disagree	agreement-to-disagree	JJ	1
agreements	agreement	NNS	299
agreements	agreement	NNP	20
agreementto	agreementto	NN	1
agrees	agree	VBZ	306
agrees	agree	NNP	3
agrees	agrees	UNC	2
agression	agression	UNC	1
agressive	agressive	JJ	3
agressively	agressively	RB	2
agrestis	agresti	NNS	1
agrevo	agrevo	NNP	1
agribiz	agribiz	NN	2
agribusiness	agribusiness	NNS	17
agribusiness	agribusiness	NNP	1
agriceutical	agriceutical	JJ	1
agriceuticals	agriceutical	NNS	1
agricola	agricolum	NNP	1
agricole	agricole	NNP	6
agricultural	agricultural	JJ	285
agricultural	agricultural	NNP	37
agriculturalist	agriculturalist	NN	1
agriculturalists	agriculturalist	NNS	1
agriculturally	agriculturally	RB	4
agriculture	agriculture	NNP	226
agriculture	agriculture	NN	149
agriculture	agriculture	UNC	1
agriculture-dependent	agriculture-dependent	JJ	1
agriculturists	agriculturist	NNS	2
agrigento	agrigento	NNP	3
agrin	agrin	NN	69
agrin	agrin	NNP	5
agrinatura	agrinatura	NNP	1
agringado	agringado	NN	10
agringado	agringado	NNP	7
agringados	agringado	NNS	1
agrippa	agrippa	NNP	5
agrippas	agrippa	NNP	1
agrippina	agrippina	NNP	1
agris	agri	NNP	14
agritainment	agritainment	NN	1
agri­culture	agri­culture	NN	1
agro	agro	NNP	2
agro-drug	agro-drug	JJ	3
agro-mediated	agro-mediated	NNP	1
agrobacteria	agrobacterium	NN	2
agrobacterium	agrobacterium	NNP	44
agrobacterium-based	agrobacterium-based	NNP	2
agrobacterium-mediated	agrobacterium-mediated	NNP	1
agrobacteriumbinary	agrobacteriumbinary	NNP	1
agrocin	agrocin	NNP	2
agrocin-encoding	agrocin-encoding	JJ	1
agrocin-like	agrocin-like	JJ	1
agrocinopine	agrocinopine	NN	1
agrocins	agrocin	NNS	1
agron	agron	NNP	2
agronomic	agronomic	JJ	4
agronomic	agronomic	NNP	1
agronomist	agronomist	NN	1
agronomy	agronomy	NNP	1
agross	agross	NNS	1
agrotourism	agrotourism	NN	1
aground	aground	NN	14
aground	aground	NNP	1
agrp	agrp	NNP	40
agrregate	agrregate	NN	1
agrument	agrument	NN	1
agrunt	agrunt	NNP	2
agréable	agréable	JJ	1
agržable	agržable	JJ	1
ags	ag	NNP	29
ags	ag	NNS	1
agsim	agsim	NNP	3
agt	agt	NNP	26
agt	agt	NN	4
agtacg	agtacg	NNP	1
agtactagggtagctcctcc	agtactagggtagctcctcc	NNP	1
agtcaaggctcacagagctaa	agtcaaggctcacagagctaa	NN	1
agtcaggaatggctgcacc	agtcaggaatggctgcacc	NNP	1
agtgactgtccttcctctgt	agtgactgtccttcctctgt	NNP	1
agtgaggttcatgtaccag	agtgaggttcatgtaccag	NNP	1
agtgct	agtgct	NNP	1
agtggcctatgcggccgcgg	agtggcctatgcggccgcgg	NNP	1
agtgtaatggaacagatgccaagg	agtgtaatggaacagatgccaagg	NNP	1
agtii	agtius	NNP	4
agttgaggggactttcccaggc	agttgaggggactttcccaggc	NNP	1
agttggttttcctttggctgtgtg	agttggttttcctttggctgtgtg	NNP	1
agttgtgtttgtgtccgacg	agttgtgtttgtgtccgacg	NNP	1
agtx	agtx	NNP	1
agu	agu	NN	1
agua	agua	NNP	8
agua	agua	NN	3
agua-cate	agua-cate	JJ	1
aguacate	aguacate	NN	3
aguada	aguada	NNP	1
aguadilla	aguadillum	NNP	3
aguadulce	aguadulce	NNP	1
aguardando	aguardando	NN	1
aguardente	aguardente	NN	3
aguardiente	aguardiente	NN	2
aguas	agua	NNP	1
aguayo	aguayo	NNP	1
agudo	agudo	NN	1
ague	ague	NNP	1
ague	ague	NN	1
aguecheek	aguecheek	NNP	2
agueface	agueface	NNP	1
aguelo	aguelo	NN	1
aguideforevaluatingagencies	aguideforevaluatingagency	NNP	1
aguideforfederalagenciesin	aguideforfederalagenciesin	NNP	1
aguilar	aguilar	NNP	9
aguilas	aguila	NNP	1
aguilera	aguilera	NNP	30
aguinaga	aguinaga	NNP	1
aguinaldo	aguinaldo	NNP	1
aguinaldos	aguinaldo	NNS	6
aguinaldos	aguinaldo	NNP	4
aguinis	aguini	NNP	1
aguirre	aguirre	NNP	11
agular	agular	NNP	1
agulo	agulo	NNP	1
agung	agung	NNP	18
agustain	agustain	NNP	4
agustin	agustin	NNP	1
agustinillo	agustinillo	NNP	1
agustín	agustín	NNP	5
aguárdenlas	aguárdenlas	NNP	1
agva	agva	NNP	1
agwale	agwale	NNP	1
agworks	agwork	NNP	4
agía	agía	NNP	21
agías	agías	NNP	1
ah	ah	NN	667
ah	ah	UH	630
ah	ah	NNP	132
ah	ah	UNC	7
ah-ah-ah	ah-ah-ah	JJ	1
ah-ah-ah	ah-ah-ah	NNP	1
ah-choo	ah-choo	NNP	1
ah-doh-nees	ah-doh-nee	NNP	1
ah-gwa	ah-gwa	NNP	1
ah-ha	ah-ha	NNP	5
ah-ha	ah-ha	JJ	1
ah-ha-ha	ah-ha-ha	NNP	11
ah-ha-ha	ah-ha-ha	JJ	6
ah-ha-ha-ha	ah-ha-ha-ha	NNP	4
ah-ha-ha-ha-ha	ah-ha-ha-ha-ha	NNP	1
ah-hem	ah-hem	JJ	1
ah-kai-nah	ah-kai-nah	NNP	1
ah-lone	ah-lone	JJ	1
ah-mtv-um	ah-mtv-um	NNP	1
ah-oo-gah	ah-oo-gah	NNP	1
ah-to-nym	ah-to-nym	NNP	1
ah-yup	ah-yup	NNP	1
aha	aha	NNP	92
aha	aha	NN	13
aha	aha	UNC	1
aha-wa	aha-wa	NNP	5
ahab	ahab	NNP	53
ahab-like	ahab-like	NNP	1
ahabs	ahab	NNP	1
ahad	ahad	NNP	2
ahaetulla	ahaetullum	NN	1
ahah	ahah	NNP	1
ahahahaha	ahahahaha	NNP	1
ahahahahahahah	ahahahahahahah	NNP	1
ahahahahahahaha	ahahahahahahaha	NN	1
aharanot	aharanot	NNP	14
aharon	aharon	NNP	4
aharonisky	aharonisky	NNP	1
aharonot	aharonot	NNP	3
ahau	ahau	NNP	2
ahazueras	ahazuera	NNP	1
ahb	ahb	NNP	1
ahbez	ahbez	NNP	1
ahc	ahc	NNP	4
ahcd	ahcd	NN	2
ahco	ahco	NNP	3
ahcompetition	ahcompetition	NN	1
ahcpr	ahcpr	NNP	3
ahd	ahd	NNP	8
ahd-a	ahd-a	NNP	1
ahdggr	ahdggr	NNP	1
ahdi	ahdus	NN	1
ahe	ahe	NN	2
ahead	ahead	RB	1714
ahead	ahead	NNP	36
ahead	ahead	UNC	5
ahearn	ahearn	NNP	5
ahed	ahed	JJ	1
ahem	ahem	NNP	54
ahem	ahem	NN	26
ahem	ahem	UNC	2
ahern	ahern	NNP	8
ahfs	ahf	NNP	1
ahh	ahh	NNP	23
ahh	ahh	NN	12
ahha	ahha	NN	1
ahhed	ahhed	JJ	1
ahhh	ahhh	NNP	28
ahhh	ahhh	NN	4
ahhh	ahhh	UNC	1
ahhhh	ahhhh	NNP	6
ahhhh	ahhhh	NN	2
ahhhhh	ahhhhh	NNP	4
ahhhhhh	ahhhhhh	NN	1
ahhhhhhhhh	ahhhhhhhhh	NN	2
ahhhhhhhhh	ahhhhhhhhh	NNP	1
ahhhhhhhhhhh	ahhhhhhhhhhh	NNP	1
ahhhhhhhhhhhhh	ahhhhhhhhhhhhh	NNP	1
ahhhhhhhhhhhhhh	ahhhhhhhhhhhhhh	NNP	1
ahhhhhhhhhhhhhhhhhhhhhhhhh	ahhhhhhhhhhhhhhhhhhhhhhhhh	NNP	1
ahhing	ahh	VBG	1
ahi	ahus	NNP	6
ahi	ahus	NN	2
ahidi	ahidus	NNP	1
ahigh	ahigh	NNP	1
ahimsa	ahimsa	NN	1
ahing	ahe	VBG	1
ahint	ahint	NN	1
ahistorical	ahistorical	JJ	8
ahistorically	ahistorically	RB	1
ahistoricity	ahistoricity	NN	3
ahistory	ahistory	NN	2
ahitw	ahitw	NNP	1
ahkenaten	ahkenaten	NNP	2
ahktar	ahktar	NNP	2
ahl	ahl	NNP	1
ahlberg	ahlberg	NNP	1
ahlborn	ahlborn	NNP	1
ahlers	ahler	NNP	1
ahlstrand	ahlstrand	NNP	1
ahluwalia	ahluwalium	NNP	3
ahmad	ahmad	NNP	44
ahmadicized	ahmadicized	NNP	1
ahmadicizing	ahmadicizing	NNP	1
ahmadzai	ahmadzaus	NNP	2
ahmak	ahmak	NN	1
ahmanson	ahmanson	NNP	4
ahmed	ahmed	NNP	102
ahmedabad	ahmedabad	NNP	5
ahmet	ahmet	NNP	9
ahmose	ahmose	NNP	1
ahn	ahn	NN	13
ahn	ahn	NNP	7
ahnee	ahnee	NN	1
ahold	ahold	NN	21
ahold	ahold	NNP	5
aholic	aholic	JJ	1
aholy	aholy	NNP	1
ahouse	ahouse	NN	1
ahoy	ahoy	NN	8
ahoy	ahoy	NNP	4
ahp	ahp	NNP	7
ahp-warner	ahp-warner	NNP	1
ahr	ahr	NNP	5
ahram	ahram	NNP	13
ahrens	ahren	NNP	3
ahronot	ahronot	NNP	2
ahrq	ahrq	NNP	1
ahrs	ahr	NNP	1
ahs	ah	UH	2
ahs	ah	NNP	1
ahsanullah	ahsanullah	NNP	9
ahsen	ahsen	NNP	1
ahtapod	ahtapod	NN	1
ahtisaari	ahtisaarus	NNP	1
ahuacatl	ahuacatl	NN	1
ahuacatl	ahuacatl	NNP	1
ahuja	ahuja	NNP	1
ahulph	ahulph	NNP	1
ahumada	ahumada	NN	1
ahv	ahv	NNP	1
ahve	ahve	NN	5
ahwahnee	ahwahnee	NNP	1
ahwatukee	ahwatukee	NNP	1
ahzar	ahzar	NNP	1
ai	ai	VBP	311
ai	ai	NNP	2
ai	aus	NNP	160
ai	aus	NN	8
ai-ish	ai-ish	NNP	2
ai-knockout	ai-knockout	NNP	1
ai-ko	ai-ko	JJ	1
ai-lead	ai-lead	NNP	1
ai-mi-tii	ai-mi-tii	JJ	1
ai-yi-yi	ai-yi-yus	NNP	1
aia	aium	NNP	17
aia	aium	NN	1
aib	aib	NNP	9
aibe	aibe	NNP	1
aic	aic	NNP	18
aicd	aicd	NNP	7
aicha	aicha	NNP	2
aichi	aichus	NNP	1
aicn	aicn	NNP	4
aicpa	aicpa	NNP	129
aicpa	aicpa	NN	2
aid	aid	NN	963
aid	aid	NNP	597
aid	aid	VB	124
aid	aid	UNC	4
aid-recipients	aid-recipient	JJ	1
aid-wearing	aid-wearing	JJ	1
aida	aida	NNP	9
aidan	aidan	NNP	24
aide	aide	NN	260
aide	aide	NNP	6
aide	aide	UNC	1
aide-de-camp	aide-de-camp	JJ	4
aided	aid	VBN	91
aided	aid	VBD	27
aided	aided	NNP	2
aided	aided	UNC	1
aiden	aiden	NNP	2
aidentifies	aidentify	NNP	1
aider	aider	NN	1
aides	aide	NNS	302
aides	aide	NNP	2
aidid	aidid	NNP	1
aidil	aidil	NNP	1
aiding	aid	VBG	36
aiding	aiding	NNP	5
aids	aid	NNP	1080
aids	aid	NNS	89
aids	aid	VBZ	13
aids	aids	UNC	5
aids-associated	aids-associated	NNP	3
aids-conference	aids-conference	NNP	1
aids-conscious	aids-conscious	NNP	2
aids-defining	aids-defining	NNP	2
aids-fighting	aids-fighting	NNP	1
aids-infected	aids-infected	JJ	3
aids-like	aids-like	NNP	2
aids-related	aids-related	NNP	7
aids-research	aids-research	JJ	2
aids-ridden	aids-ridden	NNP	1
aids-vaccine	aids-vaccine	NNP	1
aidss	aidss	NNP	20
aidsvax	aidsvax	NNP	1
aiee	aiee	NNP	6
aieee	aieee	NNP	5
aieee	aieee	NN	1
aieeee	aieeee	NNP	1
aieeeeee	aieeeeee	NNP	1
aieeeeeeeeee	aieeeeeeeeee	NNP	1
aiello	aiello	NNP	11
aif	aif	NNP	1
aifg	aifg	NNP	54
aifg	aifg	NN	1
aig	aig	NNP	18
aig-earnings	aig-earning	NNP	1
aigle	aigle	NN	1
aigu	aigu	NN	1
aiguas	aigua	NNP	1
aiguille	aiguille	NNP	5
aigus	aigus	JJ	1
aihy	aihy	NN	1
aii	aius	NNP	1
aiib	aiib	NN	1
aiieeee	aiieeee	NNP	1
aiieeeeee	aiieeeeee	NNP	1
aiii	aiius	NNP	2
aiiieeee	aiiieeee	NNP	1
aiiieeeeeeeeee	aiiieeeeeeeeee	NNP	2
aiiiieeeee	aiiiieeeee	NNP	1
aiiiiiieeeee	aiiiiiieeeee	NNP	1
aiiiiiiiiiieeeeeeeeee	aiiiiiiiiiieeeeeeeeee	NNP	1
aiims	aiim	NNP	1
aijaz	aijaz	NNP	1
aik	aik	NN	1
aiken	aiken	NNP	7
aikido	aikido	NNP	6
aikido	aikido	FW	5
aikman	aikman	NNP	23
ail	ail	NN	31
aila	ailum	NNP	3
ailecia	ailecium	NNP	1
ailed	ailed	JJ	1
aileen	aileen	NNP	3
ailerons	aileron	NNS	1
ailes	aile	NNP	1
ailey	ailey	NNP	6
ailing	ail	VBG	56
ailing	ailing	NNP	4
aillustrates	aillustrate	NNP	5
aillustrates	aillustrate	NNS	4
ailment	ailment	NN	26
ailment-free	ailment-free	JJ	1
ailments	ailment	NNS	52
ailments	ailment	NNP	2
ails	ail	NNS	12
ails	ail	NNP	1
ailsa	ailsa	NNP	3
aim	aim	NN	250
aim	aim	NNP	189
aim	aim	VBP	42
aim	aim	VB	31
aim	aim	UNC	2
aim-v	aim-v	NNP	1
aima	aima	NNP	1
aimable	aimable	JJ	1
aimcl	aimcl	NNP	1
aimd	aimd	NNP	227
aimd	aimd	NN	3
aime	aime	NNP	7
aime	aime	NN	3
aimeconat	aimeconat	NN	1
aimed	aim	VBN	352
aimed	aim	VBD	35
aimed	aimed	UNC	3
aimed	aimed	NNP	2
aimee	aimee	NNP	442
aimee	aimee	UNC	8
aimee	aimee	NN	5
aimee-i	aimee-us	NNP	1
aimee-what	aimee-what	NNP	1
aimee-you	aimee-you	NNP	1
aimeeeeeee	aimeeeeeee	NNP	2
aimeeward	aimeeward	NNP	1
aimer	aimer	NNP	1
aimer	aimer	NN	1
aimfully	aimfully	RB	2
aiming	aim	VBG	61
aiming	aiming	NNP	4
aimless	aimless	JJ	11
aimless	aimless	NNP	2
aimless	aimless	UNC	1
aimlessly	aimlessly	RB	13
aimlessness	aimlessness	NNS	2
aimon	aimon	NN	1
aims	aim	VBZ	115
aims	aim	NNS	40
aims	aim	NNP	9
aims	aims	UNC	2
aimé	aimé	NN	2
aimé	aimé	NNP	1
ain	ain	NNP	15
ain	ain	NN	11
aina	aina	NNP	1
aincome	aincome	NN	1
aindicate	aindicate	NN	1
aindicated	aindicated	NNP	1
aindicates	aindicate	NNS	2
aindicates	aindicate	NNP	1
aine	aine	NN	13
aine	aine	NNP	1
aines	aine	NNP	1
ainge	ainge	NNP	7
ainsley	ainsley	NNP	2
aint	aint	NN	7
aint	aint	NNP	2
ainu	ainu	NNP	13
aioli	aiolus	NN	4
aip	aip	NN	1
aip	aip	NNP	1
air	air	NN	3186
air	air	NNP	1086
air	air	VB	179
air	air	VBP	37
air	air	UNC	13
air-and-spit	air-and-spit	JJ	1
air-as	air-a	JJ	1
air-bag	air-bag	JJ	4
air-bag-equipped	air-bag-equipped	JJ	3
air-base	air-base	JJ	1
air-bending	air-bending	JJ	1
air-borne	air-borne	JJ	3
air-commas	air-comma	JJ	1
air-conditioned	air-conditioned	JJ	71
air-conditioned	air-conditioned	NNP	1
air-conditioner	air-conditioner	NN	7
air-conditioners	air-conditioner	JJ	2
air-conditioning	air-conditioning	NN	52
air-conditioning	air-conditioning	NNP	1
air-cushion	air-cushion	JJ	2
air-defense	air-defense	JJ	2
air-dispersion	air-dispersion	NNP	1
air-dispersion	air-dispersion	JJ	1
air-dried	air-dried	JJ	21
air-dropped	air-dropped	JJ	1
air-dry	air-dry	JJ	2
air-drying	air-drying	JJ	2
air-fare	air-fare	JJ	1
air-fares	air-fare	NNP	1
air-filled	air-filled	JJ	1
air-flow	air-flow	JJ	1
air-freight	air-freight	NN	2
air-freighted	air-freighted	JJ	1
air-ground	air-ground	JJ	1
air-inflated	air-inflated	JJ	1
air-laws	air-law	NNP	3
air-liquid	air-liquid	JJ	1
air-locked	air-locked	JJ	1
air-media	air-media	JJ	1
air-only	air-only	JJ	1
air-operating	air-operating	JJ	3
air-ports	air-port	JJ	1
air-power	air-power	JJ	1
air-pressure	air-pressure	JJ	1
air-purifying	air-purifying	JJ	1
air-quality	air-quality	NN	1
air-quotes	air-quote	JJ	4
air-raid	air-raid	JJ	6
air-refueling	air-refueling	JJ	1
air-sac	air-sac	JJ	1
air-sea	air-sea	JJ	1
air-security	air-security	NNP	4
air-semi-colons	air-semi-colon	JJ	1
air-sickness	air-sickness	JJ	1
air-tight	air-tight	JJ	1
air-time	air-time	JJ	1
air-to-air	air-to-air	JJ	5
air-to-ground	air-to-ground	NNP	1
air-traffic	air-traffic	NN	8
air-traffic-control	air-traffic-control	JJ	1
air-transport	air-transport	JJ	1
air-trapping	air-trapping	JJ	1
aira	aira	NNP	1
airbag	airbag	NN	3
airbags	airbag	NNS	5
airbags	airbags	UNC	1
airbase	airbase	NN	1
airbeds	airbed	NNS	1
airborne	airborne	JJ	75
airborne	airborne	NNP	12
airborne	airborne	UNC	1
airbrush	airbrush	NN	6
airbrushed	airbrushed	JJ	8
airbrushed	airbrushed	NNP	1
airbrushes	airbrush	NNS	2
airbrushing	airbrush	VBG	3
airbus	airbus	NNP	72
airbus	airbus	UNC	1
aircomes	aircome	NNS	1
airconditioner	airconditioner	JJR	1
aircraft	aircraft	NN	694
aircraft	aircraft	NNP	64
aircraft	aircraft	UNC	5
aircraft-and	aircraft-and	JJ	1
aircraft-based	aircraft-based	JJ	1
aircraft-carrier	aircraft-carrier	JJ	1
aircraft-presumably	aircraft-presumably	JJ	1
aircraft-that	aircraft-that	JJ	1
aircraft-the	aircraft-the	JJ	1
aircrew	aircrew	NN	1
aircrewmen	aircrewman	NN	1
aircrews	aircrew	NNS	3
airdate	airdate	NN	3
airdates	airdate	NNS	1
airdrop	airdrop	NN	1
airdrops	airdrop	NNP	1
airdrying	airdry	VBG	1
aire	aire	NN	2
aire	aire	NNP	1
aired	air	VBD	151
aired	air	VBN	92
aired	aired	UNC	1
aired	aired	NNP	1
airedale	airedale	NNP	7
aires	aire	NNP	61
airfare	airfare	NN	20
airfares	airfare	NNS	4
airfield	airfield	NN	33
airfield	airfield	NNP	2
airfields	airfield	NNS	9
airfields	airfield	NNP	1
airflow	airflow	NN	11
airflow	airflow	NNP	1
airflow-wise	airflow-wise	JJ	1
airfoil	airfoil	NN	1
airfone	airfone	NNP	1
airfones	airfone	NNP	1
airforce	airforce	NNP	1
airforce	airforce	NN	1
airframe	airframe	NNP	3
airhead	airhead	NN	14
airhead	airhead	NNP	1
airheaded	airheaded	JJ	2
airheads	airhead	NNS	4
airheads	airhead	NNP	1
airholes	airhole	NNS	1
airily	airily	RB	1
airing	air	VBG	81
airing	airing	NN	23
airing	airing	UNC	2
airing	airing	NNP	1
airlangga	airlangga	NNP	1
airless	airless	JJ	10
airlift	airlift	NN	2
airlifted	airlift	VBN	4
airlifting	airlift	VBG	1
airline	airline	NN	403
airline	airline	NNP	12
airline	airline	UNC	1
airline-installed	airline-installed	JJ	1
airline-security	airline-security	NNP	5
airline-speak	airline-speak	JJ	1
airliner	airliner	NN	32
airliner	airliner	NNP	1
airliners	airliner	NNS	33
airlines	airline	NNS	314
airlines	airline	NNPS	309
airlines	airline	NNP	34
airlines	airlines	UNC	2
airlines	airlines	NNP	1
airlock	airlock	NN	6
airmail	airmail	NN	3
airman	airman	NNP	4
airman	airman	NN	2
airman	airman	UNC	1
airmarkets	airmarket	NNS	2
airmarkt	airmarkt	NN	1
airmen	airman	NNS	19
airmen	airman	NNP	3
airness	airness	NNP	2
airobid	airobid	NNP	3
airpanel	airpanel	NNP	3
airphone	airphone	NN	6
airphone	airphone	NNP	4
airphones	airphone	NNS	2
airplane	airplane	NN	250
airplane	airplane	NNP	19
airplane	airplane	UNC	2
airplanes	airplane	NNS	119
airplanes	airplane	NNPS	6
airplane–half	airplane–half	NN	1
airplay	airplay	NN	6
airplay	airplay	NNP	1
airpopper	airpopper	NN	1
airport	airport	NN	718
airport	airport	NNP	258
airport-bookstore	airport-bookstore	JJ	1
airport-security	airport-security	JJ	1
airport-style	airport-style	NNP	1
airports	airport	NNS	201
airports	airport	NNP	12
airquote	airquote	NNP	2
airquotes	airquote	NNS	1
airs	air	NNS	30
airs	air	VBZ	21
airs	air	NNP	6
airship	airship	NN	2
airships	airship	NNS	4
airshow	airshow	NN	3
airshow-notes	airshow-note	NNP	1
airsome	airsome	NN	1
airspace	airspace	NN	75
airspace	airspace	NNP	1
airspaces	airspace	NNS	1
airspeed	airspeed	JJ	1
airspeeds	airspeed	NNS	1
airstone	airstone	NN	7
airstream	airstream	NNP	2
airstrike	airstrike	NN	24
airstrike	airstrike	NNP	3
airstrikes	airstrike	NNS	86
airstrikes	airstrike	NNP	1
airstrikes	airstrikes	UNC	2
airstrip	airstrip	NN	14
airstrips	airstrip	NNS	1
airsupply	airsupply	NNP	1
airthreat	airthreat	NNP	1
airtight	airtight	NN	18
airtime	airtime	NN	21
airton	airton	NNP	1
airtouch	airtouch	NNP	2
airtours	airtour	NNP	1
airtraffic	airtraffic	NNP	5
airtrain	airtrain	NNP	3
airtran	airtran	NNP	4
airvantage	airvantage	NNP	3
airwaves	airwave	NNS	41
airwaves	airwave	NNP	2
airway	airway	NN	83
airway	airway	NNP	2
airways	airway	NNPS	91
airways	airway	NNS	28
airways	airway	NNP	6
airwhomped	airwhomped	JJ	1
airworthiness	airworthiness	NNS	1
airworthy	airworthy	NN	1
airy	airy	JJ	59
airy-fairy	airy-fairy	JJ	1
ais	ai	NNP	38
ais	ai	NNS	2
ais-affected	ais-affected	NNP	8
ais-derived	ais-derived	NNP	11
ais-fibroblasts	ais-fibroblast	NNP	1
aisam	aisam	NNP	7
aisance	aisance	NN	1
aisheh	aisheh	NNP	1
aisi	aisi	NN	1
aisle	aisle	NN	113
aisle	aisle	UNC	3
aisle	aisle	NNP	2
aisles	aisle	NNS	39
aisne	aisne	NNP	1
aisner	aisner	NNP	2
ait	ait	NN	5
ait	ait	NNP	4
aitakute	aitakute	NNP	2
aitana	aitana	NNP	1
aitarak	aitarak	NNP	2
aitch	aitch	NN	3
aitemad	aitemad	NNP	1
aitering	aiter	VBG	1
aith	aith	NN	1
aithal	aithal	NNP	1
aitii	aitius	NN	1
aitken	aitken	NNP	3
aiv	aiv	NNP	1
aiwasfg	aiwasfg	NNP	1
aiwfg	aiwfg	NNP	1
aix	aix	NNP	5
aix-en	aix-en	NNP	8
aix-les	aix-les	NNP	2
aiyee	aiyee	NNP	1
aiyeee	aiyeee	NNP	1
aiyu	aiyu	NN	1
aj	aj	NNP	26
aj	aj	NN	1
aja	aja	NNP	1
ajaccio	ajaccio	NNP	6
ajaj	ajaj	NNP	8
ajami	ajamus	NNP	21
ajania	ajanium	NNP	5
ajaniopsis	ajaniopsis	NNP	1
ajanta	ajanta	NNP	13
ajar	ajar	NN	11
ajara	ajara	NNP	1
ajax	ajax	NNP	5
ajax	ajax	NN	1
ajay	ajay	NNP	1
ajayi	ajayus	NNP	4
ajb	ajb	NNP	1
ajc	ajc	NN	189
ajcc	ajcc	NNP	4
ajd	ajd	NNP	1
ajeerinmob	ajeerinmob	NNP	1
ajeno	ajeno	NN	3
ajl	ajl	NNP	1
ajo	ajo	NNP	3
ajones	ajone	NNS	1
ajor	ajor	NN	1
ajoupa	ajoupa	NNP	1
ajouri	ajourus	NNP	4
ajpheart	ajpheart	NN	1
ajr	ajr	NNP	1
ajs	aj	NNP	3
ajskrym	ajskrym	NN	1
ajt	ajt	NNP	1
ajuntament	ajuntament	NNP	8
ak	ak	NNP	38
ak	ak	NN	5
ak-sar-ben	ak-sar-ben	NNP	1
ak-ses	ak-se	JJ	1
aka	aka	NN	80
aka	aka	NNP	50
aka	aka	UNC	2
akab	akab	NNP	1
akabas	akaba	NNP	1
akademie	akademie	NNP	3
akadimias	akadimia	NNP	1
akaike	akaike	NNP	5
akaishi	akaishus	NNP	1
akaji	akajus	NNP	2
akaka	akaka	NNP	3
akakce	akakce	NNP	1
akal	akal	NN	1
akalaitis	akalaitis	NNP	1
akalin	akalin	NNP	1
akaline	akaline	NN	3
akals	akal	NNP	1
akamai	akamai	UNC	1
akamai	akamaus	NNP	1
akap	akap	NNP	18
akap-directed	akap-directed	NNP	1
akap-kinase	akap-kinase	NNP	1
akaps	akap	NNP	15
akasaka	akasaka	NNP	1
akash	akash	NNP	2
akashic	akashic	NNP	2
akata	aka	NNP	1
akawie	akawie	NNP	2
akbar	akbar	NNP	40
akbar-and	akbar-and	NNP	1
akc	akc	NNP	10
akd	akd	NNP	1
ake	ake	NNP	2
ake	ake	NN	2
akebono	akebono	NNP	3
akechi-daira	akechi-daira	NNP	1
akeem	akeem	NNP	4
akenside	akenside	NNP	1
akers	aker	NNP	4
akes	ake	NNS	1
akev	akev	NNP	1
akewood	akewood	NN	1
akhbar	akhbar	NNP	4
akhenaten	akhenaten	NNP	4
akhenaton	akhenaton	NNP	2
akhentaten	akhentaten	NNP	1
akhil	akhil	NNP	8
akhmad	akhmad	NNP	1
akhmedkhanov	akhmedkhanov	NNP	1
akhnaten	akhnaten	NNP	2
akhnenaten	akhnenaten	NNP	1
akhras	akhra	NNP	1
akhundzada	akhundzada	NN	1
aki	akus	NNP	1
akihabara	akihabara	NNP	3
akihito	akihito	NNP	7
akil	akil	NNP	1
akili	akilus	NNP	2
akim	akim	NNP	2
akimbo	akimbo	NN	4
akin	akin	JJ	122
akin	akin	NNP	9
akin	akin	UNC	1
akinesia	akinesium	NN	1
akinetes	akinete	NNS	1
aking	ake	VBG	2
akinyele	akinyele	NNP	1
akio	akio	NNP	2
akira	akira	NNP	11
akistan	akistan	NN	1
akita	akita	NNP	4
akita	akita	NN	1
akitas	akita	NNS	1
akitas	akita	NNP	1
akiva	akiva	NNP	6
akiyoshi	akiyoshus	NNP	3
akj	akj	NNP	1
akkadian	akkadian	NNP	5
akkadians	akkadian	NNP	2
akko	akko	NNP	12
akkum	akkum	NN	1
aklins	aklin	NNP	1
akman	akman	NNP	1
akmolith	akmolith	NN	1
akn	akn	NNP	1
aknow-nothing	aknow-nothing	NNP	1
aknowledgement	aknowledgement	NN	1
akomé	akomé	NN	1
akoosherke	akoosherke	NN	1
akording	akord	VBG	1
akornblut	akornblut	NN	1
akr	akr	NNP	12
akron	akron	NNP	14
akronafplia	akronafplium	NNP	1
akrotiri	akrotirus	NNP	6
akrotirianí	akrotirianí	NNP	2
akrotíri	akrotíri	NNP	3
akroyd	akroyd	NNP	2
aksa	aksa	NNP	30
aksairt	aksairt	NN	1
aksaray	aksaray	NNP	2
aksoy	aksoy	NNP	1
akst	akst	NNP	11
aksyonov	aksyonov	NNP	1
akt	akt	NNP	47
akta-fplc	akta-fplc	NNP	1
akti	aktus	NNP	2
aktion	aktion	NNP	6
aktivist	aktivist	NN	1
akumal	akumal	NNP	1
akxd	akxd	NNP	93
al	al	NN	4391
al	al	NNP	1604
al-ghala	al-ghala	JJ	1
al-harem	al-harem	JJ	3
al-harem	al-harem	NNP	1
al-high	al-high	NNP	1
al-hobb	al-hobb	NNP	1
al-jaar	al-jaar	JJ	1
al-kalaam	al-kalaam	JJ	1
al-qaida	al-qaida	NNP	2
al-shura	al-shura	JJ	1
ala	ala	NNP	10
ala	alum	NNP	159
ala	alum	NN	20
ala-american	ala-american	NNP	1
ala-bados	ala-bado	JJ	1
ala-ud-din	ala-ud-din	NNP	2
alaa	alaa	NNP	1
alabado	alabado	NN	2
alabados	alabado	NNS	4
alabados	alabado	NNP	3
alabama	alabama	NNP	351
alabama-based	alabama-based	NNP	1
alabama-coushatta	alabama-coushatta	NNP	2
alabamians	alabamian	NNP	5
alabamians	alabamians	NNP	1
alabar	alabar	NN	1
alabastard	alabastard	NNP	1
alabaster	alabaster	NN	24
alabaster	alabaster	NNP	6
alabárdos	alabárdos	NNP	1
alacahöyük	alacahöyük	NNP	1
alack	alack	NN	1
alacranes	alacrane	NNP	1
alacrity	alacrity	NN	8
alactoside	alactoside	NN	1
aladdin	aladdin	NNP	7
alade	alade	NNP	3
aladin	aladin	NNP	1
alagille	alagille	NNP	3
alagna	alagna	NNP	11
alaia	alaium	NNP	3
alain	alain	NNP	20
alaior	alaior	NNP	6
alaior–	alaior–	NNP	1
alais	alai	NNP	1
alam	alam	NNP	2
alamanii	alamanius	NN	1
alamans	alaman	NNP	2
alambre	alambre	NN	2
alambrista	alambrista	NNP	4
alambrista	alambrista	NN	1
alambristas	alambrista	NNS	1
alameda	alameda	NNP	15
alameda-based	alameda-based	NNP	1
alamein	alamein	NNP	1
alamgir	alamgir	NNP	1
alamilla	alamillum	NNP	1
alamillos	alamillo	NNP	1
alamitos	alamito	NNP	2
alamo	alamo	NNP	45
alamo-movie	alamo-movie	NNP	1
alamo-town	alamo-town	NNP	1
alamode	alamode	NN	3
alamodome	alamodome	NNP	4
alamogordo	alamogordo	NNP	1
alamos	alamo	NNP	67
alamosa	alamosa	NNP	1
alan	alan	NNP	669
alana	alana	NNP	1
alane	alane	NNP	1
alanes	alane	NNP	2
alania	alanium	NNP	1
alanin	alanin	NNP	1
alaninaminotransferase	alaninaminotransferase	NN	1
alanine	alanine	NN	98
alanine	alanine	NNP	5
alanine-free	alanine-free	JJ	2
alanine-rich	alanine-rich	JJ	1
alanine-scanning	alanine-scanning	JJ	5
alanine-scanning	alanine-scanning	NNP	1
alanines	alanine	NNS	7
alanis	alani	NNP	20
alanis	alani	NNS	1
alaniz	alaniz	NNP	1
alanna	alanna	NNP	1
alannis	alanni	NNP	2
alanui	alanuus	NNP	3
alanyl	alanyl	NN	23
alanyl-carrier	alanyl-carrier	JJ	1
alap	alap	NN	1
alapage	alapage	NN	1
alaph	alaph	NNP	1
alar	alar	NN	1
alarcon	alarcon	NNP	2
alarcón	alarcón	NNP	3
alaris	alari	NNP	1
alarm	alarm	NN	263
alarm	alarm	NNP	7
alarm	alarm	UNC	1
alarm-like	alarm-like	JJ	1
alarm-system	alarm-system	JJ	3
alarmed	alarm	VBN	75
alarmed	alarmed	JJ	1
alarmed	alarmed	NNP	1
alarmedly	alarmedly	RB	2
alarming	alarm	VBG	7
alarming	alarming	JJ	106
alarming	alarming	UNC	1
alarming	alarming	NNP	1
alarmingbeak	alarmingbeak	NN	1
alarmingly	alarmingly	RB	28
alarmingly	alarmingly	NNP	1
alarmism	alarmism	NN	7
alarmism	alarmism	NNP	1
alarmist	alarmist	NN	21
alarmist-seeming	alarmist-seeming	JJ	1
alarmists	alarmist	NNS	4
alarmists	alarmist	NNP	1
alarms	alarm	NNS	59
alarms	alarm	NNP	3
alarms	alarm	VBZ	2
alarnaot	alarnaot	NNP	1
alarums	alarum	NNS	2
alaró	alaró	NNP	3
alas	ala	NNP	148
alas	ala	UH	106
alas	alas	UNC	3
alasdair	alasdair	NNP	1
alaska	alaska	NNP	253
alaska	alaska	UNC	1
alaska-bound	alaska-bound	NNP	1
alaska-fireworks	alaska-firework	NNP	1
alaska-logging	alaska-logging	NNP	2
alaska-starwars	alaska-starwar	NNP	4
alaska-support	alaska-support	NNP	4
alaska-veggies-cox	alaska-veggies-cox	NNP	1
alaskacoalition	alaskacoalition	NN	2
alaskan	alaskan	JJ	37
alaskan	alaskan	NNP	1
alaskans	alaskan	NNP	11
alassio	alassio	NNP	3
alastair	alastair	NNP	9
alat	alat	NNP	1
alator	alator	NN	1
alawite	alawite	NNP	1
alawites	alawite	NNP	1
alawyer	alawyer	NN	1
alawyer	alawyer	NNP	1
alayne	alayne	NNP	7
alb	alb	NNP	1
alb	alb	NN	1
alba	alba	NNP	11
alba	alba	NN	9
albach	albach	NNP	3
albaicín	albaicín	NNP	4
albaida	albaida	NNP	1
albama	albama	NNP	1
alban	alban	NNP	7
albanesi	albanesus	NNP	1
albania	albania	NNP	1
albania	albanium	NNP	70
albania-pollute	albania-pollute	NNP	3
albanian	albanian	NNP	123
albanian-language	albanian-language	NNP	2
albanian-only	albanian-only	NNP	1
albanians	albanian	NNS	144
albanians	albanians	UNC	3
albanians	albanians	NNP	2
albano	albano	NNP	4
albans	alban	NNP	5
albany	albany	NNP	161
albany	albany	NN	1
albany-based	albany-based	NNP	1
albanyriverrats	albanyriverrat	NNS	1
albar	albar	NNP	2
albaron	albaron	NNP	1
albas	alba	NNP	2
albatenius	albatenius	NNP	1
albatross	albatross	NNS	14
albatross	albatross	NNP	2
albd	albd	NNP	1
albecht	albecht	NNP	1
albedo	albedo	NN	1
albee	albee	NNP	6
albeit	albeit	IN	252
albeit	albeit	UNC	11
albeit	albeit	NNP	2
albemarle	albemarle	NNP	6
albemuth	albemuth	NNP	2
alben	alben	NNP	2
albenda	albenda	NNP	1
albendazole	albendazole	NN	3
albenga	albenga	NNP	1
albequerque	albequerque	NNP	2
albergo	albergo	NNP	1
alberica	alberica	NNP	1
alberini	alberinus	NNP	1
alberni	albernus	NNP	1
alberobello	alberobello	NNP	3
alberoni	alberonus	NNP	1
albers	alber	NNP	1
albert	albert	NNP	224
alberta	alberta	NNP	38
albertaaaaa	albertaaaaa	NNP	1
albertas	alberta	NNP	1
alberti	albertus	NNP	3
albertina	albertina	NNP	1
albertini	albertinus	NNP	1
alberto	alberto	NNP	33
alberton	alberton	NNP	2
albertosaurus	albertosaurus	NNP	1
alberts	albert	NNP	2
albertson	albertson	NNP	9
albertsons	albertson	NNP	2
albertville	albertville	NNP	2
albi	albus	NNP	6
albicans	albican	NNS	34
albiet	albiet	NN	1
albigenses	albigense	NNP	1
albigeois	albigeoi	NNP	1
albin	albin	NNP	2
albini	albinus	NNP	5
albinism	albinism	NN	6
albinism	albinism	NNP	2
albino	albino	NN	22
albino	albino	NNP	8
albinos	albino	NNS	1
albion	albion	NNP	3
albir	albir	NNP	1
albizu	albizu	NNP	1
albizzia	albizzium	NNP	1
albores	albores	NNP	1
alborg	alborg	NNP	1
albornoz	albornoz	NNP	2
alborosella	alborosellum	NN	2
albrecht	albrecht	NNP	20
albrechts	albrecht	NNP	1
albridge	albridge	NNP	1
albright	albright	NNP	352
albright	albright	UNC	2
albrightness	albrightness	NNP	1
albritton	albritton	NNP	1
albrough	albrough	NNP	1
albufeira	albufeira	NNP	20
albufeira	albufeira	NN	1
albufera	albufera	NNP	6
album	album	NN	703
album	album	NNP	12
album	album	UNC	3
album-by-album	album-by-album	JJ	1
album-like	album-like	JJ	1
albumaxi	albumaxus	NNP	1
albume	albume	NN	1
albumen	albumen	NN	1
albumin	albumin	NN	151
albumin	albumin	NNP	10
albumin	albumin	UNC	1
albumin-bound	albumin-bound	JJ	1
albumin-dextrose-catalase	albumin-dextrose-catalase	JJ	1
albumin-to-creatinine	albumin-to-creatinine	JJ	3
albumine	albumine	NN	3
albumins	albumin	NNS	1
albuminuria	albuminurium	NN	9
albuminwas	albuminwa	NNS	1
albums	album	NNS	231
albums	album	NNP	4
albums	albums	UNC	1
albuquerque	albuquerque	NNP	46
albuquerque-based	albuquerque-based	NNP	1
alburger	alburger	NNP	1
alburtis	alburti	NNP	1
albus	albus	JJ	2
albuterol	albuterol	NN	21
albóndigasmeat	albóndigasmeat	NN	1
albóndigasmeatballslenguadosole	albóndigasmeatballslenguadosole	NN	1
alc	alc	NN	1
alcacer	alcacer	NNP	1
alcaeus	alcaeus	NNP	1
alcahest	alcahest	NN	2
alcaicería	alcaicería	NNP	1
alcala	alcalum	NNP	1
alcalay	alcalay	NNP	2
alcaldía	alcaldía	NNP	3
alcaligenes	alcaligene	NNP	1
alcalá	alcalá	NNP	6
alcam	alcam	NNP	2
alcan	alcan	NNP	11
alcantarilha	alcantarilha	NNP	1
alcantarilla	alcantarillum	NNP	1
alcatel	alcatel	NNP	20
alcatraces	alcatrace	NNP	1
alcatraz	alcatraz	NNP	17
alcaufar	alcaufar	NNP	1
alcazaba	alcazaba	NNP	5
alcazaba	alcazaba	NN	1
alcazar	alcazar	NNP	1
alcaçovas	alcaçovas	NNP	1
alcedo	alcedo	NNP	2
alces	alce	NNS	1
alces	alce	NNP	1
alcheh	alcheh	NNP	4
alchemia	alchemium	NNP	1
alchemic	alchemic	JJ	1
alchemical	alchemical	JJ	4
alchemist	alchemist	NN	5
alchemist	alchemist	NNP	1
alchemists	alchemist	NNS	5
alchemize	alchemize	NN	1
alchemized	alchemized	JJ	1
alchemy	alchemy	NN	19
alchemy	alchemy	NNP	4
alcheringa	alcheringa	NN	1
alchohol	alchohol	NN	5
alchoholic	alchoholic	JJ	1
alcian	alcian	NNP	9
alcian	alcian	NN	2
alcibiades	alcibiade	NNP	1
alcoa	alcoa	NNP	18
alcobaça	alcobaça	NNP	2
alcochete	alcochete	NNP	1
alcohol	alcohol	NN	1242
alcohol	alcohol	NNP	140
alcohol	alcohol	UNC	3
alcohol-based	alcohol-based	JJ	1
alcohol-buzzed	alcohol-buzzed	JJ	2
alcohol-dependent	alcohol-dependent	JJ	4
alcohol-drinking	alcohol-drinking	JJ	1
alcohol-focused	alcohol-focused	JJ	2
alcohol-free	alcohol-free	JJ	4
alcohol-free	alcohol-free	NNP	1
alcohol-impaired	alcohol-impaired	JJ	6
alcohol-induced	alcohol-induced	JJ	1
alcohol-involved	alcohol-involved	JJ	1
alcohol-ism	alcohol-ism	JJ	1
alcohol-positive	alcohol-positive	JJ	2
alcohol-related	alcohol-related	JJ	56
alcohol-related	alcohol-related	NNP	5
alcohol-screening	alcohol-screening	JJ	1
alcohol-specific	alcohol-specific	JJ	1
alcohol-use	alcohol-use	JJ	2
alcoholic	alcoholic	JJ	153
alcoholic	alcoholic	NNP	2
alcoholics	alcoholic	NNS	28
alcoholics	alcoholic	NNP	16
alcoholism	alcoholism	NN	99
alcoholism	alcoholism	NNP	24
alcohols	alcohol	NNS	7
alcoholsanonymous	alcoholsanonymous	NNP	1
alcon	alcon	NNP	3
alcools	alcool	NNP	1
alcor	alcor	NNP	71
alcor	alcor	NN	1
alcothon	alcothon	NN	1
alcott	alcott	NNP	8
alcotts	alcott	NNP	2
alcouffe	alcouffe	NNP	4
alcove	alcove	NN	5
alcove	alcove	NNP	1
alcoves	alcove	NNS	3
alcoy	alcoy	NNP	3
alcs	alc	NNP	1
alcudia	alcudium	NNP	1
alcuin	alcuin	NNP	1
alcyonarians	alcyonarian	NNS	1
alcácer	alcácer	NNP	1
alcántara	alcántara	NNP	5
alcázar	alcázar	NNP	16
alcázar	alcázar	NN	2
alcázares	alcázares	NNP	2
alcáçova	alcáçova	NNP	1
alcúdia	alcúdia	NNP	11
alda	alda	NNP	8
aldam	aldam	NNP	2
aldar	aldar	NNP	1
aldase	aldase	NN	1
aldea	aldea	NN	1
aldeanismo	aldeanismo	NN	1
aldebaran	aldebaran	NNP	4
aldehyde	aldehyde	NN	19
aldehyde-containing	aldehyde-containing	JJ	1
aldehyde-forming	aldehyde-forming	JJ	1
aldehydes	aldehyde	NNS	6
aldehydic	aldehydic	JJ	1
aldeia	aldeium	NNP	1
alden	alden	NNP	4
alder	alder	NN	3
alder	alder	NNP	1
alderman	alderman	NNP	9
alderman	alderman	NN	3
aldermen	alderman	NNP	3
alders	alder	NNS	2
alderson	alderson	NNP	4
alderwood	alderwood	NNP	1
aldevron	aldevron	NNP	2
aldh	aldh	NNP	74
aldhous	aldhous	NNP	1
aldiger	aldiger	NNP	1
aldine	aldine	NNP	1
aldo	aldo	NN	2
aldo	aldo	NNP	2
aldo-keto	aldo-keto	JJ	2
aldolase	aldolase	NN	10
aldona	aldona	NNP	1
aldophosphamide	aldophosphamide	NN	1
aldose	aldose	NN	2
aldous	aldous	NNP	13
aldrich	aldrich	NNP	56
aldridge	aldridge	NNP	7
aldrin	aldrin	NNP	12
aldroid	aldroid	NN	1
aldus	aldus	NNP	1
ale	ale	NN	27
ale	ale	NNP	24
ale-fueled	ale-fueled	JJ	1
ale-ya	ale-ya	NNP	1
aleatory	aleatory	NN	1
alebriges	alebrige	NNP	1
alec	alec	NNP	44
aleck	aleck	NN	2
alecks	aleck	NNS	1
alecto	alecto	NNP	1
alectorocephalic	alectorocephalic	JJ	1
aledo	aledo	NNP	1
aledort	aledort	NNP	2
alef	alef	NN	1
alefkandra	alefkandra	NNP	1
alegal	alegal	NN	1
alegranza	alegranza	NNP	1
alegre	alegre	NNP	6
alegria	alegrium	NNP	1
aleh	aleh	NN	1
alehouse	alehouse	NN	1
alei	aleus	NNP	1
aleichem	aleichem	NNP	5
aleinikoff	aleinikoff	NNP	6
alejandra	alejandra	NNP	1
alejandrina	alejandrina	NNP	1
alejandro	alejandro	NNP	19
alejo	alejo	NNP	1
aleksa	aleksa	NNP	1
aleksandar	aleksandar	NNP	1
aleksander	aleksander	NNP	7
aleksandr	aleksandr	NNP	10
aleksandra	aleksandra	NNP	7
aleksei	alekseus	NNP	1
aleksi	aleksus	NNP	1
aleksius	aleksius	NNP	1
alektorophobia	alektorophobia	NN	1
alem	alem	NN	1
alem	alem	NNP	1
alema	alema	NNP	14
alemain	alemain	NNP	1
aleman	aleman	NNP	1
alemana	alemana	NN	1
alemany	alemany	NNP	2
alemberte	alemberte	NNP	2
alembic	alembic	JJ	1
alemán	alemán	NNP	2
alemán	alemán	NN	1
alen	alen	NNP	8
alencon	alencon	NN	1
alencon	alencon	NNP	1
alendronate	alendronate	NN	1
alene	alene	NNP	1
alenes	alene	NNP	2
alenia	alenium	NNP	1
alentejano	alentejano	NNP	1
alentejo	alentejo	NNP	23
aleph	aleph	NN	2
aleph-beth	aleph-beth	JJ	1
aleppo	aleppo	NNP	1
alerding	alerding	NNP	1
alergies	alergy	NNS	1
alert	alert	NN	139
alert	alert	VB	118
alert	alert	NNP	50
alert	alert	JJ	11
alert	alert	UNC	1
alerted	alert	VBD	55
alerted	alerted	NNP	1
alerting	alert	VBG	56
alerting	alerting	NNP	1
alertness	alertness	NNS	20
alerts	alert	VBZ	42
alerts	alert	NNP	2
ales	ale	NNS	10
ales	ale	NNP	2
alessandra	alessandra	NNP	9
alessandro	alessandro	NNP	11
alesser	alesser	NNP	1
alessi	alessus	NNP	2
alessio	alessio	NNP	2
aleta	aleta	NNP	1
alethea	alethea	NNP	1
aleurone	aleurone	NN	1
aleut	aleut	NNP	1
aleutian	aleutian	NNP	3
aleutians	aleutian	NNP	1
aleuts	aleut	NNP	1
aleve	aleve	NNP	3
aleve	aleve	NN	1
alevine	alevine	NN	1
alewife	alewife	NNP	1
alex	alex	NNP	287
alexa	alexa	NNP	70
alexa-calmodulin	alexa-calmodulin	NNP	52
alexa-dye	alexa-dye	NNP	1
alexafluor	alexafluor	NNP	12
alexander	alexander	NNP	423
alexanderplatz	alexanderplatz	NNP	4
alexanders	alexander	NNP	3
alexandra	alexandra	NNP	17
alexandras	alexandra	NNP	1
alexandre	alexandre	NNP	12
alexandria	alexandrium	NNP	114
alexandrians	alexandrian	NNP	2
alexandrina	alexandrina	NNP	1
alexandrinum	alexandrinum	NNP	1
alexandros	alexandro	NNP	5
alexei	alexeus	NNP	14
alexey	alexey	NNP	1
alexi	alexi	NNP	1
alexi	alexus	NNP	3
alexia	alexium	NNP	1
alexie	alexie	NNP	4
alexis	alexi	NNP	90
alexius	alexius	NNP	1
alexiy	alexiy	NNP	1
alexj	alexj	NNP	1
alex­ander	alex­ander	NNP	1
aleyes	aley	NNS	1
aleyes	aley	NNP	1
alf	alf	NNP	12
alf	alf	NN	2
alf-express	alf-express	NNP	1
alf-f	alf-f	NNP	1
alf-r	alf-r	NNP	1
alf-voice	alf-voice	NNP	1
alfa	alfa	NN	90
alfa	alfa	NNP	10
alfabet	alfabet	NN	1
alfabetikli	alfabetiklus	NN	1
alfabia	alfabium	NNP	1
alfalfa	alfalfa	NN	13
alfalfa	alfalfa	NNP	3
alfama	alfama	NNP	10
alfaro	alfaro	NNP	3
alfie	alfie	NNP	5
alfisols	alfisol	NNS	3
alfoldi	alfoldus	NNP	1
alfons	alfon	NNP	1
alfonse	alfonse	NNP	24
alfonseca	alfonseca	NNP	3
alfonso	alfonso	NNP	51
alfonsín	alfonsín	NNP	2
alfonzo	alfonzo	NNP	3
alford	alford	NNP	1
alfre	alfre	NNP	3
alfred	alfred	NNP	139
alfredo	alfredo	NNP	11
alfredo	alfredo	NN	6
alfresco	alfresco	RB	4
alfuckingmighty	alfuckingmighty	NN	1
alfândaga	alfândaga	NNP	1
alfândega	alfândega	NNP	1
alga	alga	NN	21
algae	algae	NN	27
algae	algae	NNP	2
algaiarens	algaiaren	NNP	1
algaida	algaida	NNP	2
algal	algal	NN	13
algal	algal	NNP	3
algar	algar	NNP	4
algardi	algardus	NNP	1
algarve	algarve	NNP	169
algarvensis	algarvensis	NNS	1
algarvian	algarvian	NNP	13
algebra	algebra	NN	66
algebra	algebra	NNP	6
algebra-mapping	algebra-mapping	JJ	1
algebra-wizard	algebra-wizard	JJ	1
algebraic	algebraic	JJ	10
algebraic	algebraic	NNP	1
algebraically	algebraically	RB	6
algebras	algebra	NNS	1
algeciras	algecira	NNP	4
algeo	algeo	NNP	2
alger	alger	NNP	16
alger-type	alger-type	NNP	1
algeria	algerium	NNP	50
algerian	algerian	NNP	46
algerians	algerian	NNP	3
algerians	algerians	UNC	1
algernon	algernon	NNP	4
alghero	alghero	NNP	2
algiers	algier	NNP	9
alginate	alginate	NN	6
algo	algo	NNP	51
algoa	algoa	NNP	1
algometry	algometry	NN	1
algonkian	algonkian	NNP	2
algonquian	algonquian	NNP	6
algonquin	algonquin	NNP	18
algonquin	algonquin	UNC	1
algonquins	algonquin	NNP	1
algore	algore	NNP	1
algorhythms	algorhythm	NNS	1
algorithim	algorithim	NN	1
algorithm	algorithm	NN	541
algorithm	algorithm	NNP	23
algorithm	algorithm	UNC	1
algorithm-driven	algorithm-driven	JJ	1
algorithmic	algorithmic	JJ	43
algorithmically	algorithmically	RB	6
algorithmparameters	algorithmparameter	NNS	1
algorithms	algorithm	NNS	292
algorithms	algorithm	NNP	6
algren	algren	NNP	1
algun	algun	NN	1
algárvio	algárvio	NNP	2
algériens	algériens	NNS	1
alhaji	alhajus	NNP	1
alhamar	alhamar	NNP	1
alhambra	alhambra	NNP	21
alhami	alhamus	NNP	1
alhamilla	alhamillum	NNP	1
alhazmi	alhazmus	NNP	3
ali	ali	NNP	10
ali	alus	NNP	294
ali-a	ali-a	NNP	1
alia	alium	NN	12
alia	alium	NNP	5
aliados	aliado	NNP	1
alianza	alianza	NNP	3
aliança	aliança	NNP	1
alias	alias	NNP	197
alias	alias	NNS	21
aliases	alias	NNS	17
aliases	alias	NNP	1
aliated	aliated	JJ	1
alibay	alibay	NNP	1
alibell	alibell	NNP	1
alibelle	alibelle	NNP	226
alibelle	alibelle	NN	3
alibelle	alibelle	UNC	2
alibelle-n	alibelle-n	NNP	1
alibi	alibi	NN	24
alibi	alibi	UNC	1
alibi	alibi	NNP	1
alibis	alibi	NNS	3
alibis	alibi	NNP	1
alibot	alibot	NNP	1
alibrandi	alibrandus	NNP	1
alibris	alibri	NNP	2
alicante	alicante	NNP	34
alicante–	alicante–	NNP	1
alicantina	alicantina	NN	1
alice	alice	NNP	188
alice	alice	NN	2
alice	alice	UNC	2
alicea	alicea	NNP	2
alicel	alicel	NNP	1
aliceliz	aliceliz	NN	1
alicelizard	alicelizard	NN	4
alicenna	alicenna	NN	1
alicia	alicium	NNP	47
aliciakeys	aliciakey	NNS	1
aliciapatterson	aliciapatterson	NN	1
alien	alien	JJ	257
alien	alien	NN	125
alien	alien	NNP	57
alien	alien	UNC	3
alien-conspiracy	alien-conspiracy	JJ	1
alien-created	alien-created	JJ	1
alien-encounter	alien-encounter	JJ	1
alien-government	alien-government	JJ	1
alien-induced	alien-induced	JJ	1
alien-infected	alien-infected	JJ	1
alien-inhabited	alien-inhabited	JJ	1
alien-looking	alien-looking	JJ	1
alien-representation	alien-representation	JJ	1
alien-type	alien-type	JJ	1
alienable	alienable	JJ	1
alienate	alienate	VB	40
alienated	alienate	VBN	60
alienated	alienated	JJ	1
alienated	alienated	UNC	1
alienated	alienated	NNP	1
alienates	alienate	VBZ	2
alienating	alienate	VBG	34
alienation	alienation	NN	45
alienation	alienation	NNP	4
alienhood	alienhood	NN	1
alienist	alienist	NNP	1
alienmiracleslowgrobaby	alienmiracleslowgrobaby	NNP	1
alienness	alienness	NNS	1
aliens	alien	NNS	318
aliens	alien	NNP	36
aliens-only	aliens-only	JJ	2
alif	alif	NN	62
alif	alif	NNP	5
alig	alig	NNP	1
alighieri	alighierus	NNP	4
alight	alight	NN	12
alighted	alighted	JJ	1
alighting	alight	VBG	2
alights	alight	NNS	2
aligment	aligment	NN	1
align	align	VBP	123
align	align	NNP	4
alignable	alignable	JJ	2
aligned	align	VBN	304
aligned	aligned	NNP	3
aligner	aligner	NNP	1
aligning	align	VBG	40
aligning	aligning	NNP	8
alignment	alignment	NN	780
alignment	alignment	NNP	83
alignment-based	alignment-based	JJ	5
alignment-based	alignment-based	NNP	1
alignments	alignment	NNS	395
alignments	alignment	NNP	25
aligns	align	NNS	12
alignx	alignx	NNP	2
alii	alius	NNP	1
alii	alius	NN	1
alijó	alijó	NNP	1
alike	alike	RB	300
alike	alike	UNC	8
alike	alike	NNP	2
alike-about	alike-about	JJ	1
alikum	alikum	NN	2
alim	alim	NNP	2
alimentary	alimentary	JJ	2
alimentary-eliminative	alimentary-eliminative	JJ	1
alimentum	alimentum	NN	1
alimi	alimus	NNP	1
alimony	alimony	NN	17
alimpi	alimpus	NNP	2
alimzan	alimzan	NNP	1
alimzhan	alimzhan	NNP	5
alina	alina	NNP	2
aline	aline	NNP	2
alinea	alinea	NNP	1
alinksy	alinksy	NNP	3
alinsky	alinsky	NNP	3
alioli	aliolus	NNP	1
aliphatic	aliphatic	JJ	11
aliq	aliq	NN	4
aliquo	aliquo	NN	2
aliquot	aliquot	NN	49
aliquoted	aliquoted	JJ	11
aliquoted	aliquoted	NNP	1
aliquoting	aliquote	VBG	1
aliquots	aliquot	NNS	85
aliquots	aliquot	NNP	41
alireza	alireza	NNP	1
alis	ali	NNP	3
alisa	alisa	NNP	2
alisdair	alisdair	NNP	1
alise	alise	NN	1
alison	alison	NNP	75
alisoun	alisoun	NNP	1
alistair	alistair	NNP	5
alistapart	alistapart	NN	2
alister	alister	NNP	1
alit	alit	NN	1
aliter	aliter	NNP	2
aliteracy	aliteracy	NN	1
alittle	alittle	NNP	1
alive	alive	JJ	910
alive	alive	NNP	41
alive	alive	RB	10
alive	alive	UNC	2
aliveness	aliveness	NNS	1
aliviada	aliviada	NN	2
alix	alix	NNP	7
alixpartners	alixpartner	NNP	6
aliya	aliya	NNP	6
aliyah	aliyah	NNP	1
aliyiah	aliyiah	NNP	1
aliyu	aliyu	NNP	2
aliza	aliza	NNP	6
alizadeh	alizadeh	NNP	9
alizarin	alizarin	NNP	3
alizarin	alizarin	NN	1
alizé	alizé	NNP	2
aljer	aljer	NNP	2
aljezur	aljezur	NNP	1
aljubarrota	aljubarrota	NNP	3
aljube	aljube	NNP	1
alk	alk	NNP	29
alka	alka	NNP	3
alka-seltzer	alka-seltzer	JJ	1
alkahest	alkahest	NN	2
alkali	alkali	NN	4
alkali-sensitive	alkali-sensitive	JJ	1
alkali-stable	alkali-stable	JJ	1
alkaline	alkaline	NN	97
alkaline	alkaline	NNP	12
alkaline-phosphatase	alkaline-phosphatase	JJ	2
alkaline-phosphatase-conjugated	alkaline-phosphatase-conjugated	JJ	1
alkalinity	alkalinity	NN	18
alkalinization	alkalinization	NN	2
alkalization	alkalization	NN	1
alkaloid	alkaloid	NN	7
alkaloid-resistant	alkaloid-resistant	JJ	2
alkaloids	alkaloid	NNS	14
alkalosis	alkalosis	NNS	1
alkamystre	alkamystre	NN	1
alkane	alkane	NN	3
alkanes	alkane	NNS	1
alkanethiol	alkanethiol	NN	1
alkb	alkb	NNP	22
alkb-dependent	alkb-dependent	NNP	1
alkb-like	alkb-like	NNP	2
alkb-related	alkb-related	NNP	1
alkermes	alkerm	NNP	7
alkie	alkie	NNP	1
alkies	alky	NNS	3
alkin	alkin	NNP	1
alkinase	alkinase	NN	1
alkinise	alkinise	NN	1
alkistis	alkisti	NNP	1
alkmaar	alkmaar	NNP	2
alkoxide	alkoxide	NN	2
alkyl	alkyl	NN	8
alkylated	alkylated	JJ	1
alkylates	alkylate	NNS	1
alkylating	alkylate	VBG	11
alkylating-based	alkylating-based	JJ	1
alkylation	alkylation	NN	1
alkylhydroperoxide	alkylhydroperoxide	NN	1
all	all	DT	50687
all	all	PDT	11058
all	all	NNP	669
all	all	UNC	201
all	all	NN	58
all	all	JJ	13
all	all	RB	1
all-?	all-?	JJ	4
all-?-fold	all-?-fold	JJ	1
all-?-sheet	all-?-sheet	JJ	1
all-about	all-about	JJ	1
all-about-fabric	all-about-fabric	JJ	1
all-about-me	all-about-me	JJ	2
all-absorbing	all-absorbing	JJ	1
all-accordion	all-accordion	JJ	1
all-acoustic	all-acoustic	JJ	1
all-against-all	all-against-all	JJ	5
all-agency	all-agency	JJ	1
all-alpha	all-alpha	JJ	2
all-aluminum	all-aluminum	JJ	2
all-american	all-american	NNP	2
all-animal	all-animal	JJ	1
all-around	all-around	JJ	20
all-atom	all-atom	JJ	28
all-atom	all-atom	NNP	1
all-attentive	all-attentive	JJ	2
all-black	all-black	JJ	13
all-body	all-body	JJ	2
all-but-anonymous	all-but-anonymous	JJ	1
all-but-declared-candidate	all-but-declared-candidate	JJ	1
all-but-excluded	all-but-excluded	JJ	1
all-but-marbled	all-but-marbled	JJ	1
all-but-official	all-but-official	JJ	1
all-but-tame	all-but-tame	JJ	1
all-but-unknown	all-but-unknown	JJ	1
all-but-useless	all-but-useless	JJ	1
all-campus	all-campus	JJ	2
all-caps	all-cap	JJ	3
all-cash	all-cash	JJ	1
all-cause	all-cause	JJ	19
all-ceramic	all-ceramic	JJ	3
all-clear	all-clear	JJ	1
all-clothed	all-clothed	JJ	1
all-computer	all-computer	JJ	1
all-conference	all-conference	JJ	2
all-conquering	all-conquering	JJ	1
all-consuming	all-consuming	JJ	8
all-consuming	all-consuming	NNP	1
all-consuming-week-after-week	all-consuming-week-after-week	JJ	1
all-corsets	all-corset	JJ	1
all-court	all-court	JJ	1
all-dancing	all-dancing	JJ	1
all-data	all-data	JJ	3
all-day	all-day	JJ	16
all-deaf	all-deaf	JJ	1
all-department	all-department	JJ	1
all-dessert	all-dessert	JJ	1
all-digit	all-digit	JJ	1
all-dolled	all-dolled	JJ	1
all-elbows	all-elbow	JJ	1
all-electric	all-electric	JJ	1
all-embracing	all-embracing	JJ	2
all-employees	all-employe	JJ	1
all-encompassing	all-encompassing	JJ	15
all-engaging	all-engaging	JJ	1
all-engulfing	all-engulfing	JJ	1
all-enveloping	all-enveloping	JJ	1
all-expense-paid	all-expense-paid	JJ	1
all-expenses-paid	all-expenses-paid	JJ	3
all-federal	all-federal	JJ	1
all-female	all-female	JJ	9
all-filched-from-horror-movies	all-filched-from-horror-movy	JJ	1
all-flag	all-flag	JJ	1
all-for-one	all-for-one	JJ	1
all-fresh	all-fresh	JJ	1
all-gay	all-gay	JJ	1
all-genomes	all-genome	JJ	4
all-girl	all-girl	JJ	8
all-girls	all-girl	JJ	2
all-hands	all-hand	JJ	1
all-hazard	all-hazard	JJ	1
all-heavy	all-heavy	JJ	1
all-helix-bundle	all-helix-bundle	JJ	1
all-hours	all-hour	JJ	2
all-human	all-human	NNP	3
all-importance	all-importance	JJ	1
all-important	all-important	JJ	24
all-in	all-in	NNP	3
all-in	all-in	JJ	1
all-in-one	all-in-one	JJ	1
all-inclusive	all-inclusive	JJ	19
all-inclusive	all-inclusive	NNP	4
all-jam-bands-all-the-time	all-jam-bands-all-the-time	JJ	1
all-knowing	all-knowing	JJ	8
all-laughs	all-laugh	JJ	1
all-leather	all-leather	JJ	2
all-levels	all-level	JJ	1
all-local	all-local	JJ	1
all-lower-case	all-lower-case	JJ	1
all-lowercase	all-lowercase	JJ	3
all-mail	all-mail	JJ	2
all-male	all-male	JJ	14
all-means	all-mean	JJ	1
all-media	all-media	JJ	1
all-members	all-member	JJ	2
all-men	all-men	JJ	1
all-merciful	all-merciful	JJ	1
all-metal	all-metal	JJ	1
all-mighty	all-mighty	JJ	1
all-mond	all-mond	JJ	1
all-naked	all-naked	JJ	1
all-natural	all-natural	JJ	5
all-network	all-network	JJ	1
all-new	all-new	JJ	22
all-news	all-new	JJ	6
all-news-all-the-time	all-news-all-the-time	JJ	1
all-night	all-night	JJ	22
all-night	all-night	NNP	1
all-nighter	all-nighter	JJ	6
all-nighter	all-nighter	NNP	1
all-nighter-company-keeping	all-nighter-company-keeping	JJ	1
all-nighters	all-nighter	JJ	3
all-nighters-pulling	all-nighters-pulling	JJ	1
all-nude	all-nude	JJ	6
all-nude	all-nude	NNP	1
all-nude-debate	all-nude-debate	JJ	1
all-one	all-one	JJ	2
all-or-none	all-or-none	JJ	2
all-or-nothing	all-or-nothing	JJ	9
all-out	all-out	JJ	41
all-over	all-over	JJ	5
all-pay	all-pay	JJ	1
all-payer	all-payer	JJ	1
all-pervading	all-pervading	JJ	1
all-pervasive	all-pervasive	JJ	6
all-points	all-point	JJ	3
all-powerful	all-powerful	JJ	21
all-pro	all-pro	JJ	1
all-pupil	all-pupil	JJ	1
all-purpose	all-purpose	JJ	33
all-purpose	all-purpose	NNP	1
all-rac	all-rac	JJ	1
all-rac-?-tocopherol	all-rac-?-tocopherol	JJ	1
all-race	all-race	JJ	1
all-risk	all-risk	JJ	1
all-rock	all-rock	JJ	1
all-round	all-round	JJ	4
all-school	all-school	JJ	1
all-season	all-season	JJ	2
all-seeing	all-seeing	JJ	7
all-ship	all-ship	JJ	1
all-singing	all-singing	JJ	1
all-sister	all-sister	JJ	1
all-source	all-source	JJ	9
all-sports	all-sport	JJ	3
all-staff	all-staff	JJ	1
all-stakes	all-stake	JJ	1
all-star	all-star	JJ	40
all-star	all-star	NNP	9
all-stars	all-star	NNP	2
all-stars	all-star	JJ	1
all-state	all-state	JJ	1
all-stock	all-stock	JJ	9
all-student	all-student	JJ	1
all-survivors	all-survivor	JJ	16
all-talk	all-talk	JJ	2
all-temperature	all-temperature	JJ	1
all-terrain	all-terrain	JJ	2
all-text	all-text	JJ	3
all-the	all-the	NNP	2
all-the-president	all-the-president	JJ	1
all-the-time	all-the-time	JJ	4
all-the-way-to-the-edge	all-the-way-to-the-edge	JJ	1
all-there	all-there	JJ	1
all-things-to-all-people	all-things-to-all-people	JJ	1
all-time	all-time	JJ	121
all-time	all-time	NNP	1
all-time-high	all-time-high	JJ	1
all-timers	all-timer	JJ	1
all-to	all-to	JJ	1
all-together	all-together	JJ	1
all-together-now	all-together-now	JJ	1
all-too-common	all-too-common	JJ	3
all-too-credulous	all-too-credulous	JJ	1
all-too-familiar	all-too-familiar	JJ	5
all-too-frequent	all-too-frequent	JJ	1
all-too-human	all-too-human	JJ	2
all-too-pervasive	all-too-pervasive	JJ	1
all-too-rare	all-too-rare	JJ	1
all-too-real	all-too-real	JJ	1
all-too-scarce	all-too-scarce	JJ	1
all-too-sexy	all-too-sexy	JJ	1
all-too-sudden	all-too-sudden	JJ	1
all-too-typical	all-too-typical	JJ	1
all-trans	all-tran	JJ	28
all-trans	all-tran	NNP	1
all-trans-retinal	all-trans-retinal	JJ	1
all-try	all-try	JJ	1
all-versus-all	all-versus-all	JJ	1
all-volunteer	all-volunteer	JJ	2
all-weather	all-weather	JJ	6
all-weather	all-weather	NNP	1
all-week	all-week	JJ	1
all-wheel-drive	all-wheel-drive	JJ	2
all-white	all-white	JJ	17
all-wise	all-wise	JJ	1
all-women	all-women	JJ	2
all-world	all-world	JJ	1
all-you-can	all-you-can	JJ	1
all-you-can-eat	all-you-can-eat	JJ	2
alla	allum	NN	16
alla	allum	NNP	2
allada	allada	NNP	1
alladvantage	alladvantage	NNP	1
allagash	allagash	NNP	3
allah	allah	NNP	44
allah	allah	NN	6
allah-prevail	allah-prevail	NNP	1
allahabad	allahabad	NNP	1
allahu	allahu	NN	1
allaire	allaire	NNP	2
allais	allai	NNP	2
allais	allais	UNC	1
allakhverdov	allakhverdov	NNP	1
allan	allan	NNP	61
allanheld	allanheld	NNP	1
allante	allante	NNP	2
allantoin	allantoin	NN	1
allapplicable	allapplicable	JJ	1
allard	allard	NNP	2
allat	allat	NNP	1
allay	allay	VB	26
allayed	allay	VBN	5
allaying	allay	VBG	2
allbaugh	allbaugh	NNP	11
allbecause	allbecause	NN	1
allcaps	allcap	NNP	1
allcontract	allcontract	NN	1
alle	alle	NNP	1
alledged	alledged	JJ	1
alledgedly	alledgedly	RB	1
allee	allee	NNP	6
alleeeelic	alleeeelic	NNP	1
allegation	allegation	NN	65
allegation	allegation	UNC	2
allegation	allegation	NNP	1
allegations	allegation	NNS	366
allegations	allegation	NNP	9
allegations	allegations	UNC	1
allege	allege	VBP	25
allege	allege	VB	5
alleged	allege	VBN	443
alleged	allege	VBD	30
alleged	alleged	JJ	88
alleged	alleged	NNP	10
alleged	alleged	UNC	2
alleged-abuse	alleged-abuse	NNP	1
allegedly	allegedly	RB	277
allegedly	allegedly	NNP	11
allegedly	allegedly	UNC	1
allegedy	allegedy	NN	1
alleges	allege	VBZ	71
alleges	allege	NNP	3
alleges	allege	NNS	2
alleghenies	allegheny	NNP	1
allegheny	allegheny	NNP	4
allegiance	allegiance	NN	77
allegiance	allegiance	NNP	50
allegiance	allegiance	UNC	1
allegiances	allegiance	NNS	13
allegiant	allegiant	NN	2
alleging	allege	VBG	68
alleging	alleging	NNP	3
alleging	alleging	UNC	1
allegis	allegi	NNP	8
allegis	allegis	UNC	1
allegorical	allegorical	JJ	14
allegorical	allegorical	NNP	1
allegorically	allegorically	RB	3
allegories	allegories	UNC	1
allegories	allegory	NNS	3
allegorizing	allegorize	VBG	1
allegory	allegory	NN	24
allegory	allegory	NNP	5
allegra	allegra	NNP	15
allegre	allegre	NNP	1
allegria	allegrium	NNP	1
allegro	allegro	NNP	3
allegèd	allegèd	NN	1
allehulia	allehulium	NNP	1
allele	allele	NN	564
allele	allele	NNP	19
allele-sharing	allele-sharing	JJ	2
allele-specific	allele-specific	JJ	50
allele-specific	allele-specific	NNP	1
allelefrequencies	allelefrequency	NNS	1
alleleic	alleleic	JJ	1
alleles	allele	NNS	508
alleles	allele	NNP	4
allelic	allelic	JJ	89
allelic	allelic	NNP	5
allelic-interactions	allelic-interaction	JJ	1
allelically	allelically	RB	1
allelism	allelism	NN	2
allelotyping	allelotype	VBG	2
alleluia	alleluium	NNP	1
allemagne	allemagne	NNP	1
alleman	alleman	NNP	1
allemands	allemand	NNP	1
allen	allen	NNP	474
allen	allen	UNC	1
allen	allen	NN	1
allen-like	allen-like	NNP	1
allenberg	allenberg	NNP	1
allenbrand	allenbrand	NNP	5
allenby	allenby	NNP	5
allendal	allendal	NNP	1
allendale	allendale	NNP	3
allende	allende	NNP	12
allenstown	allenstown	NNP	1
allenswood	allenswood	NNP	1
allentown	allentown	NNP	3
aller	aller	NN	1
allergan	allergan	NNP	1
allergen	allergen	NN	39
allergen-induced	allergen-induced	JJ	2
allergen-induced	allergen-induced	NNP	1
allergen-reactive	allergen-reactive	JJ	1
allergen-specific	allergen-specific	JJ	3
allergenic	allergenic	JJ	3
allergenicity	allergenicity	NN	1
allergens	allergen	NNS	22
allergic	allergic	JJ	131
allergic	allergic	NNP	5
allergically	allergically	RB	2
allergies	allergy	NNS	68
allergies	allergy	NNP	8
allergist	allergist	NN	2
allergists	allergist	NNS	1
allergists	allergist	NNP	1
allergy	allergy	NN	83
allergy	allergy	NNP	12
allergy	allergy	UNC	2
allergy-inducing	allergy-inducing	JJ	1
allergy-plant	allergy-plant	JJ	1
allergy-prone	allergy-prone	JJ	1
allergy-provoking	allergy-provoking	JJ	1
allergy-ridden	allergy-ridden	JJ	1
allergy-suffering	allergy-suffering	JJ	1
allers	aller	NNP	1
allerton	allerton	NNP	3
alles	alle	NNS	2
alles	alle	NNP	2
allesandro	allesandro	NNP	1
alleve	alleve	NN	1
alleviate	alleviate	VB	84
alleviated	alleviated	JJ	13
alleviates	alleviate	NNS	2
alleviating	alleviate	VBG	15
alleviation	alleviation	NN	5
allex	allex	NNP	2
allexperimental	allexperimental	NN	1
alley	alley	NN	146
alley	alley	NNP	46
alley	alley	JJ	1
alley	alley	UNC	1
alleymen	alleymen	UNC	1
alleyoop	alleyoop	NNP	1
alleys	alley	NNS	83
alleys	alley	NNP	1
alleyway	alleyway	NN	16
alleyway	alleyway	NNP	1
alleyways	alleyway	NNS	38
allez	allez	NNP	2
allgemeine	allgemeine	NNP	38
allgemeine	allgemeine	UNC	1
allgenes	allgene	NNP	1
allgolf	allgolf	NNP	1
allh	allh	NN	3
allha	allha	NN	2
allhands	allhand	NNP	1
allhat	allhat	NNP	35
alliacea	alliacea	NN	2
alliance	alliance	NN	235
alliance	alliance	NNP	179
alliance	alliance	JJ	1
alliance-and	alliance-and	NNP	1
alliances	alliance	NNS	59
alliances	alliance	NNP	3
alliances	alliances	UNC	2
alliant	alliant	NNP	1
allibelle	allibelle	NNP	5
allibelle	allibelle	NN	1
allie	allie	NNP	4
allied	allied	NNP	49
allied	allied	JJ	2
allied	ally	VBD	116
allied-led	allied-led	JJ	1
allies	allies	UNC	4
allies	ally	NNS	384
allies	ally	NNP	3
alligateur	alligateur	NN	1
alligator	alligator	NN	27
alligator	alligator	NNP	18
alligator-infested	alligator-infested	JJ	1
alligator-like	alligator-like	JJ	1
alligatored	alligatored	JJ	1
alligators	alligator	NNS	15
alligators	alligator	NNP	2
allin	allin	NNP	4
allina	allina	NNP	1
allinger	allinger	NNP	1
allinputs	allinput	NNS	1
allis	alli	NNP	2
allise	allise	NNP	1
allisforgivencakes	allisforgivencake	NNP	2
allision	allision	NN	1
allison	allison	NNP	93
allison-gratitude	allison-gratitude	JJ	1
allistaire	allistaire	NNP	2
alliston	alliston	NNP	1
alliterate	alliterate	NN	1
alliterates	alliterate	NNS	1
alliterating	alliterate	VBG	1
alliteration	alliteration	NN	8
alliteration	alliteration	NNP	1
alliterations	alliteration	NNS	1
alliterative	alliterative	JJ	11
alliterative	alliterative	NNP	1
alliteratively	alliteratively	RB	1
alliternative	alliternative	JJ	1
allium	allium	NN	2
allium	allium	NNP	1
alliums	allium	NNS	1
alliès	alliès	NNP	1
alljessewants	alljessewant	NNS	1
allkind	allkind	NNP	1
alll	alll	NN	3
alll	alll	NNP	1
allll	allll	NN	2
alllll	alllll	NN	1
allllll	allllll	NNP	1
alllllllll	alllllllll	NNP	1
alllllllll	alllllllll	NN	1
allllllllll	allllllllll	NN	1
alllyson	alllyson	UNC	1
allman	allman	NNP	3
allmon	allmon	NNP	11
allmusic	allmusic	JJ	11
allmusic	allmusic	NNP	10
alln	alln	NNP	21
alln-induced	alln-induced	NNP	2
allo	allo	NN	9
allo	allo	NNP	1
allo-immune	allo-immune	JJ	2
allo-tetraploid	allo-tetraploid	JJ	1
allocate	allocate	VB	100
allocate	allocate	VBP	25
allocateallowances	allocateallowance	NNS	1
allocated	allocate	VBN	171
allocated	allocate	VBD	32
allocated	allocated	NNP	7
allocatedunder	allocatedunder	NN	1
allocates	allocate	NNS	12
allocates	allocate	NNP	1
allocating	allocate	VBG	42
allocating	allocating	NNP	2
allocation	allocation	NN	259
allocation	allocation	NNP	10
allocation	allocation	UNC	1
allocationamount	allocationamount	NN	1
allocationfor	allocationfor	NN	1
allocations	allocation	NNS	97
allocations	allocation	NNP	26
allocations-levels	allocations-level	JJ	1
allochrome	allochrome	NNP	1
allochthonous	allochthonous	JJ	1
allodynia	allodynium	NN	3
allogeneic	allogeneic	JJ	12
allograft	allograft	NN	13
allografts	allograft	NNS	3
allografts	allograft	NNP	1
allogrooming	allogroom	VBG	2
allolactose	allolactose	NN	3
allometry	allometry	NN	1
allomorphs	allomorph	NNS	2
allonissos	allonisso	NNP	1
allons	allon	NNP	3
allons	allon	NNS	1
alloo	alloo	NN	1
allopathic	allopathic	JJ	3
allopatric	allopatric	JJ	18
allopatry	allopatry	NN	5
allophone	allophone	NNP	1
allophonic	allophonic	JJ	1
allophycocyanin	allophycocyanin	NN	3
allophycocyanin	allophycocyanin	NNP	1
alloplo	alloplo	NN	1
alloploi	alloploi	NN	1
alloploidy	alloploidy	NN	1
allopolyploid	allopolyploid	NN	2
allopolyploidy	allopolyploidy	NN	14
allopregnanolone	allopregnanolone	NN	2
allopurinol	allopurinol	NN	2
allose	allose	NN	1
allosteric	allosteric	JJ	34
allosteric	allosteric	NNP	2
allosterically	allosterically	RB	2
allostery	allostery	NN	2
allot	allot	NN	14
allother	allother	NN	1
allotment	allotment	NN	14
allotments	allotment	NNS	7
allots	allot	NNS	2
allott	allott	NNP	2
allotted	allotted	JJ	34
allottees	allottee	NNS	1
allotting	allot	VBG	1
allout	allout	JJ	1
allover	allover	NN	4
allow	allow	VB	1762
allow	allow	VBP	375
allow	allow	NNP	1
allow	allow	NN	1
allowability	allowability	NN	1
allowable	allowable	JJ	60
allowable	allowable	NNP	1
allowance	allowance	NN	169
allowance	allowance	NNP	61
allowance-to-emission-reduction	allowance-to-emission-reduction	JJ	4
allowanceallocations	allowanceallocation	NNS	2
allowanceprogram	allowanceprogram	NN	1
allowances	allowance	NNS	615
allowances	allowance	NNP	41
allowances	allowances	NN	1
allowancesallocated	allowancesallocated	JJ	1
allowancesavailable	allowancesavailable	JJ	2
allowancescomprising	allowancescomprise	VBG	1
allowancesunder	allowancesunder	NN	3
allowed	allow	VBN	1600
allowed	allow	VBD	625
allowed	allow	VB	1
allowed	allowed	NNP	10
allowed	allowed	UNC	5
allowed	allowed	JJ	3
allowing	allow	VBG	840
allowing	allowing	UNC	1
allowing	allowing	NNP	1
allows	allow	VBZ	1060
allows	allow	NNP	6
allows	allows	UNC	2
allowsoptimal	allowsoptimal	NN	1
alloxan	alloxan	NN	1
alloy	alloy	NN	10
alloy	alloy	NNP	1
alloyed	alloyed	JJ	1
alloys	alloy	NNS	10
alloys	alloy	NNP	1
allozyme	allozyme	NN	1
allozymes	allozyme	NNS	1
allpolitics	allpolitic	NNP	8
allport	allport	NNP	3
allpostoperative	allpostoperative	JJ	1
allpurpose	allpurpose	NN	1
allraitnik	allraitnik	NN	1
allready	allready	NNP	1
allreasonable	allreasonable	JJ	1
allrecipes	allrecipe	NNS	1
allred	allred	NNP	3
allright	allright	NNP	4
allright	allright	NN	1
allrightnik	allrightnik	NN	1
allrighty	allrighty	NNP	1
allroad	allroad	NN	1
alls	all	NNS	4
allsource	allsource	NN	1
allspice	allspice	NN	2
allstarfanprotest	allstarfanprotest	NN	1
allstars	allstar	NNP	1
allstate	allstate	NNP	4
allston	allston	NNP	10
allt	allt	NN	1
alltell	alltell	NNP	1
allterrain	allterrain	NN	1
allthat	allthat	NN	1
alltime	alltime	NN	1
alltogether	alltogether	NN	2
allude	allude	NN	16
alluded	allude	VBD	31
alludes	allude	NNS	24
alluding	allude	VBG	31
alluding	alluding	NNP	4
allure	allure	NN	56
allure	allure	NNP	5
allures	allure	NNS	1
alluring	alluring	JJ	38
alluringly	alluringly	RB	3
allusion	allusion	NN	42
allusion	allusion	NNP	2
allusion-dropping	allusion-dropping	JJ	1
allusions	allusion	NNS	37
allusions	allusion	NNP	3
allusions	allusions	NNP	1
allusive	allusive	JJ	8
allusive	allusive	UNC	1
allusively	allusively	RB	1
allusiveness	allusiveness	NNS	1
alluvial	alluvial	JJ	7
alluvials	alluvial	NNS	1
alluvium	alluvium	NN	5
allwang	allwang	NNP	1
ally	ally	NN	140
ally	ally	NNP	71
ally	ally	VB	14
allying	ally	VBG	5
allyl-d	allyl-d	JJ	2
allyn	allyn	NNP	1
allyourbase	allyourbase	NN	1
allysa	allysa	NNP	2
allyshun	allyshun	NNP	1
allyson	allyson	NNP	612
allyson	allyson	UNC	5
allyson-it	allyson-it	NNP	1
allysonian	allysonian	NNP	1
allègre	allègre	NNP	2
allée	allée	NNP	2
allées	allées	NNS	1
allées	allées	NNP	1
alm	alm	NNP	78
alm	alm	NN	3
alma	alma	JJ	42
alma	alma	NNP	24
almaden	almaden	NNP	1
almagor	almagor	NNP	2
almah	almah	NN	21
almah	almah	NNP	1
almahide	almahide	NNP	1
almanac	almanac	NNP	14
almanac	almanac	NN	9
almanacs	almanac	NNS	2
almancil	almancil	NNP	6
almanzo	almanzo	NNP	1
almanzor	almanzor	NNP	1
almanzora	almanzora	NNP	1
almare	almare	NNP	5
almaty	almaty	NNP	1
almedina	almedina	NN	1
almeida	almeida	NNP	17
almei­da	almei­da	NNP	1
almejasbaby	almejasbaby	NN	2
almendro	almendro	NNP	1
almereyda	almereyda	NNP	2
almería	almería	NNP	15
almighty	almighty	NNP	21
almighty	almighty	NN	17
almirante	almirante	NNP	2
almishkat	almishkat	NNP	1
alml	alml	NNP	1
almo	almo	NNP	4
almodis	almodi	NNP	1
almodovar	almodovar	NNP	7
almodóvar	almodóvar	NNP	10
almodóvar	almodóvar	UNC	1
almogim	almogim	NNP	1
almohada	almohada	NN	1
almohades	almohade	NNP	1
almohads	almohad	NNP	1
almond	almond	NN	41
almond	almond	NNP	17
almond-crusted	almond-crusted	JJ	1
almond-lemon	almond-lemon	NNP	1
almond-shaped	almond-shaped	JJ	3
almonds	almond	NNS	26
almonds	almond	NNP	1
almonry	almonry	NN	1
almonte	almonte	NNP	1
almoravid	almoravid	NNP	1
almoravids	almoravid	NNP	1
almost	almost	RB	6201
almost	almost	UNC	22
almost	almost	NNP	8
almost	almost	NN	4
almost-a-campaign	almost-a-campaign	JJ	1
almost-animal	almost-animal	JJ	1
almost-beautiful	almost-beautiful	JJ	1
almost-birthday-twin	almost-birthday-twin	JJ	1
almost-black	almost-black	JJ	2
almost-but-not-entirely	almost-but-not-entirely	JJ	1
almost-but-not-quite-redoubtable	almost-but-not-quite-redoubtable	JJ	1
almost-cherubic	almost-cherubic	JJ	1
almost-comedy	almost-comedy	JJ	1
almost-completed	almost-completed	JJ	1
almost-completely	almost-completely	JJ	1
almost-declaration	almost-declaration	JJ	1
almost-delivered	almost-delivered	JJ	1
almost-dusty	almost-dusty	JJ	1
almost-empty	almost-empty	JJ	2
almost-endless	almost-endless	JJ	1
almost-forgotten	almost-forgotten	JJ	1
almost-half	almost-half	JJ	1
almost-lost	almost-lost	JJ	1
almost-mythological	almost-mythological	JJ	1
almost-not-red-at-all	almost-not-red-at-all	JJ	1
almost-painful	almost-painful	JJ	1
almost-polite	almost-polite	JJ	1
almost-president	almost-president	JJ	1
almost-real	almost-real	JJ	1
almost-straight	almost-straight	JJ	1
almosts	almost	NNS	1
almostsane	almostsane	NNP	2
almourol	almourol	NNP	1
almr	almr	NNP	1
alms	alms	NNP	39
alms	alms	NNS	7
almsbasket	almsbasket	NN	1
almshouse	almshouse	NNP	1
almsot	almsot	NN	3
almsround	almsround	NN	1
almudaina	almudaina	NNP	5
almuñécar	almuñécar	NNP	5
almy	almy	NNP	5
almyerda	almyerda	NNP	1
aln	aln	NN	3
alnifolium	alnifolium	NN	1
alnorum	alnorum	NN	1
alnus	alnus	NNP	1
alnylam	alnylam	NNP	3
alo	alo	NN	1
alocal	alocal	NN	1
aloe	aloe	NN	5
aloe	aloe	NNP	2
aloed	aloed	JJ	1
alof	alof	NNP	1
aloft	aloft	RB	17
aloft	aloft	UNC	1
alogencim	alogencim	NN	1
aloha	aloha	NNP	11
alohnna	alohnna	NNP	1
alois	aloi	NNP	2
alok	alok	NNP	2
aloka	aloka	NNP	2
alol	alol	NNP	1
alom	alom	NN	1
alomar	alomar	NNP	30
alomari	alomarus	NNP	1
alon	alon	NNP	3
alona	alona	NNP	1
alone	alone	RB	2698
alone	alone	NNP	80
alone	alone	UNC	14
alone	alone	JJ	7
alone-ness	alone-ness	JJ	1
alone-to	alone-to	JJ	1
aloneness	aloneness	NNS	7
along	along	IN	5113
along	along	RB	338
along	along	UNC	28
along	along	RP	18
along	along	NNP	5
along-getting	along-getting	JJ	1
alonger	alonger	NN	1
alongside	alongside	IN	272
alonissos	alonisso	NNP	5
alonso	alonso	NNP	15
alonzo	alonzo	NNP	18
alonzo-dunsmoor	alonzo-dunsmoor	NNP	1
aloo	aloo	NN	1
aloof	aloof	NN	34
aloof	aloof	UNC	1
aloofness	aloofness	NNS	13
alope	alope	NNP	1
alopecia	alopecia	NN	1
alor	alor	NNP	1
alora	alora	NNP	1
alors	alor	NNP	5
alors	alor	NNS	1
alosetron	alosetron	NN	1
alot	alot	NN	14
alot	alot	NNP	3
alot	alot	UNC	1
alotamus	alotamus	JJ	1
alotta	alotta	NN	1
alou	alou	NNP	15
alouatte	alouatte	NNP	1
aloud	aloud	RB	71
aloud	aloud	NNP	1
alouicious	alouicious	NNP	1
aloul	aloul	NNP	5
alove	alove	NN	4
aloy	aloy	NNP	2
aloyisia	aloyisium	NNP	2
aloysia	aloysium	NNP	1
aloysius	aloysius	NNP	6
alp	alp	NNP	1
alp-like	alp-like	NNP	1
alpa	alpa	NN	1
alpaca	alpaca	NN	4
alpaca	alpaca	NNP	2
alpacas	alpaca	NNP	2
alpacas	alpaca	NNS	1
alpar	alpar	NNP	3
alpargatas	alpargata	NNS	1
alpaugh	alpaugh	NNP	10
alpco	alpco	NNP	1
alpe	alpe	NNP	3
alpena	alpena	NNP	2
alpenglow	alpenglow	NN	1
alper	alper	NNP	1
alperin	alperin	NNP	2
alpern	alpern	NNP	1
alpert	alpert	NNP	7
alpert	alpert	NN	2
alpes	alp	NNP	13
alpes	alpes	NNP	1
alpha	alpha	NN	422
alpha	alpha	NNP	53
alpha-adrenergic	alpha-adrenergic	JJ	6
alpha-alpha	alpha-alpha	JJ	1
alpha-amino	alpha-amino	JJ	1
alpha-amino-caprylic	alpha-amino-caprylic	JJ	1
alpha-amylase	alpha-amylase	JJ	8
alpha-amylases	alpha-amylase	JJ	2
alpha-antagonists	alpha-antagonist	JJ	1
alpha-carbon	alpha-carbon	JJ	2
alpha-chain	alpha-chain	JJ	1
alpha-crystallin	alpha-crystallin	JJ	35
alpha-crystallin	alpha-crystallin	NNP	2
alpha-factor	alpha-factor	JJ	1
alpha-ferret	alpha-ferret	JJ	1
alpha-fibrin	alpha-fibrin	JJ	2
alpha-globin	alpha-globin	JJ	1
alpha-glucosidase	alpha-glucosidase	JJ	1
alpha-ground-squirrel	alpha-ground-squirrel	JJ	1
alpha-gustducin	alpha-gustducin	NNP	2
alpha-helical	alpha-helical	JJ	4
alpha-helix	alpha-helix	JJ	1
alpha-helix-initiation	alpha-helix-initiation	JJ	1
alpha-helix-termination	alpha-helix-termination	JJ	1
alpha-hydroxy	alpha-hydroxy	JJ	1
alpha-hydroxylase	alpha-hydroxylase	JJ	1
alpha-interferon	alpha-interferon	JJ	1
alpha-keto	alpha-keto	JJ	1
alpha-keto-dehydrogenase	alpha-keto-dehydrogenase	JJ	1
alpha-keto-glu	alpha-keto-glu	JJ	1
alpha-keto-gluterate	alpha-keto-gluterate	JJ	4
alpha-male	alpha-male	JJ	3
alpha-malevolent	alpha-malevolent	JJ	1
alpha-myosin	alpha-myosin	JJ	1
alpha-numeric	alpha-numeric	JJ	1
alpha-proteobacteria	alpha-proteobacteria	JJ	10
alpha-proteobacterial	alpha-proteobacterial	JJ	12
alpha-proteobacterium	alpha-proteobacterium	JJ	2
alpha-satellite	alpha-satellite	JJ	1
alpha-secretases	alpha-secretase	JJ	1
alpha-to-enter	alpha-to-enter	JJ	2
alpha-to-remove	alpha-to-remove	JJ	2
alpha-tocopherol	alpha-tocopherol	JJ	61
alpha-tocopherol	alpha-tocopherol	NNP	2
alpha-tocopheryl	alpha-tocopheryl	JJ	25
alpha-tocopheryl	alpha-tocopheryl	NNP	1
alpha-tropo-miacine	alpha-tropo-miacine	JJ	1
alpha-tubulin	alpha-tubulin	JJ	1
alpha-wave-overdosed	alpha-wave-overdosed	JJ	1
alphaa	alphaa	NN	59
alphaa	alphaa	NNP	7
alphaa-crystallin	alphaa-crystallin	JJ	1
alphaako	alphaako	NN	2
alphab	alphab	NN	26
alphab	alphab	NNP	3
alphab-crystallin	alphab-crystallin	JJ	1
alphabet	alphabet	NN	109
alphabet	alphabet	NNP	19
alphabet-lace	alphabet-lace	JJ	1
alphabeta	alphabeta	NNP	1
alphabetic	alphabetic	JJ	13
alphabetic	alphabetic	NNP	2
alphabetical	alphabetical	JJ	41
alphabetical	alphabetical	NNP	1
alphabetically	alphabetically	RB	26
alphabetization	alphabetization	NN	4
alphabetize	alphabetize	NN	2
alphabetized	alphabetized	JJ	6
alphabetizes	alphabetize	NNS	1
alphabetizing	alphabetize	VBG	3
alphabets	alphabet	NNS	18
alphabets	alphabets	UNC	1
alphabko	alphabko	NN	2
alphacel	alphacel	NNP	2
alphaeasefc	alphaeasefc	NNP	1
alphagene	alphagene	NNP	1
alphanumeric	alphanumeric	JJ	6
alpharabius	alpharabius	NNP	1
alpharetta	alpharetta	NNP	7
alphas	alpha	NNS	5
alphaville	alphaville	NNP	5
alphoid	alphoid	NN	24
alphoid	alphoid	NNP	1
alphonse	alphonse	NNP	1
alphonsus	alphonsus	NNP	1
alpilles	alpille	NNP	2
alpin	alpin	NNP	1
alpine	alpine	NNP	41
alpine	alpine	NN	16
alpine-backed	alpine-backed	NNP	1
alpinia	alpinium	NN	9
alpinia	alpinium	NNP	1
alpinus	alpinus	JJ	1
alpirez	alpirez	NNP	1
alpo	alpo	NNP	2
alportel	alportel	NNP	2
alpro	alpro	NNP	2
alps	alp	NNP	103
alpujarra	alpujarra	NNP	4
alpujarras	alpujarra	NNP	3
alq	alq	NNP	1
alqueda	alqueda	NNP	1
alr	alr	NNP	3
alr	alr	NN	1
alre	alre	NN	1
alreadhy	alreadhy	NN	2
already	already	RB	5753
already	already	UNC	8
already	already	NNP	7
already	already	JJ	1
already-called	already-called	JJ	3
already-crowded	already-crowded	JJ	1
already-dead-scene	already-dead-scene	JJ	1
already-delivered	already-delivered	JJ	1
already-established	already-established	JJ	1
already-existing	already-existing	JJ	1
already-finished	already-finished	JJ	1
already-impressive	already-impressive	JJ	1
already-limited	already-limited	JJ	1
already-low	already-low	JJ	1
already-myelinated	already-myelinated	JJ	1
already-occupied	already-occupied	JJ	1
already-once-convicted	already-once-convicted	JJ	1
already-ongoing	already-ongoing	JJ	1
already-outdated	already-outdated	JJ	1
already-overburdened	already-overburdened	JJ	1
already-processed	already-processed	JJ	1
already-reported	already-reported	JJ	1
already-scheduled	already-scheduled	JJ	1
already-seen	already-seen	JJ	1
already-snarled	already-snarled	JJ	1
already-strong	already-strong	JJ	1
already-waiting	already-waiting	JJ	1
already-weak	already-weak	JJ	1
alreadydrowned	alreadydrowned	JJ	1
alrededor	alrededor	NN	1
alri	alri	NN	2
alright	alright	NN	665
alright	alright	NNP	47
alrighty	alrighty	NN	33
alrighty	alrighty	NNP	2
alrm	alrm	NNP	1
alroomi	alroomus	NNP	1
als	al	NNP	21
als	al	NNS	4
als	als	NN	2
alsace	alsace	NNP	17
alsacien	alsacien	NNP	1
alsafar	alsafar	NNP	1
alsamoud	alsamoud	NN	2
alsamouds	alsamoud	NNS	3
alsancak	alsancak	NNP	1
alsatian	alsatian	NNP	14
alsdorf	alsdorf	NNP	1
alsmadi	alsmadus	NNP	1
also	also	RB	32854
also	also	NNP	42
also	also	UNC	37
also	also	JJ	2
also	also	NN	1
also-ran	also-ran	NN	7
also-rans	also-ran	JJ	5
also-where	also-where	JJ	1
alsoashes	alsoash	NNS	1
alsofrom	alsofrom	NNP	1
alsomeasured	alsomeasured	JJ	1
alson	alson	NN	1
alsop	alsop	NNP	3
alstom	alstom	NNP	3
alston	alston	NNP	2
alstott	alstott	NNP	1
alt	alt	NN	36
alt	alt	NNP	33
alt-control-delete	alt-control-delete	NNP	1
alt-countriers	alt-countrier	JJ	1
alt-country	alt-country	JJ	3
alt-countrypolitan	alt-countrypolitan	JJ	1
alt-folk	alt-folk	JJ	2
alt-med	alt-med	NNP	2
alt-pop	alt-pop	NNP	1
alt-pop	alt-pop	JJ	1
alt-press	alt-press	JJ	1
alt-rock	alt-rock	JJ	2
alt?nkap?	alt?nkap?	NNP	1
alta	alta	NNP	19
altaaf	altaaf	NNP	3
altadena	altadena	NNP	2
altaic	altaic	NNP	2
altair	altair	NNP	2
altamira	altamira	NNP	3
altamirano	altamirano	NNP	1
altamont	altamont	NNP	2
altamonte	altamonte	NNP	1
altana	altana	NNP	9
altar	altar	NN	190
altar	altar	NNP	9
altar	altar	UNC	1
altar-like	altar-like	JJ	1
altarcito	altarcito	NN	2
altarcitos	altarcito	NNS	1
altare	altare	NN	1
altarpiece	altarpiece	NN	15
altarpiece	altarpiece	NNP	2
altarpieces	altarpiece	NNS	3
altars	altar	NNS	32
altars	altar	NNP	8
altar­piece	altar­piece	NN	1
altas	alta	NNP	2
altavista	altavista	NNP	12
altaya	altaya	NNP	1
alte	alte	NNP	7
alte	alte	NN	1
altea	altea	NNP	7
altea-la	altea-la	NNP	1
altenberg	altenberg	NNP	2
altendorfs	altendorf	NNP	1
alter	alter	VB	384
alter	alter	VBP	38
alter	alter	NNP	26
alter-ego	alter-ego	JJ	2
alteration	alteration	NN	140
alteration	alteration	NNP	9
alterations	alteration	NNS	247
alterations	alteration	NNP	11
alterations	alterations	UNC	1
altercation	altercation	NN	5
altercations	altercation	NNS	3
altered	alter	VBN	510
altered	alter	VBD	98
altered	altered	NNP	19
altered	altered	JJ	3
alterers	alterer	NNS	1
altering	alter	VBG	125
altering	altering	NNP	6
alterman	alterman	NNP	24
alternate	alternate	JJ	228
alternate	alternate	NNP	10
alternate-dimensional	alternate-dimensional	JJ	1
alternate-history	alternate-history	JJ	3
alternate-side-of-the-street	alternate-side-of-the-street	JJ	1
alternated	alternated	JJ	12
alternatehistory	alternatehistory	NNP	1
alternately	alternately	RB	53
alternately	alternately	NNP	13
alternately	alternately	UNC	2
alternatepersonality	alternatepersonality	NNP	1
alternates	alternate	VBZ	12
alternates	alternate	NNS	2
alternating	alternate	VBG	53
alternating	alternating	NNP	3
alternation	alternation	NN	4
alternations	alternation	NNS	1
alternative	alternative	NN	813
alternative	alternative	JJ	792
alternative	alternative	NNP	157
alternative	alternative	UNC	8
alternative-country	alternative-country	NNP	1
alternative-country	alternative-country	JJ	1
alternative-free-response	alternative-free-response	JJ	1
alternative-fuels	alternative-fuel	JJ	1
alternative-medicine	alternative-medicine	JJ	2
alternative-news	alternative-new	JJ	1
alternative-program	alternative-program	JJ	1
alternative-rock	alternative-rock	JJ	3
alternative-universe	alternative-universe	JJ	1
alternativebalancing	alternativebalance	VBG	1
alternativecompliance	alternativecompliance	NN	1
alternatively	alternatively	RB	340
alternatively	alternatively	NN	1
alternatives	alternative	NNS	330
alternatives	alternative	NNP	21
alternatives	alternatives	UNC	2
alternativesconsidered	alternativesconsidered	JJ	1
alternator	alternator	NN	14
alters	alter	NNS	73
altersstil	altersstil	NN	1
alterthe	alterthe	NN	1
altes	alt	NNP	6
altfest	altfest	NNP	2
althea	althea	NNP	15
alther	alther	NNP	1
althert	althert	NNP	1
altho	altho	NN	2
altho	altho	NNP	1
althoff	althoff	NNP	2
althogh	althogh	NNP	1
althorp	althorp	NNP	3
althoug	althoug	NN	1
although	although	IN	7746
although	although	UNC	69
although	although	NNP	2
althoughj	althoughj	UNC	1
althought	althought	NN	1
althoughthere	althoughthere	NNP	1
althoughto	althoughto	NNP	3
althugh	althugh	NNP	1
althumairy	althumairy	NNP	4
althumairy	althumairy	NN	2
althusser	althusser	NNP	1
alticor	alticor	NNP	2
altie-hip-hop	altie-hip-hop	JJ	1
alties	alty	NNS	1
altima	altima	NNP	6
altimas	altima	NNP	1
altimeter	altimeter	NN	3
altinkum	altinkum	NNP	1
altiplano	altiplano	NN	1
altissima	altissima	NN	1
altitude	altitude	NN	129
altitude	altitude	NNP	7
altitude	altitude	UNC	2
altitude-measuring	altitude-measuring	JJ	1
altitudes	altitude	NNS	28
altman	altman	NNP	109
altmans	altman	NNP	1
alto	alto	NNP	117
alto	alto	NN	13
altogether	altogether	RB	301
altogether	altogether	UNC	6
altoids	altoid	NNP	3
alton	alton	NNP	34
alton-based	alton-based	NNP	2
altonaer	altonaer	NNP	2
altoona	altoona	NNP	2
altos	alto	NNP	5
altos	alto	NNS	1
altra	altra	NNP	1
altreuter	altreuter	NNP	1
altrincham	altrincham	NNP	3
altropine	altropine	NN	1
altrose	altrose	NN	1
altruism	altruism	NN	34
altruism	altruism	NNP	1
altruist	altruist	NN	4
altruistic	altruistic	JJ	30
altruistic	altruistic	NNP	1
altruistically	altruistically	RB	1
altruists	altruist	NNS	3
altrusa	altrusa	NNP	2
altrusian	altrusian	NNP	2
altrusitic	altrusitic	JJ	1
altsanger	altsanger	NNP	5
altschul	altschul	NNP	1
altstadt	altstadt	NNP	2
altstätten	altstätten	NNP	1
altunisi	altunisus	NN	1
alturas	altura	NNP	1
altus	altus	JJ	3
altísimo	altísimo	NN	1
alu	alu	NNP	65
alu	alu	NN	4
aluf	aluf	NNP	2
alui	aluus	NNP	1
alum	alum	NN	20
alum	alum	NNP	2
alumah	alumah	NNP	1
alumen	aluman	NN	2
alumin	alumin	NN	1
alumina	alumina	NN	3
aluminium	aluminium	NN	11
aluminium	aluminium	NNP	8
aluminous	aluminous	JJ	1
aluminum	aluminum	NN	282
aluminum	aluminum	NNP	4
aluminum	aluminum	JJ	2
aluminum	aluminum	UNC	1
aluminum-alloy	aluminum-alloy	JJ	1
aluminum-clad	aluminum-clad	JJ	1
aluminum-wielding	aluminum-wielding	JJ	1
alumium	alumium	NN	1
alumna	alumna	NN	5
alumna	alumna	NNP	3
alumnae	alumna	NN	7
alumni	alumnus	NNS	191
alumni	alumnus	NNP	48
alumnus	alumnus	NN	27
alumnus	alumnus	NNP	3
alums	alum	NNS	4
alums	alums	UNC	1
alun-alun	alun-alun	NNP	1
alured	alured	NNP	1
alurista	alurista	NNP	2
alus	alus	NNP	1
alusuisse	alusuisse	NNP	1
alutaceus	alutaceus	JJ	1
alv	alv	NNP	3
alv	alv	NN	1
alva	alva	NNP	4
alvar	alvar	NNP	4
alvarado	alvarado	NNP	13
alvares	alvare	NNP	1
alvarez	alvarez	NNP	30
alvaro	alvaro	NNP	4
alvent	alvent	NN	6
alveolar	alveolar	NN	73
alveolar	alveolar	NNP	2
alveolar-capillary	alveolar-capillary	JJ	4
alveolar-interstitial	alveolar-interstitial	JJ	2
alveoli	alveolus	NN	12
alveolitis	alveolitis	NNS	1
alveolus	alveolus	JJ	3
alvernia	alvernium	NNP	4
alves	alve	NNP	1
alvin	alvin	NNP	25
alvinium	alvinium	NN	3
alvor	alvor	NNP	3
alvy	alvy	NNP	1
alvão	alvão	NNP	1
alwa	alwa	NN	2
alwaleed	alwaleed	NNP	1
alwan	alwan	NNP	2
alwas	alwa	NNS	1
alway	alway	NN	3
always	alway	RB	9649
always	alway	NNP	28
always	always	UNC	17
always	always	JJ	1
always	always	NNP	1
always-important	always-important	JJ	1
always-on	always-on	JJ	1
always-present	always-present	JJ	1
always-right	always-right	JJ	1
always-rightness	always-rightness	JJ	1
always-shrewd	always-shrewd	JJ	1
always-spectacular	always-spectacular	JJ	1
always-taker	always-taker	JJ	1
always-takers	always-taker	JJ	1
always-troubled	always-troubled	JJ	1
alwaysattend	alwaysattend	NN	1
alwin	alwin	NNP	1
alwn	alwn	NNP	1
alwni	alwnus	NNP	1
alwsy	alwsy	NN	1
alwyn	alwyn	NNP	1
aly	aly	NNP	19
alyamani	alyamanus	NNP	1
alyce	alyce	NNP	1
alydar	alydar	NNP	2
alyeska	alyeska	NNP	3
alynne	alynne	NNP	11
alyosha	alyosha	NNP	1
alyscamps	alyscamp	NNP	1
alysheba	alysheba	NNP	2
alysis	alysis	NNS	1
alyson	alyson	NNP	44
alysonhannigancorner	alysonhannigancorner	NN	1
alyssa	alyssa	NNP	9
alyzer	alyzer	NN	1
alzet	alzet	NNP	1
alzforum	alzforum	NN	1
alzheimer	alzheimer	NNP	200
alzheimers	alzheimer	NNP	2
alzou	alzou	NNP	1
al­ca­lá	al­ca­lá	NNP	1
al­lowed	al­lowed	JJ	1
aléxandros	aléxandros	NNP	1
alêne	alêne	NNP	1
am	am	NNP	761
am	am	NN	6
am	am	UNC	4
am	am	JJ	3
am	be	VBP	7640
am-add-nyt-budget	am-add-nyt-budget	NNP	17
am-chau	am-chau	NNP	2
am-early-frontpage-nyt	am-early-frontpage-nyt	NNP	9
am-frontpage-nyt	am-frontpage-nyt	NNP	10
am-ing	am-ing	JJ	1
am-not-a-princess	am-not-a-princess	JJ	2
am-nyt-budget	am-nyt-budget	NNP	15
am-or	am-or	JJ	1
am-page	am-page	NNP	14
am-to-midnight	am-to-midnight	NNP	1
am-type	am-type	NNP	1
am?teátrum	am?teátrum	NNP	1
ama	ama	NNP	60
ama	ama	NN	6
ama	ama	UNC	1
ama-assn	ama-assn	JJ	2
amabelle	amabelle	NNP	1
amabilis	amabili	NNS	2
amaco	amaco	NNP	1
amacrine	amacrine	NN	10
amad	amad	NNP	3
amadei	amadeus	NNP	5
amadeus	amadeus	NNP	10
amado	amado	NNP	1
amador	amador	NNP	6
amadorio	amadorio	NNP	2
amadou	amadou	NNP	9
amadour	amadour	NNP	1
amagansett	amagansett	NNP	2
amah	amah	NNP	1
amahiganiak	amahiganiak	NN	1
amahlia	amahlium	NN	1
amainstream	amainstream	NN	1
amajor	amajor	NNP	1
amajority	amajority	NNP	1
amakusa	amakusa	NNP	3
amal	amal	NNP	5
amal	amal	NN	1
amalfi	amalfus	NNP	12
amalgam	amalgam	NN	36
amalgamate	amalgamate	VB	4
amalgamated	amalgamated	NNP	7
amalgamated	amalgamated	JJ	5
amalgamates	amalgamate	NNS	1
amalgamation	amalgamation	NN	12
amalgamations	amalgamation	NNS	1
amalgams	amalgam	NNS	1
amalgan	amalgan	NN	1
amalgo	amalgo	NN	3
amali	amalus	NNP	3
amalia	amalium	NNP	6
amalias	amalia	NNP	2
amalie	amalie	NNP	8
amalla	amallum	NNP	1
amalricus	amalricus	NNP	2
amalthea	amalthea	NNP	2
amama	amama	NNP	1
aman	aman	NNP	8
amanda	amanda	NNP	124
amandaness	amandaness	NNP	1
amani	amanus	NNP	2
amanitas	amanita	NNS	1
amanpour	amanpour	NNP	3
amantadine	amantadine	NN	4
amante	amante	NN	1
amanti	amantus	NNP	1
amantidine-resistant	amantidine-resistant	JJ	1
amantis	amanti	NNP	2
amanuenses	amanuensis	NNS	1
amanuensis	amanuensis	NNS	1
amaqjuaq	amaqjuaq	NNP	1
amar	amar	NNP	30
amara	amara	NNP	3
amara	amara	NN	1
amaral	amaral	NNP	6
amarante	amarante	NNP	1
amaranth	amaranth	NN	2
amaretto	amaretto	NN	4
amaretto	amaretto	NNP	2
amarga	amarga	NN	1
amari	amarus	NNP	2
amarilla	amarillum	NNP	1
amarillo	amarillo	NNP	36
amarillo-area	amarillo-area	NNP	1
amarillo-based	amarillo-based	NNP	1
amarillodiocese	amarillodiocese	NN	1
amarinic	amarinic	JJ	1
amarlai	amarlaus	NN	1
amarna	amarna	NNP	4
amarnath	amarnath	NNP	1
amaro	amaro	NNP	1
amaros	amaro	NNP	20
amarra	amarra	NNP	3
amartya	amartya	NNP	4
amarus	amarus	JJ	1
amaryllis	amarylli	NNS	1
amaryllis	amarylli	NNP	1
amas	ama	NNP	1
amasando	amasando	NNP	1
amass	amass	VB	14
amass	amass	VBP	1
amass	amass	NNP	1
amassed	amass	VBN	34
amassed	amass	VBD	7
amassed	amassed	UNC	1
amasses	amass	VBZ	2
amassing	amass	VBG	15
amaterasu	amaterasu	NNP	4
amateur	amateur	JJ	178
amateur-astronomer	amateur-astronomer	NNP	1
amateur-theater	amateur-theater	JJ	1
amateurbitch	amateurbitch	NN	1
amateurish	amateurish	JJ	20
amateurishness	amateurishness	NNS	1
amateurs	amateur	NNS	38
amateurs	amateur	NNP	3
amateurs	amateurs	UNC	1
amatller	amatller	NNP	2
amato	amato	NNP	97
amatoing	amatoing	NNP	2
amatoism	amatoism	NNP	1
amatory	amatory	NN	1
amatter	amatter	NNP	1
amature	amature	NNP	1
amauri	amaurus	NNP	1
amaurosis	amaurosis	NNS	1
amaury	amaury	NNP	1
amavit	amavit	NN	1
amaya	amaya	NNP	2
amaze	amaze	VB	12
amazed	amaze	VBN	214
amazed	amazed	NNP	2
amazed	amazed	JJ	2
amazeingfunmazes	amazeingfunmaze	NNS	1
amazement	amazement	NN	43
amazement	amazement	UNC	1
amazes	amaze	NNS	34
amaziah	amaziah	NNP	1
amazigh	amazigh	NNP	1
amazin	amazin	NN	1
amazing	amazing	JJ	1004
amazing	amazing	NNP	30
amazing	amazing	UNC	3
amazing-review	amazing-review	NNP	3
amazingly	amazingly	RB	94
amazingly	amazingly	NNP	29
amazon	amazon	NNP	421
amazon	amazon	NN	17
amazon	amazon	UNC	2
amazon-earnings	amazon-earning	NNP	2
amazon-earns	amazon-earn	NNP	1
amazon-like	amazon-like	NNP	2
amazon-radar	amazon-radar	NNP	1
amazona	amazona	NNP	1
amazoned	amazoned	NNP	1
amazonia	amazonium	NNP	1
amazonian	amazonian	JJ	13
amazons	amazon	NNP	1
amb	amb	NN	2
amba	amba	NNP	1
ambah	ambah	NNP	4
ambani	ambanus	NNP	11
ambash	ambash	NNP	6
ambassador	ambassador	NN	172
ambassador	ambassador	NNP	65
ambassador-at-large	ambassador-at-large	JJ	1
ambassador-level	ambassador-level	JJ	1
ambassador-nominee	ambassador-nominee	NNP	1
ambassadorial	ambassadorial	NN	6
ambassadors	ambassador	NNS	27
ambassadors	ambassador	NNP	7
ambassadorship	ambassadorship	NN	7
ambassadorships	ambassadorship	NNS	4
ambassy	ambassy	NN	1
amber	amber	NNP	86
amber	amber	NN	36
amber-coloured	amber-coloured	NNP	1
amber-lighted	amber-lighted	JJ	1
ambergris	ambergris	NNS	1
amberjack	amberjack	NN	3
amberlyte	amberlyte	NNP	1
ambersons	amberson	NNP	1
amberstone	amberstone	NNP	1
ambev	ambev	NNP	2
ambi	ambus	NN	2
ambiance	ambiance	NN	10
ambidexterity	ambidexterity	NN	1
ambidextrous	ambidextrous	JJ	7
ambidextrous	ambidextrous	NNP	1
ambien	ambien	NNP	3
ambience	ambience	NN	44
ambience	ambience	NNP	1
ambient	ambient	NN	87
ambient	ambient	NNP	17
ambigious	ambigious	JJ	2
ambigous	ambigous	JJ	1
ambiguities	ambiguity	NNS	33
ambiguities	ambiguity	NNP	2
ambiguity	ambiguity	NN	123
ambiguity	ambiguity	NNP	7
ambiguity	ambiguity	UNC	1
ambiguous	ambiguous	JJ	164
ambiguous	ambiguous	NNP	4
ambiguous	ambiguous	UNC	2
ambiguously	ambiguously	RB	7
ambiguus	ambiguus	JJ	2
ambion	ambion	NNP	62
ambis	ambi	NNP	1
ambisextrous	ambisextrous	JJ	2
ambit	ambit	NN	5
ambiti	ambiti	NN	1
ambition	ambition	NN	139
ambition	ambition	NNP	6
ambition	ambition	UNC	3
ambition-crazed	ambition-crazed	JJ	1
ambitions	ambition	NNS	116
ambitions	ambitions	UNC	1
ambitious	ambitious	JJ	291
ambitious	ambitious	NNP	7
ambitiously	ambitiously	RB	6
ambivalence	ambivalence	NN	69
ambivalent	ambivalent	JJ	75
ambivalent	ambivalent	NNP	3
ambivalently	ambivalently	RB	1
ambivialent	ambivialent	NN	1
amble	amble	VB	10
ambled	ambled	JJ	4
ambler	ambler	NNP	2
ambles	amble	NNS	1
ambleside	ambleside	NNP	20
ambling	amble	VBG	6
ambling	ambling	NNP	2
amboise	amboise	NNP	3
ambon	ambon	NNP	1
ambos	ambo	NNP	2
ambosa	ambosa	NNP	1
amboy	amboy	NNP	2
ambrex	ambrex	NN	1
ambriz	ambriz	NNP	2
ambroggio	ambroggio	NNP	2
ambrogio	ambrogio	NNP	5
ambroise	ambroise	NNP	1
ambrose	ambrose	NNP	97
ambrose	ambrose	NN	1
ambrose	ambrose	UNC	1
ambrosia	ambrosia	NNP	2
ambrosia	ambrosia	NN	1
ambrosiana	ambrosiana	NNP	1
ambrosio	ambrosio	NNP	14
ambroso	ambroso	NNP	1
ambrotype	ambrotype	NN	1
ambrotypes	ambrotype	NNS	1
ambrous	ambrous	NNP	2
ambrozic	ambrozic	NNP	3
ambs	amb	NNP	5
ambulan	ambulan	NN	1
ambulance	ambulance	NN	64
ambulance	ambulance	NNP	4
ambulance-chasing	ambulance-chasing	JJ	1
ambulances	ambulance	NNS	15
ambulants	ambulant	NNS	2
ambulate	ambulate	NN	1
ambulatory	ambulatory	JJ	51
ambulatory	ambulatory	NNP	14
ambulence	ambulence	NN	1
ambush	ambush	NN	52
ambush	ambush	NNP	7
ambushed	ambush	VBD	18
ambushers	ambusher	NNS	3
ambushes	ambush	NNS	1
ambushing	ambush	VBG	4
amby	amby	NNP	2
ambystoma	ambystoma	NNP	1
ambélou	ambélou	NNP	1
amc	amc	NNP	17
amca	amca	NNP	1
amcarl	amcarl	NN	1
amcat	amcat	NNP	1
amchau	amchau	NNP	2
amcwamc	amcwamc	NNP	1
amd	amd	NNP	13
amd	amd	NN	5
amd-performance	amd-performance	NNP	4
amda	amda	NNP	1
amdanda	amdanda	NNP	1
amdec	amdec	NNP	2
amdec	amdec	NN	1
amdt	amdt	NNP	1
amduat	amduat	NNP	4
ame	ame	NN	3
ame	ame	NNP	1
ameboid	ameboid	NN	2
ameca	ameca	NNP	1
amed	amed	NNP	3
amedeo	amedeo	NNP	2
ameer	ameer	NNP	1
ameet	ameet	NNP	2
ameijeiras	ameijeira	NNP	1
amelia	amelium	NNP	25
amelica	amelica	NNP	1
amelie	amelie	NNP	41
amelio	amelio	NNP	9
ameliorate	ameliorate	NN	19
ameliorated	ameliorated	JJ	12
ameliorates	ameliorate	NNS	1
ameliorating	ameliorate	VBG	9
amelioration	amelioration	NN	11
amelioration	amelioration	NNP	1
ameliorative	ameliorative	JJ	3
amelistris	amelistris	NN	1
amemiya	amemiya	NNP	1
amen	aman	NN	8
amen	aman	NNP	4
amen	amen	UH	49
amenable	amenable	JJ	41
amend	amend	VB	46
amend	amend	NNP	1
amendable	amendable	JJ	4
amended	amend	VBN	125
amended	amend	VBD	21
amended	amended	NNP	1
amendedreconstruction	amendedreconstruction	NN	1
amendement	amendement	NN	1
amending	amend	VBG	26
amendment	amendment	NNP	439
amendment	amendment	NN	261
amendment	amendment	UNC	7
amendment-friendly	amendment-friendly	NNP	1
amendment-given	amendment-given	NNP	1
amendments	amendment	NNS	174
amendments	amendment	NNP	73
amendments	amendments	UNC	5
amends	amends	NNS	44
amends	amends	NNP	38
amenemhet	amenemhet	NNP	1
amenhotep	amenhotep	NNP	3
amenities	amenities	UNC	1
amenities	amenity	NNS	70
amenity	amenity	NN	2
ameno	ameno	NNP	1
amenophis	amenophi	NNP	10
amenorrhea	amenorrhea	NN	3
amensiac	amensiac	NNP	1
amentia	amentium	NN	1
amer	amer	NNP	5
ameranda	ameranda	NNP	1
amerco	amerco	NNP	4
amereican	amereican	NNP	1
ameri	ameri	NNP	4
ameri	amerus	NNP	1
america	america	NNP	4477
america	america	UNC	33
america	america	NN	3
america-bound	america-bound	NNP	1
america-first	america-first	NNP	1
america-firsters	america-firster	NNP	1
america-hating	america-hating	NNP	2
america-mura	america-mura	NNP	1
americaat	americaat	NNP	1
americain	americain	NNP	1
americaland	americaland	NNP	1
americaleave	americaleave	NNP	1
americamysis	americamysis	NNP	1
american	american	JJ	6164
american	american	NNP	4138
american	american	NN	8
american	american	UNC	4
american-airlines	american-airline	NNP	3
american-approved	american-approved	NNP	1
american-backed	american-backed	NNP	3
american-based	american-based	NNP	3
american-born	american-born	NNP	16
american-bred	american-bred	NNP	2
american-culture	american-culture	NNP	1
american-dream	american-dream	NNP	1
american-educated	american-educated	NNP	2
american-financed	american-financed	NNP	2
american-flag-burning	american-flag-burning	NNP	1
american-funded	american-funded	NNP	1
american-government	american-government	NNP	1
american-hating	american-hating	NNP	1
american-league	american-league	NNP	1
american-led	american-led	NNP	15
american-made	american-made	JJ	9
american-ness	american-ness	NNP	2
american-piloted	american-piloted	NNP	1
american-produced	american-produced	NNP	1
american-sponsored	american-sponsored	NNP	3
american-style	american-style	JJ	23
american-style	american-style	NNP	1
american-trained	american-trained	NNP	1
american-y	american-y	NNP	1
americana	americana	NNS	29
americana	americana	NN	8
americana	americana	NNP	1
americana-auction	americana-auction	NNP	1
americaners	americaner	NNP	1
americanese	americanese	NNP	1
americaness	americaness	NNP	1
americanettes	americanette	NNP	1
americanew	americanew	NNP	1
americangreetings	americangreeting	NNP	2
americanhistory	americanhistory	NN	2
americanians	americanian	NNP	1
americanisation	americanisation	NNP	1
americanism	americanism	NNP	30
americanismos	americanismo	NNP	1
americanisms	americanism	NNP	13
americanizado	americanizado	NN	2
americanizados	americanizado	NNS	1
americanization	americanization	NNP	9
americanized	americanize	VBD	16
americanizing	americanizing	NNP	1
americanlawyer	americanlawyer	NNP	1
americanleather	americanleather	NN	1
americanlegacy	americanlegacy	NN	1
americann	americann	NNP	1
americanness	americanness	NNP	3
americano	americano	NN	1
americano	americano	NNP	1
americanos	americano	NNS	1
americanpolitics	americanpolitic	NNS	1
americans	american	NNPS	2986
americans	american	NNP	33
americans	americans	UNC	22
americans-win	americans-win	NNP	1
americantrust	americantrust	NNP	1
americanum	americanum	NN	3
americanum	americanum	NNP	1
americanus	americanus	JJ	4
americard	americard	NNP	1
americas	america	NNPS	86
americas	america	NNP	7
americasarmy	americasarmy	NN	1
americastestkitchen	americastestkitchen	NN	1
americasunknownchild	americasunknownchild	NN	1
americentric	americentric	NNP	1
americium	americium	NNP	3
americo	americo	NNP	3
americorps	americorp	NNP	14
americorps	americorps	UNC	1
americus	americus	NNP	2
amerie	amerie	NNP	1
amerigo	amerigo	NNP	12
amerika	amerika	NNP	1
amerikani	amerikanus	NNP	1
amerikanits	amerikanit	NNS	1
amerikanka	amerikanka	NNP	1
amerikans	amerikan	NNP	1
amerikanskij	amerikanskij	NN	1
amerikanskije	amerikanskije	NN	1
amerikantsi	amerikantsus	NN	1
ameriker	ameriker	NNP	1
amerindia	amerindium	NNP	1
amerindian	amerindian	NNP	17
amerindians	amerindian	NNP	9
amerinidian	amerinidian	NNP	1
amerishima	amerishima	NNP	1
ameritech	ameritech	NNP	10
ameritrade	ameritrade	NNP	1
amerlex	amerlex	NNP	1
amerrikeh	amerrikeh	NNP	1
amersfoort	amersfoort	NNP	1
amersham	amersham	NNP	181
amerta	amerta	NN	1
amery	amery	NNP	1
amer­i­cans	amer­i­cans	NNP	1
ames	ame	NNP	71
ames	ame	NNS	1
ameslan	ameslan	NNP	1
amethodology	amethodology	NNP	1
amethyst	amethyst	NN	3
amethysts	amethyst	NNS	1
ameti	ametus	NNP	1
amevive	amevive	NNP	2
amex	amex	NNP	8
amf	amf	NNP	3
amfar	amfar	NNP	2
amfi	amfus	NN	1
amg	amg	NNP	28
amgen	amgen	NNP	38
amguard	amguard	NNP	1
amgydala	amgydalum	NN	1
amh	amh	NNP	1
amharic	amharic	NNP	1
amherst	amherst	NNP	32
amherst-based	amherst-based	NNP	2
ami	amus	NNP	21
amia	amium	NNP	4
amiability	amiability	NN	2
amiable	amiable	JJ	38
amiable	amiable	NNP	1
amiably	amiably	RB	9
amibiguous	amibiguous	JJ	1
amicable	amicable	JJ	11
amicably	amicably	RB	11
amice	amice	NNP	1
amichai	amichaus	NNP	1
amico	amico	NNP	7
amicon	amicon	NNP	12
amics	amic	NNP	1
amicus	amicus	JJ	4
amicus	amicus	NNP	1
amid	amid	IN	331
amid	amid	NNP	19
amid	amid	UNC	2
amida	amida	NNP	7
amidala	amidalum	NNP	7
amidase	amidase	NN	7
amidated	amidated	JJ	1
amide	amide	NN	12
amide	amide	NNP	1
amides	amide	NNS	1
amido	amido	NN	1
amido	amido	NNP	1
amidolytic	amidolytic	JJ	2
amidophosphoribosyi	amidophosphoribosyus	NN	1
amidships	amidship	NNS	1
amidst	amidst	NN	26
amidst	amidst	NNP	6
amiee	amiee	NNP	1
amiel	amiel	NNP	4
amiens	amien	NNP	11
amiens	amiens	UNC	1
amieva	amieva	NNP	1
amiga	amiga	NNP	67
amigas	amiga	NNP	1
amigo	amigo	NNP	10
amigos	amigo	NNP	2
amigos	amigo	NNS	1
amiguito	amiguito	NN	1
amiiformes	amiiform	NNP	1
amikacin	amikacin	NN	3
amiller	amiller	NN	1
amiloride	amiloride	NN	3
amiloride-sensitive	amiloride-sensitive	JJ	1
amin	amin	NNP	18
amina	amina	NNP	121
aminafwd	aminafwd	NNP	1
aminal	aminal	NN	1
aminated	aminated	JJ	8
amination	amination	NN	1
amine	amine	NN	5
amine-coupling	amine-coupling	JJ	1
amine-modified	amine-modified	NNP	1
amines	amine	NNS	7
aming	ame	VBG	1
amino	amino	JJ	1409
amino	amino	NNP	26
amino	amino	NN	20
amino-acid	amino-acid	JJ	267
amino-acid	amino-acid	NNP	8
amino-acid-encoding	amino-acid-encoding	JJ	1
amino-acid-long	amino-acid-long	JJ	1
amino-acids	amino-acid	JJ	2
amino-adamantane	amino-adamantane	JJ	1
amino-allyl	amino-allyl	JJ	2
amino-allyl	amino-allyl	NNP	1
amino-allyl-based	amino-allyl-based	JJ	1
amino-allyl-d	amino-allyl-d	JJ	1
amino-and	amino-and	JJ	1
amino-cyclopropane	amino-cyclopropane	JJ	1
amino-cyclopropane-carboxylate	amino-cyclopropane-carboxylate	JJ	1
amino-group	amino-group	JJ	2
amino-labeled	amino-labeled	JJ	1
amino-modified	amino-modified	JJ	2
amino-oxidase	amino-oxidase	JJ	1
amino-oxidase-type	amino-oxidase-type	JJ	2
amino-propargyl	amino-propargyl	NNP	1
amino-terminal	amino-terminal	JJ	113
amino-terminal	amino-terminal	NNP	4
amino-terminus	amino-terminus	JJ	11
amino-transferase	amino-transferase	JJ	2
amino-transferases	amino-transferase	JJ	1
aminoacid	aminoacid	NN	3
aminoacids	aminoacid	NNS	2
aminoacyl	aminoacyl	NN	2
aminoacyl-adenylate	aminoacyl-adenylate	JJ	2
aminoacyl-t	aminoacyl-t	JJ	10
aminoacyl-t	aminoacyl-t	NNP	2
aminoacyle	aminoacyle	NN	2
aminoadenine	aminoadenine	NN	1
aminoadenosine	aminoadenosine	NN	3
aminoallyl	aminoallyl	NN	4
aminoallyl-d	aminoallyl-d	JJ	7
aminoallyl-modified	aminoallyl-modified	JJ	1
aminoarabinose	aminoarabinose	NN	3
aminobenzoic	aminobenzoic	JJ	3
aminocyclopropane	aminocyclopropane	NN	2
aminoethyl	aminoethyl	NN	1
aminoethyl	aminoethyl	NNP	1
aminoglutethimide	aminoglutethimide	NN	2
aminoglycoside	aminoglycoside	NN	2
aminoglycosides	aminoglycoside	NNS	1
aminogylcosides	aminogylcoside	NNS	1
aminolink	aminolink	NNP	1
aminomethane	aminomethane	NN	2
aminomethyl	aminomethyl	NN	1
aminomethylcoumarin	aminomethylcoumarin	NN	1
aminopenicillins	aminopenicillin	NNS	1
aminopeptidase	aminopeptidase	NN	7
aminophenoxy	aminophenoxy	NN	1
aminopropyltriethoxysilane-coated	aminopropyltriethoxysilane-coated	JJ	1
aminopyridine	aminopyridine	NN	4
aminosalicylic	aminosalicylic	JJ	3
aminosilane	aminosilane	NN	2
aminoterminal	aminoterminal	NN	3
aminoterminus	aminoterminus	JJ	5
aminotetraacetic	aminotetraacetic	JJ	1
aminotranferase	aminotranferase	NN	2
aminotransferase	aminotransferase	NN	35
aminotransferase	aminotransferase	NNP	1
aminotransferases	aminotransferase	NNS	14
aminov	aminov	NNP	8
amintore	amintore	NNP	1
amio	amio	NN	1
amiodarone	amiodarone	NN	2
amipens	amipen	NNP	1
amipro	amipro	NNP	3
amir	amir	NNP	12
amir	amir	UNC	1
amiral	amiral	NNP	1
amirs	amir	NNP	1
amis	ami	NNP	59
amis	ami	NNS	1
amish	amish	NNP	46
amison	amison	NNP	1
amiss	amiss	JJ	20
amistad	amistad	NNP	37
amit	amit	NNP	2
amitai	amitaus	NNP	1
amitav	amitav	NNP	1
amitavo	amitavo	NNP	1
amitochondrial	amitochondrial	NN	1
amitochondriate	amitochondriate	NN	6
amitotically	amitotically	RB	1
amitriptyline	amitriptyline	NN	2
amittit	amittit	NN	1
amity	amity	NN	7
amity	amity	NNP	5
amityville	amityville	NNP	8
amizade	amizade	NNP	1
amjad	amjad	NNP	1
aml	aml	NNP	43
amla	amlum	NN	1
amlapura	amlapura	NNP	4
amlaw	amlaw	NNP	6
amlodipine	amlodipine	NN	1
amma	amma	NN	1
amman	amman	NNP	25
ammanati	ammanatus	NNP	1
ammar	ammar	NNP	1
ammeen	ammeen	NNP	6
ammend	ammend	NN	2
ammer	ammer	NNP	2
ammi	ammus	NNP	1
ammiano	ammiano	NNP	6
ammiel	ammiel	NNP	1
ammo	ammo	NN	18
ammo	ammo	NNP	5
ammo-acid	ammo-acid	JJ	2
ammon	ammon	NNP	4
ammonia	ammonia	NN	76
ammonia	ammonia	NNP	9
ammonite	ammonite	NN	1
ammonium	ammonium	NN	60
ammons	ammon	NNP	1
ammunition	ammunition	NN	81
ammunitions	ammunition	NNS	1
amn	amn	NNP	1
amnesia	amnesia	NN	39
amnesia	amnesia	NNP	3
amnesiac	amnesiac	NN	5
amnesic	amnesic	JJ	3
amnestic	amnestic	JJ	1
amnestics	amnestic	NNS	1
amnesty	amnesty	NNP	31
amnesty	amnesty	NN	26
amnio	amnio	NN	3
amnio	amnio	NNP	1
amniocentesis	amniocentesis	NNS	1
amniocentesis	amniocentesis	NNP	1
amnion	amnion	NN	3
amnion	amnion	NNP	2
amnioserosa	amnioserosa	NN	2
amniota	amniota	NNP	2
amniote	amniote	NN	1
amniotic	amniotic	JJ	26
amnon	amnon	NNP	2
amo	amo	NNP	2
amoco	amoco	NNP	8
amodiaquine	amodiaquine	NN	11
amodiaquine	amodiaquine	NNP	5
amodt	amodt	NNP	2
amoeba	amoeba	NNP	17
amoeba	amoeba	NN	6
amoebae	amoeba	NN	2
amoebas	amoeba	NNS	1
amoebic	amoebic	NNP	1
amoeboid	amoeboid	NN	2
amoh	amoh	NNP	10
amok	amok	RB	32
amok	amok	NNP	2
amon	amon	NNP	7
among	among	IN	7232
among	among	UNC	21
among-population	among-population	JJ	1
among-site	among-site	JJ	1
among-strain	among-strain	JJ	1
amongpatients	amongpatient	NNS	1
amongst	amongst	IN	135
amongst	amongst	NNP	4
amongthe	amongthe	NN	1
amongttic	amongttic	NN	1
amonia	amonium	NN	1
amonte	amonte	NNP	34
amontillado	amontillado	NNP	2
amontillados	amontillado	NNS	2
amonts	amont	NNS	1
amor	amor	NN	4
amor	amor	FW	4
amoral	amoral	NN	22
amoral	amoral	UNC	1
amorality	amorality	NN	3
amorbid	amorbid	NNP	1
amore	amore	NNP	7
amore	amore	NN	3
amoreeffective	amoreeffective	JJ	1
amoreira	amoreira	NNP	1
amoreiras	amoreira	NNP	1
amores	amore	NNP	1
amori	amorus	NN	1
amorim	amorim	NNP	123
amorites	amorite	NNP	2
amormino	amormino	NNP	1
amoros	amoro	NNP	22
amoroso	amoroso	NN	1
amorosos	amoroso	NNS	1
amorous	amorous	JJ	16
amorousness	amorousness	NNS	1
amorphous	amorphous	JJ	20
amorthropized	amorthropized	JJ	1
amortization	amortization	NN	14
amortization	amortization	NNP	2
amortize	amortize	VB	4
amortized	amortized	JJ	8
amortizing	amortize	VBG	1
amortizing	amortizing	NNP	1
amory	amory	NNP	2
amos	amo	NNP	34
amoudia	amoudium	NNP	1
amoun	amoun	NNP	1
amoung	amoung	NN	5
amount	amount	NN	3064
amount	amount	VB	40
amount	amount	VBP	24
amount	amount	NNP	8
amount	amount	UNC	3
amounted	amount	VBD	66
amounted	amount	VBN	5
amounting	amount	VBG	17
amounting	amounting	UNC	1
amountof	amountof	NN	5
amounts	amount	NNS	936
amounts	amount	VBZ	30
amounts	amount	NNP	17
amounts	amounts	UNC	5
amour	amour	NNP	11
amour	amour	NN	6
amoureux	amoureux	NNP	2
amours	amour	FW	1
amours	amour	NNP	1
amouse	amouse	NNP	1
amout	amout	NN	1
amoxicillin	amoxicillin	NN	7
amoy	amoy	NNP	3
amp	amp	NNP	52
amp	amp	NN	20
amp-binding	amp-binding	NNP	1
amp-lysine	amp-lysine	NNP	1
amp-nh	amp-nh	NNP	1
amp-response	amp-response	NNP	1
amp-stimulated	amp-stimulated	NNP	1
ampa	ampa	NNP	26
ampa-gated	ampa-gated	NNP	1
ampa-receptor	ampa-receptor	NNP	1
ampa-receptors	ampa-receptor	NNP	1
ampang	ampang	NNP	3
ampata	ampa	NNP	3
ampcp	ampcp	NNP	11
amped	amped	JJ	5
amped	amped	NNP	1
amped-up	amped-up	JJ	2
ampenan	ampenan	NNP	5
amperage	amperage	NN	5
amperages	amperage	NNS	1
amperase	amperase	NNP	4
ampere	ampere	NN	1
amperometric	amperometric	JJ	2
amperometric	amperometric	NNP	1
ampersand	ampersand	NN	6
ampezzo	ampezzo	NNP	3
amphetamine	amphetamine	NN	5
amphetamine-addled	amphetamine-addled	JJ	1
amphetamine-crazed	amphetamine-crazed	JJ	1
amphetamine-jag	amphetamine-jag	JJ	1
amphetamine-like	amphetamine-like	JJ	1
amphetamine-soaked	amphetamine-soaked	JJ	3
amphetamines	amphetamine	NNS	16
amphetamines	amphetamine	NNP	1
amphetamines	amphetamines	UNC	1
amphibia	amphibium	NN	1
amphibian	amphibian	NN	10
amphibians	amphibian	NNS	14
amphibious	amphibious	JJ	6
amphicoma	amphicoma	NNP	1
amphigory	amphigory	NN	1
amphioxus	amphioxus	JJ	1
amphipathic	amphipathic	JJ	9
amphiphilic	amphiphilic	JJ	3
amphiphilicity	amphiphilicity	NN	1
amphiregulin	amphiregulin	NN	2
amphisa	amphisa	NNP	1
amphitheater	amphitheater	NN	28
amphitheater	amphitheater	NNP	3
amphitheater-shaped	amphitheater-shaped	JJ	1
amphitheaters	amphitheater	NNS	1
amphitheaters	amphitheater	NNP	1
amphitheatre	amphitheatre	NN	7
amphitheatre	amphitheatre	NNP	3
amphitheatre-type	amphitheatre-type	JJ	1
amphitheatres	amphitheatr	NNS	1
amphitrite	amphitrite	NNP	2
amphi­theater	amphi­theater	NN	2
amphi­theaters	amphi­theaters	NNS	1
ampholines	ampholine	NNS	2
ampholytes	ampholyte	NNS	1
amphony	amphony	NNP	2
amphora	amphora	NN	1
amphoras	amphora	NNS	2
amphotericin	amphotericin	NN	13
amphotericin	amphotericin	NNP	1
amphotropic	amphotropic	JJ	8
amphotropic	amphotropic	NNP	1
ampici	ampici	NN	1
ampicill	ampicill	NN	2
ampicillin	ampicillin	NN	45
ampicillin	ampicillin	NNP	5
ampicillin-resistant	ampicillin-resistant	JJ	1
ampification	ampification	NN	1
amping	amp	VBG	1
ampirevay	ampirevay	NN	1
ampitheater	ampitheater	NN	1
ampitheatre	ampitheatre	NNP	1
ampk	ampk	NNP	1
ample	ample	JJ	118
ample	ample	NNP	3
ampleness	ampleness	NNS	1
amplex	amplex	NNP	2
ampli	ampli	NNP	1
ampli	amplus	NNP	1
amplicon	amplicon	NN	58
amplicon-derived	amplicon-derived	JJ	1
amplicons	amplicon	NNS	44
amplicor	amplicor	NNP	1
amplifed	amplifed	JJ	1
amplifiable	amplifiable	JJ	1
amplification	amplification	NN	684
amplification	amplification	NNP	49
amplification-based	amplification-based	JJ	1
amplifications	amplification	NNS	49
amplifications	amplification	NNP	6
amplificaton	amplificaton	NN	1
amplified	amplified	NNP	16
amplified	amplify	VBN	536
amplifier	amplifier	NN	26
amplifiers	amplifier	NNS	4
amplifies	amplify	NNS	17
ampliflour	ampliflour	NNP	1
amplifluor	amplifluor	NNP	13
amplifluors	amplifluor	NNP	3
amplify	amplify	VB	125
amplify	amplify	NNP	1
amplifying	amplify	VBG	30
ampligase	ampligase	NNP	12
ampligase	ampligase	NN	4
amplimer	amplimer	NN	1
amplimers	amplimer	NNS	4
ampliscribe	ampliscribe	NNP	5
amplitaq	amplitaq	NNP	23
amplitaq	amplitaq	NN	2
amplitron	amplitron	NNP	1
amplitude	amplitude	NN	163
amplitudes	amplitude	NNS	54
amply	amply	RB	34
ampod	ampod	NN	1
ampollas	ampolla	NNP	1
ampoule	ampoule	NN	1
amppnp	amppnp	NNP	4
amprenavir	amprenavir	NNP	1
amps	amp	NNS	5
amps	amp	NNP	1
ampul	ampul	NN	2
ampules	ampule	NNS	1
ampus	ampus	UNC	1
amputate	amputate	NN	2
amputated	amputated	JJ	27
amputates	amputate	NNS	1
amputating	amputate	VBG	2
amputation	amputation	NN	26
amputation	amputation	NNP	1
amputations	amputation	NNS	10
amputee	amputee	NN	3
amputees	amputee	NNS	5
amr	amr	NNP	11
amr-earnings	amr-earning	NNP	2
amra	amra	NNP	1
amrad	amrad	NNP	1
amrak	amrak	NNP	1
amrant	amrant	NN	4
amref	amref	NNP	1
amrein	amrein	NNP	3
amresco	amresco	NNP	1
amri	amrus	NNP	1
amrich	amrich	NNP	3
amritraj	amritraj	NNP	3
amritrajes	amritraje	NNP	2
amritsar	amritsar	NNP	6
amro	amro	NNP	3
amrs	amr	NNP	8
ams	am	NNP	56
amsa	amsa	NNP	2
amsa	amsa	NN	1
amsacta	amsacta	NNP	2
amsel	amsel	NNP	1
amsequestered	amsequestered	NNP	1
amsol	amsol	NNP	2
amstel	amstel	NNP	13
amstelredamme	amstelredamme	NNP	7
amsterdam	amsterdam	NNP	213
amsterdam	amsterdam	NN	2
amsterdam-based	amsterdam-based	NNP	2
amsterdam-born	amsterdam-born	NNP	1
amsterdammers	amsterdammer	NNP	23
amsterdamse	amsterdamse	NNP	2
amstrelkring	amstrelkring	NNP	1
amsuvarna	amsuvarna	NNP	1
amt	amt	NNP	2
amtave	amtave	NNP	1
amtave	amtave	NN	1
amthology	amthology	NN	1
amtion	amtion	NNP	2
amtrack	amtrack	NNP	1
amtrak	amtrak	NNP	121
amtrak	amtrak	UNC	1
amtrak-derail	amtrak-derail	NNP	5
amuck	amuck	NN	1
amud	amud	NNP	1
amuk	amuk	NNP	1
amulet	amulet	NN	13
amulets	amulet	NNS	3
amulets	amulet	NNP	2
amun	amun	NNP	9
amundadottir	amundadottir	NNP	1
amundsen	amundsen	NNP	3
amunophis	amunophi	NNP	1
amurricans	amurrican	NNP	1
amuse	amuse	VBP	49
amuse-bouches	amuse-bouch	JJ	1
amused	amuse	VBN	45
amused	amused	JJ	99
amused	amused	NNP	4
amused	amused	UNC	1
amusedsydney	amusedsydney	NNP	1
amusement	amusement	NN	119
amusement	amusement	NNP	7
amusement-park	amusement-park	JJ	4
amusements	amusement	NNS	12
amusements	amusement	NNP	1
amuses	amus	NNS	17
amusez-vous	amusez-vous	NNP	1
amusing	amusing	JJ	296
amusing	amusing	UNC	2
amusing	amusing	NNP	1
amusingly	amusingly	RB	23
amusingly	amusingly	NNP	5
amusingness	amusingness	NNS	1
amusment	amusment	NN	1
amutant	amutant	NNP	1
amv	amv	NNP	18
amv-reverse	amv-reverse	NNP	1
amv-rt	amv-rt	NNP	1
amw	amw	NNP	1
amway	amway	NNP	15
amway-style	amway-style	NNP	1
amwest	amwest	NNP	1
amy	amy	NNP	332
amy	amy	NN	23
amy-the-evil-boxing-coach	amy-the-evil-boxing-coach	NNP	1
amych	amych	NN	112
amych	amych	NNP	65
amych	amych	UNC	2
amych-style	amych-style	JJ	5
amych-ubercrunch	amych-ubercrunch	JJ	1
amycolatopsis	amycolatopsis	NNP	1
amyest	amyest	NN	1
amyeth	amyeth	NN	1
amygdala	amygdalum	NN	30
amygdala-decreased	amygdala-decreased	JJ	1
amygdala-specific	amygdala-specific	JJ	2
amyl	amyl	NN	1
amyland	amyland	NNP	1
amylase	amylase	NN	1
amylases	amylase	NNS	1
amyliz	amyliz	NNP	1
amyloid	amyloid	NN	14
amyloid	amyloid	NNP	1
amyloid-?	amyloid-?	JJ	1
amyloid-beta	amyloid-beta	JJ	1
amyloid-ß	amyloid-ß	JJ	1
amyloidogenic	amyloidogenic	JJ	1
amyloidogenic	amyloidogenic	NNP	1
amyloidosis	amyloidosis	NNS	5
amyloiodgenic	amyloiodgenic	JJ	1
amyloliqufaciens	amyloliqufacien	NNS	1
amylose-free	amylose-free	JJ	4
amylovora	amylovora	NN	2
amyotrophic	amyotrophic	JJ	3
amyotrophic	amyotrophic	NNP	1
amyp	amyp	NNP	10
amyp	amyp	NN	5
amyparker	amyparker	NNP	9
amyparker	amyparker	NN	7
amyparker-wards	amyparker-ward	JJ	1
amyre	amyre	NN	1
amys	amy	NNS	1
amys	amy	NNP	1
amyt	amyt	NN	1
amyth	amyth	NN	21
amyth	amyth	NNP	8
amyth	amyth	UNC	1
amythests	amythest	NNS	1
amytus	amytus	JJ	1
amyvi	amyvus	NN	1
am­ong	am­ong	NN	1
amália	amália	NNP	1
amári	amári	NNP	4
amélia	amélia	NNP	4
amélie	amélie	NNP	1
américa	américa	NNP	2
américas	américas	NNP	14
américo	américo	NNP	11
amérique	amérique	NNP	1
amœba	amœba	NN	1
am–	am–	NN	127
am–midnight	am–midnight	NN	2
am–noon	am–noon	NN	1
am–sunset	am–sunset	NN	1
an	an	DT	73833
an	an	UNC	199
an	an	NN	42
an	an	NNP	12
an-end-of-myth	an-end-of-myth	JJ	1
an-gel-us	an-gel-us	NNP	4
an-hour	an-hour	JJ	7
an-hour-plus	an-hour-plus	JJ	1
an-nhar	an-nhar	JJ	2
an-nhar	an-nhar	NNP	1
an-swer	an-swer	JJ	2
ana	ana	NNP	53
ana	ana	NN	3
ana	ana	UNC	1
ana-n	ana-n	NNP	1
anabaena	anabaena	NNP	63
anabaptists	anabaptist	NNP	1
anable	anable	JJ	1
anabolic	anabolic	JJ	20
anabolis	anaboli	NNP	1
anabranch	anabranch	NN	2
anacapa	anacapa	NNP	1
anacapri	anacaprus	NNP	2
anachro	anachro	NN	1
anachronism	anachronism	NN	22
anachronism	anachronism	NNP	1
anachronisms	anachronism	NNS	9
anachronisms	anachronism	NNP	1
anachronistic	anachronistic	JJ	29
anachronistic	anachronistic	NNP	1
anachronistically	anachronistically	RB	5
anacin	anacin	NNP	1
anacoluthic	anacoluthic	JJ	1
anaconda	anaconda	NNP	9
anacor	anacor	NNP	1
anacostia	anacostium	NNP	5
anacreon	anacreon	NNP	1
anad	anad	NN	2
anadama	anadama	NN	1
anadia	anadium	NNP	2
anadolu	anadolu	NNP	3
anadromous	anadromous	JJ	1
anaemia	anaemia	NN	5
anaemia	anaemia	NNP	1
anaerobes	anaerobe	NNS	2
anaerobic	anaerobic	JJ	48
anaerobically	anaerobically	RB	7
anaerobiosis	anaerobiosis	NNS	1
anaesthesia	anaesthesia	NN	15
anaesthesiological	anaesthesiological	JJ	2
anaesthesiologist	anaesthesiologist	NN	1
anaesthesiologists	anaesthesiologist	NNP	1
anaesthetic	anaesthetic	JJ	8
anaesthetic	anaesthetic	UNC	1
anaesthetised	anaesthetised	JJ	4
anaesthetises	anaesthetise	NNS	1
anaesthetist	anaesthetist	NN	1
anaesthetists	anaesthetist	NNS	1
anaesthetized	anaesthetized	JJ	8
anaffected	anaffected	JJ	2
anafi	anafus	NNP	1
anafiotika	anafiotika	NNP	3
anaglyph	anaglyph	NN	3
anaglyph-encoded	anaglyph-encoded	JJ	2
anagoddess	anagoddess	NNS	2
anagram	anagram	NN	13
anagram	anagram	NNP	12
anagramgenius	anagramgenius	JJ	1
anagrammatical	anagrammatical	JJ	1
anagrams	anagram	NNS	14
anagrams	anagram	NNP	1
anahad	anahad	NNP	1
anaheim	anaheim	NNP	118
anais	anai	NNP	3
anaka	anaka	NNP	1
anake	anake	NN	1
anakin	anakin	NNP	21
anakinra	anakinra	NN	2
anal	anal	NN	38
anal	anal	NNP	3
anal-retentive	anal-retentive	JJ	6
anal-retentiveness	anal-retentiveness	JJ	3
analagous	analagous	JJ	2
analaysis	analaysis	NNS	1
analco	analco	NNP	2
analects	analect	NNP	1
analgesia	analgesia	NN	28
analgesia	analgesia	NNP	1
analgesic	analgesic	JJ	58
analgesic	analgesic	NNP	2
analgesics	analgesic	NNS	50
analgesics	analgesic	NNP	3
analisa	analisa	NNP	1
anality	anality	NN	1
analize	analize	NN	1
anally	anally	RB	1
analog	analog	NN	179
analog	analog	NNP	13
analog	analog	UNC	1
analogical	analogical	JJ	1
analogies	analogy	NNS	44
analogies	analogy	NNP	9
analogists	analogist	NNP	2
analogizes	analogize	NNS	1
analogous	analogous	JJ	178
analogous	analogous	NNP	7
analogously	analogously	RB	6
analogously	analogously	NNP	3
analogs	analog	NNS	86
analogs	analog	NNP	2
analogue	analogue	NN	45
analogues	analogue	NNS	14
analogues	analogue	NNP	4
analogx	analogx	NN	2
analogx	analogx	NNP	1
analogy	analogy	NN	234
analogy	analogy	NNP	8
analogy	analogy	UNC	1
analsysis	analsysis	NNS	1
analysand	analysand	NN	2
analysand	analysand	NNP	1
analyse	analyse	NN	16
analyse	analyse	NNP	2
analyse-it	analyse-it	NNP	1
analysed	analysed	JJ	72
analyser	analyser	NN	7
analyses	analyses	UNC	1
analyses	analysis	NNS	1588
analyses-client	analyses-client	JJ	1
analysing	analyse	VBG	7
analysis	analysis	NN	7558
analysis	analysis	NNP	889
analysis	analysis	UNC	11
analysis-derived	analysis-derived	JJ	1
analysis-heavy	analysis-heavy	JJ	1
analysis-relevant	analysis-relevant	JJ	1
analysis-that	analysis-that	JJ	1
analysis-to	analysis-to	JJ	1
analysisdemonstrated	analysisdemonstrated	JJ	1
analysisprovides	analysisprovide	NNS	1
analysisstudiesa	analysisstudiesa	NN	1
analyst	analyst	NN	509
analyst	analyst	NNP	10
analyst	analyst	UNC	1
analyst-related	analyst-related	JJ	1
analysts	analyst	NNS	939
analysts	analyst	NNP	7
analyte	analyte	NN	16
analytes	analyte	NNS	17
analytic	analytic	JJ	194
analytic	analytic	NNP	3
analytica	analytica	NNP	4
analytical	analytical	JJ	191
analytical	analytical	NNP	33
analytically	analytically	RB	13
analytically	analytically	NNP	2
analytics	analytic	NNP	2
analyzable	analyzable	JJ	5
analyze	analyze	VB	371
analyze	analyze	VBP	34
analyze	analyze	NNP	26
analyzed	analyze	VBN	874
analyzed	analyze	VBD	575
analyzed	analyzed	NNP	6
analyzer	analyzer	NN	27
analyzer	analyzer	NNP	18
analyzers	analyzer	NNS	3
analyzes	analyze	NNS	56
analyzes	analyze	NNP	1
analyzes	analyzes	UNC	1
analyzing	analyze	VBG	243
analyzing	analyzing	NNP	20
analyzing	analyzing	UNC	1
analyzing	analyzing	NN	1
anamnesis	anamnesis	NNS	1
anamniote	anamniote	NN	1
anamorphic	anamorphic	JJ	1
anamount	anamount	NN	1
anan	anan	NN	3
ananas	anana	NNS	1
ananas	anana	NNP	1
ananase	ananase	NN	2
anand	anand	NNP	6
ananda	ananda	NNP	18
anandalakshmi	anandalakshmus	NNP	1
anania	ananium	NNP	1
ananias	anania	NNP	2
ananim	ananim	NN	3
ananimous	ananimous	JJ	1
ananka	ananka	NNP	1
ananna	ananna	NN	1
ananova	ananova	NN	1
ananse	ananse	NN	1
ananson	ananson	NNP	1
ananta	ananta	NNP	1
anao	anao	NNP	2
anao	anao	NN	1
anapana	anapana	NN	2
anapanna	anapanna	NN	1
anaparticular	anaparticular	NN	1
anaphase	anaphase	NN	70
anaphase	anaphase	NNP	1
anaphase-inhibitor	anaphase-inhibitor	JJ	1
anaphase-promoting	anaphase-promoting	JJ	3
anaphora	anaphora	NN	1
anaphylactic	anaphylactic	JJ	35
anaphylactic	anaphylactic	NNP	1
anaphylactoid	anaphylactoid	NN	3
anaphylatoxin	anaphylatoxin	NN	3
anaphylaxis	anaphylaxi	NNS	32
anaphylaxis	anaphylaxi	NNP	1
anaplastic	anaplastic	JJ	1
anaplastologist	anaplastologist	NN	1
anaplerotic	anaplerotic	JJ	15
anapplication	anapplication	NN	2
anaptychia	anaptychium	NNP	1
anarachy	anarachy	NNP	1
anarchic	anarchic	JJ	15
anarchic	anarchic	NNP	2
anarchic	anarchic	UNC	1
anarchically	anarchically	RB	1
anarchism	anarchism	NN	4
anarchism	anarchism	NNP	1
anarchist	anarchist	NN	22
anarchist	anarchist	NNP	3
anarchista	anarchista	NN	1
anarchistic	anarchistic	JJ	2
anarchists	anarchist	NNS	19
anarchists	anarchists	UNC	1
anarcho	anarcho	NN	1
anarchy	anarchy	NN	43
anarchy	anarchy	NNP	5
anas	ana	NNP	1
anasazi	anasazus	NNP	5
anaspec	anaspec	NNP	1
anastacio	anastacio	NNP	1
anastamosis	anastamosis	NNS	2
anastasia	anastasium	NNP	10
anastasio	anastasio	NNP	1
anastasios	anastasio	NNP	1
anastasis	anastasis	NNP	1
anastellin	anastellin	NN	1
anastomising	anastomise	VBG	1
anat	anat	NN	1
anathema	anathema	NN	31
anathema	anathema	NNP	18
anathemas	anathema	NNS	1
anathematize	anathematize	NN	1
anathematized	anathematized	JJ	2
anathematizing	anathematize	VBG	1
anatinas	anatina	NNS	3
anatinus	anatinus	JJ	1
anatole	anatole	NNP	3
anatolia	anatolium	NNP	26
anatolian	anatolian	NNP	4
anatoly	anatoly	NNP	10
anatomic	anatomic	JJ	19
anatomic-therapeutic-chemical	anatomic-therapeutic-chemical	JJ	1
anatomica	anatomica	NNP	1
anatomical	anatomical	JJ	63
anatomical	anatomical	NNP	3
anatomically	anatomically	RB	19
anatomically	anatomically	NNP	2
anatomically-based	anatomically-based	JJ	1
anatomies	anatomy	NNS	1
anatomist	anatomist	NN	1
anatomists	anatomist	NNP	1
anatomized	anatomized	JJ	1
anatomizes	anatomize	NNS	1
anatomy	anatomy	NN	82
anatomy	anatomy	NNP	14
anatomy	anatomy	UNC	1
anatomy-based	anatomy-based	JJ	1
anatrace	anatrace	NNP	1
anatrepsis	anatrepsis	NNS	4
anatural	anatural	NN	1
anavatos	anavato	NNP	2
anavim	anavim	NNP	1
anaxagoras	anaxagora	NNS	1
anaxagoras	anaxagora	NNP	1
anay	anay	NNP	1
anaya	anaya	NNP	8
anaylses	anaylse	NNS	1
anaïs	anaïs	NNP	2
anba	anba	NNP	3
anc	anc	NNP	54
anc	anc	NN	1
anc-led	anc-led	NNP	1
anca	anca	NNP	1
ance	ance	NN	1
ancel	ancel	NNP	5
ancell	ancell	NNP	1
ancestor	ancestor	NN	189
ancestor	ancestor	NNP	4
ancestor-worshipping	ancestor-worshipping	JJ	1
ancestors	ancestor	NNS	161
ancestors	ancestor	NNP	3
ancestory	ancestory	NNP	1
ancestral	ancestral	JJ	170
ancestral	ancestral	NNP	4
ancestrally	ancestrally	RB	1
ancestress	ancestress	NNS	1
ancestries	ancestry	NNS	2
ancestry	ancestry	NN	80
ancestry	ancestry	UNC	1
ancestry	ancestry	NNP	1
ancho	ancho	NN	3
ancho-chile	ancho-chile	JJ	1
anchoasanchoviesmariscosshellfish	anchoasanchoviesmariscosshellfish	NN	1
anchor	anchor	NN	100
anchor	anchor	VB	52
anchor	anchor	NNP	16
anchor	anchor	VBP	10
anchor-blondes	anchor-blond	JJ	1
anchorage	anchorage	NNP	26
anchorage	anchorage	NN	16
anchorage-dependent	anchorage-dependent	JJ	12
anchorage-independent	anchorage-independent	JJ	10
anchorage-independently	anchorage-independently	JJ	1
anchorages	anchorage	NNS	5
anchored	anchor	VBN	94
anchored	anchored	NNP	3
anchoring	anchor	VBG	41
anchoring	anchoring	NNP	2
anchorman	anchorman	NN	8
anchormen	anchorman	NN	2
anchormen	anchorman	NNP	1
anchors	anchor	NNS	41
anchors	anchor	NNP	2
anchorwoman	anchorwoman	NN	1
anchorwomen	anchorwoman	NN	1
anchoveta	anchoveta	NN	3
anchovies	anchovy	NNS	9
anchovies	anchovy	NNP	3
anchoviesmerluzahake	anchoviesmerluzahake	NN	1
anchoviespez	anchoviespez	NN	1
anchovy	anchovy	NN	2
anchovy	anchovy	NNP	1
ancien	ancien	NN	8
ancien	ancien	NNP	6
ancienne	ancienne	NNP	1
ancient	ancient	JJ	1132
ancient	ancient	NNP	98
ancient-looking	ancient-looking	JJ	1
ancient-sounding	ancient-sounding	JJ	1
ancient-world	ancient-world	JJ	1
ancientness	ancientness	NNS	1
ancients	ancients	NNS	15
ancillae	ancilla	NN	1
ancillary	ancillary	JJ	36
ancillary	ancillary	NNP	1
ancillus	ancillus	JJ	1
ancle	ancle	NN	1
ancona	ancona	NNP	1
ancora	ancora	NN	1
ancova	ancova	NNP	10
ancre	ancre	NN	1
ancylostoma	ancylostoma	NNP	2
ancylostoma	ancylostoma	NN	1
ancón	ancón	NNP	4
and	and	CC	595372
and	and	UNC	2306
and	and	NN	224
and	and	JJ	28
and	and	NNP	11
and-a	and-a	JJ	1
and-a-half	and-a-half	JJ	2
and-a-half-foot-long	and-a-half-foot-long	JJ	1
and-a-half-minute	and-a-half-minute	JJ	1
and-a-half-month-old	and-a-half-month-old	JJ	1
and-and	and-and	NNP	1
and-depending	and-depending	JJ	1
and-disagrees-with	and-disagrees-with	JJ	1
and-don	and-don	JJ	1
and-filer	and-filer	JJ	1
and-in	and-in	JJ	2
and-more	and-more	JJ	1
and-more-warts	and-more-wart	JJ	1
and-museum	and-museum	JJ	1
and-odd	and-odd	JJ	1
and-older	and-older	JJ	1
and-over	and-over	JJ	1
and-perhaps	and-perhaps	JJ	1
and-relationships	and-relationship	JJ	1
and-this	and-thi	JJ	1
and-under	and-under	JJ	2
and-will-protect-us-so-everyone-keep-quiet	and-will-protect-us-so-everyone-keep-quiet	JJ	1
anda	anda	NNP	8
anda	anda	NN	1
andaccurately	andaccurately	RB	1
andale	andale	NN	2
andale	andale	NNP	1
andaleeb	andaleeb	NNP	1
andalex	andalex	NNP	1
andalou	andalou	NNP	2
andaluca	andaluca	NNP	1
andalucia	andalucium	NNP	3
andalucian	andalucian	NNP	2
andalucía	andalucía	NNP	22
andalucían	andalucían	NNP	6
andalus	andalus	NNP	2
andalusia	andalusium	NNP	6
andalusian	andalusian	NNP	9
andalusian-born	andalusian-born	NNP	1
andalusians	andalusian	NNP	1
andaluz	andaluz	NNP	2
andaluza	andaluza	NNP	1
andandrew	andandrew	NN	1
andante	andante	NNP	1
andanthropogenic	andanthropogenic	JJ	1
andantino	andantino	NNP	1
andantioxidant	andantioxidant	NN	1
andapplied	andapplied	JJ	1
andar	andar	NN	2
andatsdiditbettermystorystickingtoit	andatsdiditbettermystorystickingtoit	NNP	1
andaudit	andaudit	NN	1
andawarding	andaward	VBG	1
andawn	andawn	NNP	2
andbetter	andbetter	NNP	1
andbibliographicreferences	andbibliographicreference	NNS	1
andblood	andblood	NN	1
andbuying	andbuy	VBG	1
andby	andby	NN	1
andcertification	andcertification	NN	1
andclosure	andclosure	NN	1
andcompetitive	andcompetitive	JJ	1
andcompliance	andcompliance	NN	1
andcontrol	andcontrol	NN	1
andcoordination	andcoordination	NN	1
anddcm	anddcm	NN	1
anddetermine	anddetermine	NN	1
anddeveloping	anddevelop	VBG	1
ande	ande	NNP	2
andeach	andeach	NN	1
andean	andean	JJ	12
andele	andele	NNP	2
andelin	andelin	NNP	1
andenbuch	andenbuch	NNP	1
andenilso	andenilso	NNP	2
ander	ander	NN	5
ander	ander	NNP	1
anderman	anderman	NNP	3
anders	ander	NNP	12
andersen	andersen	NNP	142
anderson	anderson	NNP	488
andersonville	andersonville	NNP	1
andersson	andersson	NNP	7
andes	and	NNPS	10
andews	andews	NNP	1
andexplicitly	andexplicitly	RB	1
andfederal	andfederal	NN	1
andfour	andfour	NN	1
andhari	andharus	NNP	3
andhow	andhow	NN	1
andhra	andhra	NNP	5
andi	andus	NNP	5
andie	andie	NNP	8
andimax	andimax	NN	1
andimplementation	andimplementation	NN	1
andits	andit	NN	1
andmaking	andmake	VBG	1
andmaybeformyothersite	andmaybeformyothersite	NN	1
andmercury	andmercury	NN	1
andmodeling	andmodele	VBG	1
andnewsweek	andnewsweek	NN	1
andno	andno	NN	1
andnyha	andnyha	NN	1
ando	ando	NNP	1
andoccurrence	andoccurrence	NN	1
andopen	andopen	NN	1
andopportunity	andopportunity	NN	1
andor	andor	NNP	2
andorra	andorra	NNP	1
andother	andother	NN	1
andouille	andouille	NN	1
andover	andover	NNP	36
andperforms	andperform	NNS	1
andpsychologic	andpsychologic	JJ	1
andquotations	andquotation	NNS	1
andr	andr	NNP	2
andra	andra	NNP	2
andrade	andrade	NNP	3
andratx	andratx	NNP	4
andre	andre	NNP	101
andrea	andrea	NNP	75
andreas	andrea	NNP	31
andrecreation	andrecreation	NN	2
andreduce	andreduce	NN	1
andreduction	andreduction	NN	1
andree	andree	NNP	1
andreesen	andreesen	NNP	1
andreessen	andreessen	NNP	7
andrei	andreus	NNP	12
andreiko	andreiko	NNP	1
andrejs	andrej	NNP	1
andreotti	andreottus	NNP	4
andreports	andreport	NNS	1
andrequired	andrequired	JJ	1
andres	andr	NNP	18
andresino	andresino	NNP	1
andresolved	andresolved	JJ	1
andresources	andresource	NNS	1
andress	andress	NNP	3
andretti	andrettus	NNP	4
andreu	andreu	NNP	1
andrew	andrew	NNP	1207
andrew	andrew	NN	3
andrew-centric	andrew-centric	NNP	1
andrew-hesitant	andrew-hesitant	NNP	1
andrew-the-follower	andrew-the-follower	NNP	1
andrew-the-yes-man	andrew-the-yes-man	NNP	1
andrewartha	andrewartha	NNP	1
andrewcentric	andrewcentric	NNP	1
andrewgirl	andrewgirl	NN	1
andrewpiece	andrewpiece	NNP	1
andrews	andrew	NNP	82
andrews-in	andrews-in	NNP	1
andriacco	andriacco	NNP	2
andrian	andrian	NNP	1
andriesen	andriesen	NNP	5
andriessen	andriessen	NNP	1
andrieux	andrieux	NNP	1
andro	andro	NN	1
androcentrism	androcentrism	NNP	1
androcles	androcle	NNP	1
androgen	androgen	NN	169
androgen	androgen	NNP	9
androgen-dependent	androgen-dependent	JJ	2
androgen-depleted	androgen-depleted	JJ	2
androgen-deprived	androgen-deprived	JJ	4
androgen-driven	androgen-driven	JJ	1
androgen-free	androgen-free	JJ	1
androgen-independent	androgen-independent	JJ	5
androgen-induced	androgen-induced	JJ	7
androgen-induced	androgen-induced	NNP	1
androgen-like	androgen-like	JJ	1
androgen-mediated	androgen-mediated	JJ	12
androgen-regulated	androgen-regulated	JJ	2
androgen-related	androgen-related	JJ	1
androgen-replete	androgen-replete	JJ	1
androgen-responsive	androgen-responsive	JJ	14
androgen-sensitive	androgen-sensitive	JJ	1
androgen-treated	androgen-treated	JJ	4
androgenic	androgenic	JJ	3
androgens	androgen	NNS	37
androgens	androgen	NNP	1
androgyne	androgyne	NN	1
androgynous	androgynous	JJ	4
androgynously	androgynously	RB	3
androgyny	androgyny	NN	9
android	android	NN	8
android	android	NNP	1
androids	android	NNS	4
androids	android	NNP	2
andrology	andrology	NNP	1
andrology	andrology	NN	1
andromeda	andromeda	NNP	23
andronico	andronico	NNP	3
andronicus	andronicus	NNP	3
andronikos	androniko	NNP	1
andropov	andropov	NNP	1
andros	andro	NNP	34
androscoggin	androscoggin	NNP	1
androsia	androsium	NNP	2
androstane	androstane	NN	1
androstanol	androstanol	NN	15
androstenedione	androstenedione	NN	13
androstenol	androstenol	NN	1
androv	androv	NNP	2
andru	andru	NNP	1
andruw	andruw	NNP	6
andruzzi	andruzzus	NNP	3
andrzej	andrzej	NNP	2
andrás	andrás	NNP	3
andrássy	andrássy	NNP	9
andré	andré	NNP	25
andréas	andréas	NNP	1
andrés	andrés	NNP	7
ands	and	NNS	7
ands	and	NNP	2
andsection	andsection	NN	2
andsecurethe	andsecurethe	NN	1
andseveralimpressivestatuesoframses	andseveralimpressivestatuesoframse	NNS	1
andshe	andshe	NN	1
andsnes	andsn	NNP	10
andsomely	andsomely	RB	1
andstreetlife	andstreetlife	NN	1
andsubpart	andsubpart	NN	1
andsymptoms	andsymptom	NNS	1
andtaliban	andtaliban	NN	3
andtechniques	andtechnique	NNS	1
andtenet	andtenet	NN	3
andthat	andthat	NN	1
andthe	andthe	NN	5
andthemicrowavedrierisdead	andthemicrowavedrierisdead	NN	1
andthis	andthi	NNS	1
andtizegha	andtizegha	NN	1
andto	andto	NN	1
andttic	andttic	NN	1
anduille	anduille	NNP	1
andulacia	andulacium	NNP	1
andverification	andverification	NN	1
andy	andy	NNP	335
andy	andy	NN	2
andya	andya	NN	29
andycam	andycam	NNP	1
andydworkin	andydworkin	NN	1
andyf	andyf	NN	1
andym	andym	NN	2
andyou	andyou	NN	1
andys	andy	NNP	1
andºprovid	andºprovid	NN	1
andónis	andónis	NNP	1
andújar	andújar	NNP	1
ane	ane	NNP	1
ane	ane	NN	1
anealling	anealle	VBG	1
aneb	aneb	NNP	1
anecdotal	anecdotal	JJ	71
anecdotal	anecdotal	NNP	13
anecdotally	anecdotally	RB	10
anecdotally	anecdotally	NNP	3
anecdotally	anecdotally	UNC	1
anecdote	anecdote	NN	68
anecdote	anecdote	NNP	2
anecdote	anecdote	UNC	1
anecdote-examples	anecdote-example	JJ	1
anecdote-rich	anecdote-rich	JJ	1
anecdotes	anecdote	NNS	85
anecdotes	anecdote	NNP	6
anechoic	anechoic	JJ	1
anee	anee	NNP	1
anejo	anejo	NN	1
anelection	anelection	NN	1
anelectric	anelectric	JJ	2
anella	anellum	NNP	1
anemia	anemia	NN	74
anemia	anemia	NNP	5
anemia-drug	anemia-drug	NNP	1
anemia-related	anemia-related	JJ	1
anemic	anemic	JJ	27
anemission	anemission	NN	1
anemissions	anemission	NNS	1
anemone	anemone	NN	4
anemone	anemone	NNP	2
anemones	anemone	NNS	6
anemones	anemones	UNC	1
anemophily	anemophily	RB	2
anencephalics	anencephalic	NNS	2
anent	anent	NNP	3
anent	anent	NN	1
anergic	anergic	JJ	2
anergy	anergy	NN	4
anerica	anerica	NNP	1
anerican	anerican	NNP	1
aneruysm	aneruysm	NN	1
anesthesia	anesthesium	NN	99
anesthesia	anesthesium	NNP	8
anesthesiologist	anesthesiologist	NN	11
anesthesiologists	anesthesiologist	NNS	11
anesthesiologists	anesthesiologist	NNP	1
anesthesiology	anesthesiology	NN	2
anesthesiology	anesthesiology	NNP	1
anesthetic	anesthetic	JJ	30
anesthetics	anesthetic	NNS	14
anesthetist	anesthetist	NN	1
anesthetists	anesthetist	NNS	1
anesthetization	anesthetization	NN	3
anesthetized	anesthetized	JJ	75
anesthetizing	anesthetize	VBG	3
anestrous	anestrous	JJ	3
anestrus	anestrus	JJ	1
anethol	anethol	NN	1
anette	anette	NNP	1
aneuploid	aneuploid	NN	6
aneuploidies	aneuploidy	NNS	1
aneuploids	aneuploid	NNS	4
aneuploidy	aneuploidy	NN	15
aneuploidy	aneuploidy	NNP	1
aneurin	aneurin	NNP	2
aneurism	aneurism	NN	1
aneurisms	aneurism	NNS	1
aneurysm	aneurysm	NN	14
aneurysmal	aneurysmal	NN	3
aneurysms	aneurysm	NNS	5
aneusomic	aneusomic	NNP	1
aneusomic	aneusomic	JJ	1
anevaluation	anevaluation	NNP	3
anew	anew	RB	34
anew	anew	UNC	1
anew	anew	NNP	1
anews	anew	NNP	1
anexis	anexi	NNP	1
anexpenditure	anexpenditure	NN	1
anf	anf	NN	1
ang	ang	NNP	81
ang	ang	NN	8
ang-hsi	ang-hsi	JJ	1
anga	anga	NN	1
angau	angau	NNP	1
ange	ange	NNP	4
ange	ange	NN	1
angel	angel	NNP	5272
angel	angel	NN	119
angel	angel	UNC	6
angel-as-dork	angel-as-dork	NNP	1
angel-baby	angel-baby	JJ	1
angel-delayed	angel-delayed	NNP	1
angel-esque	angel-esque	NNP	1
angel-hair	angel-hair	JJ	1
angel-in-the-gutter-eating-rats	angel-in-the-gutter-eating-rat	NNP	2
angel-ish	angel-ish	NNP	1
angel-land	angel-land	NNP	2
angel-like	angel-like	NNP	1
angel-loving	angel-loving	NNP	1
angel-mopeage	angel-mopeage	NNP	1
angel-obsessed	angel-obsessed	NNP	1
angel-of-peace	angel-of-peace	JJ	1
angel-pain	angel-pain	NNP	2
angel-raisins	angel-raisin	NNP	1
angel-related	angel-related	NNP	5
angel-souls	angel-soul	NNP	1
angel-specific	angel-specific	NNP	1
angel-spoilage	angel-spoilage	NNP	1
angel-the	angel-the	NNP	1
angel-the-character	angel-the-character	NNP	1
angel-watching	angel-watching	NNP	1
angel-wig	angel-wig	NNP	1
angel-without-a-mission	angel-without-a-mission	NNP	1
angel-y	angel-y	NNP	1
angela	angela	NNP	1
angela	angelum	NNP	110
angelbot	angelbot	NNP	1
angelcake	angelcake	NNP	1
angelcakes	angelcake	NNP	1
angeled	angeled	NNP	1
angeleez	angeleez	NNP	1
angeleno	angeleno	NNP	1
angelenos	angeleno	NNP	20
angeles	angele	NNP	2460
angeles	angeles	UNC	2
angeles-area	angeles-area	NNP	4
angeles-based	angeles-based	JJ	13
angeles-set	angeles-set	NNP	1
angeles-style	angeles-style	NNP	1
angelesifcation	angelesifcation	NNP	1
angelestimes	angelestime	NNP	1
angeles–	angeles–	NNP	2
angelfic	angelfic	NNP	1
angelfire	angelfire	NN	3
angelfish	angelfish	NN	2
angeli	angelus	NN	3
angeli	angelus	NNP	1
angelic	angelic	JJ	15
angelic	angelic	NNP	1
angelica	angelica	NNP	8
angelico	angelico	NNP	13
angelides	angelide	NNP	8
angelika	angelika	NNP	1
angelil	angelil	NNP	2
angelina	angelina	NNP	22
angeline	angeline	NNP	1
angelini	angelinus	NNP	1
angelinnean	angelinnean	NNP	1
angelisnbigrubbahsatin	angelisnbigrubbahsatin	NNP	1
angelito	angelito	NNP	1
angelitos	angelito	NNP	1
angell	angell	NNP	19
angellus	angellus	NNP	1
angelman	angelman	NNP	4
angelmobile	angelmobile	NNP	3
angelo	angelo	NNP	25
angelopoulos	angelopoulo	NNP	2
angelos	angelo	NNP	11
angelou	angelou	NNP	15
angelou	angelou	UNC	1
angels	angel	NNPS	328
angels	angel	NNS	84
angels	angel	NNP	30
angels	angels	UNC	3
angelsacolyte	angelsacolyte	NN	1
angelsu	angelsu	NNP	1
angeluna	angeluna	NNP	1
angelus	angelus	NNP	824
angelus	angelus	JJ	1
angelus-all-along	angelus-all-along	NNP	1
angelus-from-the-happy-pill	angelus-from-the-happy-pill	NNP	1
angelus-style	angelus-style	NNP	1
angelus-will-do-anything-he-can-hang-onto	angelus-will-do-anything-he-can-hang-onto	NNP	1
angelus-y	angelus-y	NNP	3
angelusy	angelusy	NNP	1
angelverse	angelverse	NNP	6
angely	angely	NNP	1
angent	angent	NN	1
angeogenesis	angeogenesis	NNS	1
anger	anger	NN	382
anger	anger	NNP	22
anger	anger	UNC	1
anger-at-work	anger-at-work	JJ	1
anger-in	anger-in	JJ	1
anger-management	anger-management	JJ	2
anger-out	anger-out	JJ	1
anger-release	anger-release	JJ	1
angered	anger	VBN	35
angered	anger	VBD	25
angered	angered	NNP	4
angered	angered	UNC	1
angering	anger	VBG	7
angers	anger	NNP	9
angers	anger	NNS	1
anges	ange	NNP	2
angevin	angevin	NNP	4
anggrek	anggrek	NNP	1
angie	angie	NNP	32
angie	angie	NN	3
angier	angier	NNP	10
angii-elicited	angii-elicited	NNP	1
angii-induced	angii-induced	NNP	1
angilirq	angilirq	NNP	1
angina	angina	NN	27
angina	angina	NNP	3
anginal	anginal	NN	2
angioblasts	angioblast	NNS	1
angioblasts	angioblast	NNP	1
angiocath	angiocath	NNP	1
angiocatheter	angiocatheter	NN	2
angioedema	angioedema	NN	1
angiofluorography	angiofluorography	NN	1
angiogenesis	angiogenesis	NNS	88
angiogenesis	angiogenesis	UNC	2
angiogenesis	angiogenesis	NNP	2
angiogenesis-inducing	angiogenesis-inducing	JJ	1
angiogenesis-related	angiogenesis-related	JJ	3
angiogenic	angiogenic	JJ	43
angiogenic	angiogenic	NNP	3
angiogram	angiogram	NN	10
angiographic	angiographic	JJ	3
angiographic	angiographic	NNP	1
angiographically	angiographically	RB	1
angiography	angiography	NN	25
angiography	angiography	NNP	1
angioguard	angioguard	NNP	9
angiokeratomas	angiokeratoma	NNS	1
angioplastic	angioplastic	JJ	1
angioplasties	angioplasty	NNS	3
angioplasty	angioplasty	NN	24
angioplasty	angioplasty	NNP	7
angiopoietin	angiopoietin	NN	4
angiopoietin	angiopoietin	NNP	1
angiopoietins	angiopoietin	NNS	2
angiosarcoma	angiosarcoma	NN	1
angiosarcomas	angiosarcoma	NNS	1
angioscopy	angioscopy	NN	1
angiosperms	angiosperm	NNS	3
angiostatic	angiostatic	JJ	12
angiostatics	angiostatic	NNS	2
angiostatin	angiostatin	NN	1
angiotensin	angiotensin	NN	34
angiotensin	angiotensin	NNP	4
angiotensin-converting	angiotensin-converting	JJ	5
angius	angius	NNP	1
angkasa	angkasa	NNP	1
angkor	angkor	NNP	6
angladon	angladon	NNP	1
anglais	anglai	NNS	4
anglais	anglai	NNP	3
anglais	anglais	JJ	1
angle	angle	NN	477
angle	angle	NNP	31
angle	angle	UNC	5
angle	angle	JJ	1
angled	angled	JJ	16
angleman	angleman	NNP	2
anglenlorne	anglenlorne	NNP	1
anglenwezlee	anglenwezlee	NNP	1
angler	angler	NN	16
angler	angler	NNP	7
anglers	angler	NNS	21
anglers	angler	NNP	4
angles	angle	NNS	179
angles	angle	NNP	14
angles	angles	UNC	5
anglesea	anglesea	NNP	2
anglesey	anglesey	NNP	1
angleterre	angleterre	NNP	1
angleton	angleton	NNP	3
angleus	angleus	NNP	1
anglia	anglium	NNP	3
anglian	anglian	JJ	4
anglican	anglican	NNP	45
anglican	anglican	UNC	1
anglicans	anglican	NNP	12
anglice	anglice	NNP	1
anglicised	anglicised	JJ	1
anglicisms	anglicism	NNP	4
anglicisms	anglicism	NNS	2
anglicization	anglicization	NN	1
anglicize	anglicize	NNP	1
anglicize	anglicize	NN	1
anglicized	anglicized	JJ	15
anglicized	anglicized	NNP	4
anglicizers	anglicizer	NNS	1
anglicizing	anglicize	VBG	1
anglicum	anglicum	NNP	1
anglified	anglified	JJ	1
angliiskii	angliiskius	NNP	1
anglikon	anglikon	NNP	1
angling	angle	VBG	24
angling	angling	NNP	2
anglish	anglish	NNP	7
anglo	anglo	NNP	219
anglo-american	anglo-american	NNP	1
anglo-conformity	anglo-conformity	NNP	1
anglo-hybrids	anglo-hybrid	NNP	1
anglo-maniac	anglo-maniac	NNP	1
anglo-saxons	anglo-saxon	NNP	1
anglo-saxophone	anglo-saxophone	NNP	1
anglo-waste	anglo-waste	NNP	1
anglocentric	anglocentric	NNP	1
anglois	angloi	NNP	1
anglomania	anglomanium	NNP	2
anglophile	anglophile	NNP	3
anglophile	anglophile	NN	1
anglophiles	anglophile	NNP	2
anglophiles	anglophile	NNS	1
anglophiliac	anglophiliac	NNP	1
anglophilic	anglophilic	NNP	3
anglophobia	anglophobia	NNP	2
anglophone	anglophone	NNP	9
anglophone	anglophone	NN	3
anglophones	anglophone	NNP	6
anglos	anglo	NNP	14
anglus	anglus	NNP	1
angnardo	angnardo	NNP	6
angola	angolum	NNP	21
angola	angolum	NN	1
angolan	angolan	JJ	2
angoni	angonus	NNP	1
angora	angora	NNP	3
angora	angora	NN	3
angosta	angosta	NNP	1
angostura	angostura	NNP	2
angram	angram	NNP	1
angrier	angrier	NN	12
angriest	angriest	NN	5
angrily	angrily	RB	48
angrily	angrily	NNP	1
angrp	angrp	NNP	3
angry	angry	JJ	590
angry	angry	NNP	38
angry	angry	UNC	1
angry-for-just-cause	angry-for-just-cause	JJ	1
angry-girl	angry-girl	JJ	1
angry-psychotic	angry-psychotic	JJ	1
angry-with-the-death-of	angry-with-the-death-of	JJ	2
angry-without-a-cause	angry-without-a-cause	JJ	1
angrycrazyruthless	angrycrazyruthless	JJ	1
angrydoctor	angrydoctor	NNP	2
angst	angst	NN	115
angst	angst	NNP	12
angst	angst	JJ	1
angst-fest	angst-fest	JJ	3
angst-filled	angst-filled	JJ	1
angst-ridden	angst-ridden	JJ	3
angst-wracked	angst-wracked	JJ	1
angsted	angsted	JJ	1
angstfest	angstfest	NN	1
angstful	angstful	JJ	1
angstier	angstier	NN	1
angstiest	angstiest	NNP	1
angsting	angst	VBG	2
angstrom	angstrom	NN	2
angstrom	angstrom	NNP	1
angstroms	angstrom	NNS	1
angsty	angsty	NN	27
angsty	angsty	NNP	1
anguage	anguage	NN	1
anguilla	anguillum	NNP	2
anguipede	anguipede	NN	1
anguish	anguish	NN	51
anguish	anguish	NNP	1
anguish-y	anguish-y	JJ	1
anguished	anguished	JJ	31
anguished	anguished	NNP	1
anguished-looking	anguished-looking	JJ	1
anguishing	anguish	VBG	1
angular	angular	NN	25
angulasbaby	angulasbaby	NN	1
angulations	angulation	NNS	1
angulatus	angulatus	JJ	1
angus	angus	NNP	212
angus	angus	JJ	1
angus-ly	angus-ly	NNP	1
angus-style	angus-style	NNP	1
angustias	angustia	NNS	1
angustias	angustia	NNP	1
angustiis	angustii	NNS	1
angusy	angusy	NNP	2
angwissous	angwissous	JJ	2
angwissous	angwissous	NNP	1
angélico	angélico	NNP	1
anh	anh	NNP	1
anhalt	anhalt	NNP	2
anhalter	anhalter	NNP	2
anhedonia	anhedonium	NN	1
anhela	anhelum	NN	1
anheuser	anheuser	NNP	16
anhidrosis	anhidrosis	NNS	1
anhouilh	anhouilh	NNP	1
anhui	anhuus	NNP	1
anhydrase	anhydrase	NN	9
anhydride	anhydride	NN	4
anhydrogalactose	anhydrogalactose	NN	2
anhydrous	anhydrous	JJ	14
anhydrous	anhydrous	NNP	1
ani	anus	NN	30
ani	anus	NNP	11
aniacs	aniac	NNS	2
anibal	anibal	NNP	1
anicca	anicca	NN	1
anicteric	anicteric	JJ	2
anifowoshe	anifowoshe	NNP	1
anihi	anihi	NN	1
anika	anika	NNP	1
aniko	aniko	NNP	1
anil	anil	NNP	2
aniline-dyed	aniline-dyed	JJ	1
anima	anima	NN	6
animadversion	animadversion	NN	2
animadversions	animadversion	NNS	1
animae	anima	NN	1
animal	animal	NN	1228
animal	animal	NNP	215
animal	animal	JJ	11
animal	animal	UNC	2
animal-based	animal-based	JJ	1
animal-consuming	animal-consuming	JJ	1
animal-control	animal-control	JJ	1
animal-driven	animal-driven	JJ	1
animal-ethics	animal-ethic	NNP	4
animal-friendly	animal-friendly	JJ	1
animal-headed	animal-headed	JJ	1
animal-inspired	animal-inspired	JJ	1
animal-loving	animal-loving	JJ	1
animal-printed	animal-printed	JJ	1
animal-righters	animal-righter	NNP	1
animal-rights	animal-right	NN	4
animal-rights	animal-right	NNP	3
animal-skin	animal-skin	JJ	1
animal-specific	animal-specific	JJ	1
animal-to	animal-to	NNP	1
animal-to-animal	animal-to-animal	JJ	5
animal-to-person	animal-to-person	JJ	1
animal-type	animal-type	JJ	1
animal-unit-month	animal-unit-month	JJ	2
animalcule	animalcule	NN	1
animalibus	animalibus	NNP	1
animalistic	animalistic	JJ	8
animality	animality	NN	1
animals	animal	NNS	1914
animals	animal	NNPS	16
animals	animal	NNP	4
animals	animals	UNC	9
animals-only	animals-only	JJ	1
animalsthat	animalsthat	NN	1
animalsto	animalsto	NN	1
animal–microbe	animal–microbe	NN	1
animal–vegetal	animal–vegetal	NN	1
animaniacs	animaniac	NNP	6
animaniacs-in	animaniacs-in	NNP	2
animas	anima	NNP	2
animate	animate	NN	20
animated	animate	VBN	183
animated	animated	JJ	12
animated	animated	NNP	2
animatedly	animatedly	RB	7
animates	animate	NNS	6
animating	animate	VBG	10
animation	animation	NN	99
animation	animation	NNP	4
animations	animation	NNS	11
animator	animator	NN	13
animator	animator	NNP	2
animators	animator	NNS	11
animatronic	animatronic	JJ	15
animatronically	animatronically	RB	1
animatronics	animatronic	NNS	1
anime	anime	NN	13
anime	anime	NNP	2
animes	anime	NNS	1
animism	animism	NN	3
animist	animist	NN	6
animistic	animistic	JJ	2
animists	animist	NNS	2
animorphs	animorph	NNP	1
animosities	animosity	NNS	5
animosity	animosity	NN	45
animosity	animosity	UNC	1
animportant	animportant	NN	1
animus	animus	JJ	15
anindependent	anindependent	NN	1
anion	anion	NN	11
anion-exchange	anion-exchange	JJ	7
anion-exchange	anion-exchange	NNP	1
anionic	anionic	JJ	23
anions	anion	NNS	4
anipryl	anipryl	NNP	2
anis	ani	NNP	1
anise	anise	NN	4
anise-flavored	anise-flavored	JJ	1
aniseed	aniseed	JJ	4
aniseed-scented	aniseed-scented	JJ	1
anish	anish	NNP	2
anisocoria	anisocorium	NN	1
anisomorphic	anisomorphic	JJ	1
anisomorphic	anisomorphic	NNP	1
anisomycin	anisomycin	NN	14
anisomycin-stimulated	anisomycin-stimulated	JJ	1
anisomycin-treated	anisomycin-treated	JJ	1
anisonucleosis	anisonucleosis	NNS	2
anissina	anissina	NNP	33
aniston	aniston	NNP	30
aniston	aniston	UNC	1
anit	anit	NN	1
anita	anita	NNP	104
anitfreeze	anitfreeze	NN	1
anither	anither	NN	1
anitra	anitra	NNP	1
anity	anity	NN	1
aniversary	aniversary	NNP	1
aniya	aniya	NNP	2
anja	anja	NNP	1
anjali	anjalus	NNP	1
anjelica	anjelica	NNP	3
anjin	anjin	NNP	1
anjin	anjin	NN	1
anjing	anjing	NNP	1
anjou	anjou	NNP	10
ank	ank	NNP	5
ank	ank	NN	1
anka	anka	NNP	7
ankara	ankara	NNP	31
ankeny	ankeny	NNP	2
anker	anker	NNP	1
anker	anker	NN	1
ankfc	ankfc	NNP	2
ankh	ankh	NN	2
ankh	ankh	NNP	2
ankle	ankle	NN	140
ankle	ankle	NNP	6
ankle-deep	ankle-deep	JJ	1
ankle-length	ankle-length	JJ	6
ankle-snapping	ankle-snapping	JJ	1
ankles	ankle	NNS	58
anklesangle	anklesangle	NN	1
anklet	anklet	NN	1
ankleton	ankleton	NNP	1
anklets	anklet	NNS	3
ankor	ankor	NN	1
anks-ity	anks-ity	NNP	1
ankush	ankush	NNP	2
ankylosing	ankylose	VBG	8
ankylosis	ankylosis	NNS	3
ankyrin	ankyrin	NN	5
ankyrins	ankyrin	NNS	1
ankyrins	ankyrin	NNP	1
anlage	anlage	NN	25
anlage	anlage	NNP	1
anlagen	anlagen	NN	7
anlagen	anlagen	NNP	3
anlayzed	anlayzed	JJ	1
anlysis	anlysis	NNS	1
ann	ann	NNP	401
anna	anna	NNP	179
anna	anna	NN	1
anna	anna	UNC	1
annabel	annabel	NNP	8
annabella	annabellum	NNP	2
annabelle	annabelle	NNP	11
annabeth	annabeth	NNP	3
annachie	annachie	NNP	2
annaka	annaka	NNP	1
annakhil	annakhil	NNP	1
annakovsky	annakovsky	NN	2
annal	annal	NN	1
annalee	annalee	NNP	1
annals	annals	NN	26
annals	annals	NNP	16
annamaria	annamarium	NNP	8
annamese	annamese	NNP	1
annan	annan	NNP	136
annan	annan	UNC	1
annan-brokered	annan-brokered	NNP	1
annan-omous	annan-omous	NNP	1
annandale	annandale	NNP	5
annandale-on	annandale-on	NNP	2
annane	annane	NNP	2
annapolis	annapoli	NNP	22
annapolis-sat	annapolis-sat	NNP	1
annapurna	annapurna	NNP	14
annapurnas	annapurna	NNP	2
annarborous	annarborous	NNP	1
annas	anna	NNP	2
annaud	annaud	NNP	3
anne	anne	NNP	488
anne	anne	NN	1
anne	anne	UNC	1
anne-de	anne-de	NNP	1
anne-style	anne-style	NNP	1
anneal	anneal	NN	14
annealed	annealed	JJ	41
annealed	annealed	NNP	1
annealing	anneal	VBG	115
annealing-extension	annealing-extension	JJ	1
anneals	anneal	NNS	3
annecy	annecy	NNP	5
annelaine	annelaine	NNP	3
anneli	annelus	NNP	1
annelid	annelid	NN	1
annelida	annelida	NNP	1
annelids	annelid	NNS	4
annemarie	annemarie	NNP	2
annenberg	annenberg	NNP	7
annenbergs	annenbergs	NNP	1
annes	ann	NNP	4
annese	annese	NNP	4
anness	anness	NNP	1
annetastic	annetastic	NNP	1
annett	annett	NNP	1
annette	annette	NNP	33
annex	annex	NN	37
annex	annex	NNP	6
annexation	annexation	NN	22
annexed	annexed	JJ	28
annexes	annex	NNS	3
annexes	annexes	UNC	1
annexin	annexin	NN	46
annexin	annexin	NNP	10
annexing	annex	VBG	5
annexins	annexin	NNS	1
anni	annus	NN	1
annia	annium	NNP	12
annibale	annibale	NNP	7
annick	annick	NNP	1
annie	annie	NNP	100
anniesj	anniesj	NNP	2
annif	annif	NN	1
annihilate	annihilate	NN	9
annihilated	annihilated	JJ	11
annihilating	annihilate	VBG	1
annihilation	annihilation	NN	11
annihilation	annihilation	NNP	1
annika	annika	NNP	18
annin	annin	NNP	1
annin	annin	NN	1
annis	anni	NNP	2
annisa	annisa	NN	1
annisquam	annisquam	NNP	1
anniston	anniston	NNP	3
anniversaries	anniversary	NNS	12
anniversaries	anniversary	NNP	1
anniversary	anniversary	NN	418
anniversary	anniversary	NNP	1
anniversay	anniversay	NN	1
anniversyar	anniversyar	NNP	1
annmtg	annmtg	NN	1
annnd	annnd	NNP	3
annniversary	annniversary	NNP	1
anno	anno	NN	1
annointed	annointed	NNP	1
annoncement	annoncement	NN	2
annonciade	annonciade	NNP	1
annooying	annooy	VBG	1
annot	annot	NN	1
annotate	annotate	NN	47
annotated	annotated	JJ	282
annotated	annotated	NNP	8
annotates	annotate	NNS	1
annotating	annotate	VBG	18
annotating	annotating	NNP	1
annotation	annotation	NN	431
annotation	annotation	NNP	38
annotation-based	annotation-based	JJ	1
annotational	annotational	NN	1
annotationare	annotationare	NN	1
annotationeditor	annotationeditor	NNP	4
annotations	annotation	NNS	230
annotations	annotation	NNP	8
annotationsfor	annotationsfor	NN	1
annotationstation	annotationstation	NNP	1
annotative	annotative	JJ	1
annotator	annotator	NN	8
annotators	annotator	NNS	1
annoting	annote	VBG	1
annotto	annotto	NNP	2
annouced	annouced	JJ	1
annoucement	annoucement	NN	1
announce	announce	VB	200
announce	announce	VBP	39
announce	announce	NNP	2
announced	announce	VBD	939
announced	announce	VBN	285
announced	announced	JJ	8
announced	announced	UNC	4
announcement	announcement	NN	490
announcement	announcement	NNP	3
announcement	announcement	UNC	1
announcements	announcement	NNS	98
announcements	announcement	NNP	2
announcer	announcer	NN	56
announcer	announcer	NNP	6
announcers	announcer	NNS	16
announces	announce	VBZ	97
announces	announce	NNP	9
announcing	announce	VBG	143
announcing	announcing	NNP	9
announcing	announcing	UNC	1
announcment	announcment	NN	4
annoy	annoy	NN	66
annoy	annoy	NNP	1
annoyance	annoyance	NN	56
annoyance	annoyance	NNP	6
annoyances	annoyance	NNS	6
annoyances	annoyance	NNP	1
annoyances	annoyances	UNC	1
annoyed	annoy	VBN	119
annoyed	annoy	VBD	90
annoyed	annoyed	NNP	4
annoying	annoying	JJ	511
annoying	annoying	NNP	21
annoying	annoying	UNC	1
annoyingly	annoyingly	RB	21
annoys	annoy	NNS	55
annpying	annpy	VBG	1
anntibiotics	anntibiotic	NNS	1
annua	annua	NN	2
annual	annual	JJ	1696
annual	annual	NNP	125
annual-meeting	annual-meeting	JJ	1
annual-meetings	annual-meeting	JJ	1
annualcombustion	annualcombustion	NN	3
annualized	annualize	VBN	21
annualized	annualized	NNP	1
annualized	annualized	JJ	1
annually	annually	RB	339
annually	annually	NNP	5
annually	annually	UNC	1
annualrpt	annualrpt	NN	1
annuals	annual	NNS	12
annuals	annual	NNP	2
annui	annuus	NN	1
annuitant	annuitant	NN	1
annuitants	annuitant	NNS	1
annuities	annuity	NNS	24
annuitity	annuitity	NN	1
annuitizing	annuitize	VBG	2
annuity	annuity	NN	28
annuity	annuity	NNP	4
annul	annul	NN	2
annular	annular	NN	3
annulata	annula	NN	1
annulate	annulate	NN	2
annuli	annulus	NN	1
annulled	annulled	JJ	9
annulling	annull	VBG	1
annulment	annulment	NN	8
annulments	annulment	NNS	2
annuls	annul	NNS	1
annulus	annulus	JJ	7
annum	annum	NN	2
annunciation	annunciation	NNP	15
annunciation	annunciation	NN	2
annunziata	annunzia	NNP	2
annunzio	annunzio	NNP	5
annun­ci­a­tion	annun­ci­a­tion	NNP	1
annus	annus	JJ	4
annuus	annuus	JJ	3
anny	anny	NN	1
ano	ano	NNP	4
ano	ano	NN	3
anoble	anoble	JJ	2
anode	anode	NN	1
anodized	anodized	JJ	2
anodized	anodized	NNP	1
anodyne	anodyne	NN	14
anodyne	anodyne	NNP	4
anoia	anoium	NNP	2
anoikis	anoiki	NNS	5
anoint	anoint	NN	11
anointed	anointed	JJ	46
anointed	anointed	NNP	7
anointest	anointest	NN	1
anointing	anoint	VBG	7
anointment	anointment	NN	2
anoints	anoint	NNS	7
anomalies	anomaly	NNS	35
anomalies	anomaly	NNP	3
anomalous	anomalous	JJ	43
anomalous	anomalous	NNP	2
anomalously	anomalously	RB	2
anomaly	anomaly	RB	39
anomaly-the	anomaly-the	JJ	1
anomic	anomic	JJ	3
anomie	anomie	NN	10
anomie	anomie	NNP	1
anomolies	anomoly	NNS	1
anon	anon	NNP	8
anon	anon	NN	5
anone	anone	NN	1
anonymiana	anonymiana	NNP	1
anonymity	anonymity	NN	92
anonymity	anonymity	UNC	2
anonymity	anonymity	NNP	1
anonymized	anonymized	JJ	1
anonymous	anonymous	JJ	214
anonymous	anonymous	NNP	55
anonymous	anonymous	UNC	2
anonymous-evil-which-must-be-destroyed	anonymous-evil-which-must-be-destroyed	JJ	1
anonymouse	anonymouse	NNP	1
anonymously	anonymously	RB	36
anonymously	anonymously	UNC	1
anonymously	anonymously	NNP	1
anonyms	anonym	NNS	1
anooying	anooy	VBG	1
anopheles	anopheles	NNP	93
anopheline	anopheline	NN	2
anoquodor	anoquodor	NNP	2
anorexia	anorexia	NN	35
anorexia	anorexia	NNP	15
anorexic	anorexic	JJ	34
anorexics	anorexic	NNS	9
anorxic	anorxic	NNP	2
anosmias	anosmia	NNS	2
anosognosia	anosognosium	NN	2
anot	anot	NNP	6
anote	anote	NNP	1
anotehr	anotehr	NN	1
anoth	anoth	NN	2
anothe	anothe	NN	1
another	another	DT	12221
another	another	UNC	37
another	another	NNP	23
another-are	another-are	JJ	1
another-it	another-it	JJ	1
anotherand	anotherand	NN	1
anotherthree	anotherthree	NN	1
anouk	anouk	NNP	4
anouncement	anouncement	NN	1
anova	anova	NNP	204
anovas	anova	NNP	10
anovulation	anovulation	NN	1
anovulatory	anovulatory	NN	1
anoxia	anoxium	NN	1
anozer	anozer	NN	5
anp	anp	NNP	1
anpei	anpeus	NN	1
anquetil	anquetil	NNP	7
anred	anred	JJ	2
ans	an	NNS	7
ans	ans	NN	1
ansar	ansar	NNP	10
ansar-ul	ansar-ul	NNP	2
ansari	ansarus	NNP	2
anschutz	anschutz	NNP	6
ansci	anscus	NN	1
anse	anse	NNP	16
anse-aux	anse-aux	NNP	1
ansel	ansel	NNP	5
anselin	anselin	NNP	1
ansell	ansell	NNP	4
anselm	anselm	NNP	4
anselma	anselma	NNP	1
anselmo	anselmo	NNP	19
ansen	ansen	NNP	30
anses-d	anses-d	NNP	1
ansi	ansus	NNP	9
ansible	ansible	JJ	1
ansley	ansley	NNP	2
anson	anson	NNP	15
ansty	ansty	NN	1
answeed	answeed	JJ	1
answer	answer	NN	2083
answer	answer	VB	696
answer	answer	NNP	310
answer	answer	VBP	59
answer	answer	UNC	13
answer	answer	JJ	1
answer-desk	answer-desk	JJ	1
answerable	answerable	JJ	7
answered	answer	VBN	258
answered	answer	VBD	243
answered	answered	UNC	2
answered	answered	NNP	1
answererd	answererd	NN	1
answerers	answerer	NNS	1
answering	answer	VBG	269
answering	answering	NN	12
answering	answering	NNP	10
answering-machine	answering-machine	JJ	3
answerphone	answerphone	NN	1
answers	answer	NNS	960
answers	answer	VBZ	87
answers	answer	NNP	14
answers	answers	UNC	2
answers	answers	JJ	1
answerthink	answerthink	NN	1
ant	ant	NN	49
ant	ant	NNP	35
ant-nut	ant-nut	JJ	1
ant-parasite	ant-parasite	JJ	1
ant-phosphotyrosine	ant-phosphotyrosine	JJ	1
anta	anta	NN	2
anta	anta	NNP	1
antacid	antacid	NN	2
antacids	antacid	NNS	2
antacids	antacid	NNP	1
antag	antag	NNP	4
antagonisation	antagonisation	NN	2
antagonise	antagonise	NN	1
antagonised	antagonised	JJ	2
antagonising	antagonise	VBG	1
antagonism	antagonism	NN	58
antagonism	antagonism	NNP	3
antagonism	antagonism	UNC	1
antagonisms	antagonism	NNS	1
antagonist	antagonist	NN	129
antagonist	antagonist	NNP	2
antagonist-bound	antagonist-bound	JJ	2
antagonistic	antagonistic	JJ	61
antagonistic	antagonistic	UNC	1
antagonistic	antagonistic	NNP	1
antagonistically	antagonistically	RB	4
antagonists	antagonist	NNS	162
antagonists	antagonist	NNP	4
antagonists	antagonists	UNC	1
antagonization	antagonization	NN	1
antagonize	antagonize	VB	24
antagonized	antagonized	JJ	12
antagonizes	antagonize	NNS	11
antagonizing	antagonize	VBG	18
antagonizing	antagonizing	NNP	2
antananarivo	antananarivo	NNP	3
antarctic	antarctic	NNP	42
antarctica	antarctica	NNP	45
antarctica	antarctica	NN	1
antares	antare	NNP	4
antartica	antartica	NNP	2
antas	anta	NNS	1
antawn	antawn	NNP	1
antca	antca	NN	1
ante	ante	NN	53
ante	ante	UNC	1
ante	ante	NNP	1
anteact	anteact	NN	1
anteater	anteater	NNP	1
anteaters	anteater	NNS	1
antebellum	antebellum	JJ	13
antebellum	antebellum	NNP	1
anteceded	anteceded	JJ	1
antecedent	antecedent	NN	29
antecedent	antecedent	NNP	2
antecedently	antecedently	RB	1
antecedents	antecedent	NNS	17
antechamber	antechamber	NN	6
antechamber	antechamber	NNP	1
antechambers	antechamber	NNS	2
antecubital	antecubital	NN	3
anted	anted	JJ	1
antedate	antedate	NN	5
antedated	antedated	JJ	2
antedates	antedate	NNS	5
antedating	antedate	VBG	2
antedatings	antedating	NNS	1
antedatings	antedating	NNP	1
antedatings	antedatings	UNC	1
antediluvian	antediluvian	NN	5
antediluvian	antediluvian	NNP	1
antegrade	antegrade	NN	3
antegren	antegren	NNP	1
anteing	ante	VBG	2
antel	antel	NNP	2
antelami	antelamus	NNP	1
antell	antell	NNP	1
antelope	antelope	NNP	19
antelope	antelope	NNS	15
antelopes	antelope	NNS	4
antemortem	antemortem	NN	1
antemortum	antemortum	NN	1
antena	antena	NN	1
antenae	antena	NN	1
antenatal	antenatal	NN	7
antenna	antenna	NN	38
antenna-like	antenna-like	JJ	1
antennae	antenna	NN	22
antennal	antennal	NN	32
antennapedia	antennapedium	NNP	3
antennas	antenna	NNS	17
antennes	antenn	NNS	1
antepartum	antepartum	NN	2
antepenultimate	antepenultimate	NN	1
antequam	antequam	NN	1
antequera	antequera	NNP	7
anteriad	anteriad	NN	1
anterioposterior	anterioposterior	NNP	1
anterior	anterior	NN	216
anterior	anterior	NNP	12
anterior-posterior	anterior-posterior	JJ	7
anteriorly	anteriorly	RB	15
anterior–posterior	anterior–posterior	NN	1
anterograde	anterograde	NN	1
anterolateral	anterolateral	NN	3
anterolateral	anterolateral	NNP	1
anteroom	anteroom	NN	2
anteroposterior	anteroposterior	NNP	1
anteroposterior	anteroposterior	NN	1
anteroventral	anteroventral	NN	1
antes	ant	NNS	2
antforms	antform	NNP	1
anthee	anthee	NNP	6
anthelminthic	anthelminthic	JJ	1
anthem	anthem	NN	52
anthem	anthem	NNP	13
anthem	anthem	UNC	1
anthema	anthema	NNP	1
anthemic	anthemic	JJ	2
anthemideae	anthemidea	NNP	8
anthemideae-type	anthemideae-type	NNP	1
anthemius	anthemius	NNP	1
anthems	anthem	NNS	13
anther	anther	NN	2
anther	anther	NNP	1
anthers	anther	NNS	2
anthill	anthill	NN	3
anthills	anthill	NNS	2
anthills	anthill	NNP	1
anthocyanidins	anthocyanidin	NNS	1
anthocyanines	anthocyanine	NNS	1
anthoine	anthoine	NNP	2
anthologie	anthologie	NN	1
anthologies	anthology	NNS	10
anthologies	anthology	NNP	1
anthologists	anthologist	NNS	1
anthologized	anthologized	JJ	1
anthologizers	anthologizer	NNS	1
anthologizing	anthologize	VBG	1
anthology	anthology	NN	39
anthology	anthology	NNP	20
anthology	anthology	UNC	1
anthony	anthony	NNP	338
anthony	anthony	NN	1
anthonys	anthony	NNP	1
anthozoons	anthozoon	NNS	1
anthracis	anthraci	NNS	27
anthracite	anthracite	NN	2
anthracks	anthrack	NNS	1
anthracycline	anthracycline	NN	3
anthracycline-containing	anthracycline-containing	JJ	1
anthracyclines	anthracycline	NNS	3
anthranilate	anthranilate	NN	20
anthranilate-utilizing	anthranilate-utilizing	JJ	1
anthrax	anthrax	NN	111
anthrax	anthrax	NNP	8
anthrax-by-mail	anthrax-by-mail	JJ	1
anthrax-laced	anthrax-laced	NNP	1
anthrax-like	anthrax-like	JJ	1
anthrax-response	anthrax-response	JJ	1
anthrax-scientist	anthrax-scientist	NNP	3
anthrax-tipped	anthrax-tipped	JJ	1
anthrax-type	anthrax-type	NNP	1
anthro	anthro	NN	5
anthropic	anthropic	JJ	6
anthropic	anthropic	NNP	2
anthropogenic	anthropogenic	JJ	1
anthropoid	anthropoid	NNP	1
anthropological	anthropological	JJ	20
anthropological	anthropological	NNP	4
anthropologically	anthropologically	RB	2
anthropologist	anthropologist	NN	53
anthropologist	anthropologist	NNP	3
anthropologists	anthropologist	NNS	38
anthropologists	anthropologist	NNP	5
anthropology	anthropology	NN	60
anthropology	anthropology	NNP	17
anthropology-speak	anthropology-speak	JJ	1
anthropometric	anthropometric	JJ	21
anthropometric	anthropometric	NNP	1
anthropometrics	anthropometric	NNS	1
anthropometry	anthropometry	NNP	1
anthropometry	anthropometry	NN	1
anthropomorphic	anthropomorphic	JJ	8
anthropomorphic	anthropomorphic	NNP	1
anthropomorphically	anthropomorphically	RB	1
anthropomorphism	anthropomorphism	NN	1
anthropomorphization	anthropomorphization	NN	1
anthropomorphize	anthropomorphize	NN	3
anthropomorphizing	anthropomorphize	VBG	4
anthroponymy	anthroponymy	NN	1
anthropormorphise	anthropormorphise	NN	1
anthro­pol­o­gists	anthro­pol­o­gists	NNP	1
anthurium	anthurium	NN	1
anthuriums	anthurium	NNS	2
anti	anti	NN	1716
anti	anti	NNP	176
anti	anti	UNC	6
anti-?	anti-?	JJ	50
anti-?	anti-?	NNP	2
anti-?-actin	anti-?-actin	JJ	3
anti-?-actin	anti-?-actin	NNP	2
anti-?-catenin	anti-?-catenin	JJ	2
anti-?-coatomer	anti-?-coatomer	JJ	1
anti-?-gal	anti-?-gal	JJ	1
anti-?-gustducin	anti-?-gustducin	JJ	3
anti-?-tubulin	anti-?-tubulin	JJ	6
anti-?v?	anti-?v?	JJ	1
anti-abortion	anti-abortion	JJ	86
anti-abortion	anti-abortion	NN	1
anti-abortion-rights	anti-abortion-right	JJ	2
anti-abortionist	anti-abortionist	NN	2
anti-abortionists	anti-abortionist	NNS	1
anti-abortive	anti-abortive	JJ	1
anti-abuse	anti-abuse	JJ	1
anti-academic	anti-academic	JJ	3
anti-academy	anti-academy	JJ	1
anti-acetylated	anti-acetylated	JJ	1
anti-actin	anti-actin	JJ	2
anti-active	anti-active	JJ	2
anti-adenoviral	anti-adenoviral	JJ	1
anti-adhesive	anti-adhesive	JJ	1
anti-ads	anti-ad	JJ	1
anti-adultery	anti-adultery	JJ	2
anti-aesthetic	anti-aesthetic	JJ	1
anti-affirmative	anti-affirmative	JJ	5
anti-affirmative-action	anti-affirmative-action	JJ	5
anti-ageing	anti-ageing	JJ	1
anti-aggregant	anti-aggregant	JJ	1
anti-aging	anti-aging	JJ	3
anti-air	anti-air	JJ	3
anti-aircraft	anti-aircraft	JJ	37
anti-airline	anti-airline	NN	1
anti-al	anti-al	JJ	1
anti-allergy	anti-allergy	JJ	1
anti-alpha	anti-alpha	JJ	1
anti-androgen	anti-androgen	JJ	2
anti-angiogenesis	anti-angiogenesis	JJ	1
anti-angiogenic	anti-angiogenic	JJ	10
anti-anorexia	anti-anorexia	JJ	1
anti-anti	anti-anti	JJ	3
anti-anti-cloning	anti-anti-cloning	JJ	2
anti-anti-divorce	anti-anti-divorce	JJ	1
anti-antidisestablishmentarianism	anti-antidisestablishmentarianism	NNP	1
anti-anxiety	anti-anxiety	JJ	8
anti-anything	anti-anything	JJ	1
anti-apartheid	anti-apartheid	JJ	5
anti-apologizing	anti-apologizing	JJ	1
anti-apoptotic	anti-apoptotic	JJ	42
anti-apoptotic	anti-apoptotic	NNP	2
anti-apoptotically	anti-apoptotically	JJ	3
anti-aquaporin	anti-aquaporin	JJ	2
anti-arrhythmic	anti-arrhythmic	JJ	1
anti-art	anti-art	JJ	1
anti-arthritic	anti-arthritic	JJ	1
anti-asbestos	anti-asbesto	JJ	1
anti-asbt	anti-asbt	JJ	1
anti-askye	anti-askye	JJ	1
anti-assisted	anti-assisted	JJ	1
anti-assisted-suicide	anti-assisted-suicide	JJ	1
anti-asspull	anti-asspull	JJ	1
anti-atherogenesis	anti-atherogenesis	JJ	1
anti-atherogenic	anti-atherogenic	JJ	1
anti-atherosclerotic	anti-atherosclerotic	JJ	1
anti-authoritarian	anti-authoritarian	JJ	3
anti-authoritarianism	anti-authoritarianism	JJ	2
anti-authority	anti-authority	JJ	1
anti-autism	anti-autism	JJ	1
anti-b	anti-b	JJ	1
anti-backlash	anti-backlash	JJ	1
anti-bacteriants	anti-bacteriant	JJ	1
anti-baking	anti-baking	JJ	1
anti-baldness	anti-baldness	JJ	1
anti-ballerina	anti-ballerina	JJ	1
anti-ballistic	anti-ballistic	JJ	5
anti-ballistic	anti-ballistic	NNP	1
anti-ballistic-missile	anti-ballistic-missile	JJ	1
anti-banner	anti-banner	JJ	1
anti-battle	anti-battle	JJ	1
anti-big-government	anti-big-government	JJ	1
anti-bigotry	anti-bigotry	JJ	1
anti-bilingualism	anti-bilingualism	JJ	1
anti-biography	anti-biography	JJ	1
anti-biological	anti-biological	JJ	1
anti-biotics	anti-biotic	JJ	6
anti-biotin	anti-biotin	JJ	2
anti-birth-control	anti-birth-control	JJ	1
anti-bistate	anti-bistate	JJ	1
anti-black	anti-black	JJ	5
anti-bloat	anti-bloat	JJ	2
anti-blockbuster	anti-blockbuster	JJ	1
anti-blood-clotting	anti-blood-clotting	JJ	1
anti-blue	anti-blue	JJ	1
anti-bodies	anti-body	JJ	1
anti-body	anti-body	JJ	1
anti-bombing	anti-bombing	JJ	5
anti-boring	anti-boring	JJ	1
anti-bourgeois	anti-bourgeoi	JJ	1
anti-bovine	anti-bovine	JJ	2
anti-boxing	anti-boxing	JJ	1
anti-breast	anti-breast	JJ	1
anti-breeding	anti-breeding	JJ	1
anti-bribery	anti-bribery	JJ	1
anti-brutality	anti-brutality	JJ	1
anti-buffista	anti-buffista	JJ	1
anti-bureaucratic	anti-bureaucratic	JJ	1
anti-business	anti-business	JJ	9
anti-busing	anti-busing	JJ	2
anti-c-crk	anti-c-crk	JJ	1
anti-c-jun	anti-c-jun	JJ	1
anti-caffeine	anti-caffeine	JJ	1
anti-caldesmon	anti-caldesmon	JJ	1
anti-calnexin	anti-calnexin	JJ	1
anti-calnexin	anti-calnexin	NNP	1
anti-calponin	anti-calponin	JJ	1
anti-calreticulin	anti-calreticulin	NNP	2
anti-camel	anti-camel	JJ	1
anti-camel-toe	anti-camel-toe	JJ	1
anti-campaign	anti-campaign	JJ	1
anti-cancer	anti-cancer	JJ	8
anti-capital	anti-capital	JJ	1
anti-capitalist	anti-capitalist	JJ	4
anti-caspase	anti-caspase	JJ	1
anti-catalase	anti-catalase	JJ	2
anti-cathepsin	anti-cathepsin	JJ	1
anti-catheter	anti-catheter	JJ	1
anti-celebrity	anti-celebrity	JJ	1
anti-cellularism	anti-cellularism	JJ	1
anti-censorship	anti-censorship	JJ	1
anti-chameleon	anti-chameleon	JJ	1
anti-change	anti-change	JJ	1
anti-charismatic	anti-charismatic	JJ	1
anti-chart-pop	anti-chart-pop	JJ	1
anti-chemical	anti-chemical	JJ	1
anti-chemokine	anti-chemokine	JJ	1
anti-chicken	anti-chicken	JJ	3
anti-chicken	anti-chicken	NNP	1
anti-chimera	anti-chimera	JJ	1
anti-chlamydial	anti-chlamydial	JJ	2
anti-choice	anti-choice	JJ	5
anti-cholesterol	anti-cholesterol	JJ	1
anti-cholinergic	anti-cholinergic	NNP	1
anti-christ	anti-christ	NNP	1
anti-christ	anti-christ	JJ	1
anti-cigarette	anti-cigarette	JJ	1
anti-civil-libertarian	anti-civil-libertarian	JJ	1
anti-class	anti-class	JJ	1
anti-cleaved	anti-cleaved	JJ	2
anti-clerical	anti-clerical	JJ	5
anti-clericalism	anti-clericalism	JJ	2
anti-clericalist	anti-clericalist	JJ	1
anti-climactic	anti-climactic	JJ	4
anti-climatic	anti-climatic	NNP	1
anti-climax	anti-climax	JJ	3
anti-cloning	anti-cloning	JJ	1
anti-clotting	anti-clotting	JJ	1
anti-coagulant	anti-coagulant	JJ	3
anti-coffee	anti-coffee	JJ	2
anti-collagen	anti-collagen	JJ	6
anti-collagen-type	anti-collagen-type	JJ	1
anti-colonial	anti-colonial	JJ	5
anti-color	anti-color	JJ	1
anti-commercial	anti-commercial	JJ	2
anti-commercialism	anti-commercialism	JJ	1
anti-commodity	anti-commodity	JJ	1
anti-communism	anti-communism	JJ	8
anti-communist	anti-communist	JJ	9
anti-communists	anti-communist	JJ	1
anti-community	anti-community	JJ	1
anti-competitive	anti-competitive	JJ	26
anti-conglomerate	anti-conglomerate	JJ	1
anti-connor	anti-connor	JJ	1
anti-conservationist	anti-conservationist	JJ	1
anti-conservative	anti-conservative	JJ	1
anti-conservatives	anti-conservative	JJ	1
anti-conspiratorial	anti-conspiratorial	JJ	1
anti-constitutional	anti-constitutional	JJ	1
anti-consumer	anti-consumer	JJ	3
anti-consumerism	anti-consumerism	JJ	1
anti-cool	anti-cool	JJ	1
anti-corporate	anti-corporate	JJ	3
anti-corruption	anti-corruption	JJ	2
anti-crime	anti-crime	JJ	6
anti-criminal	anti-criminal	JJ	1
anti-crisis	anti-crisis	JJ	1
anti-crowd	anti-crowd	JJ	1
anti-cyclin	anti-cyclin	JJ	6
anti-cynicism	anti-cynicism	JJ	1
anti-cytochrome	anti-cytochrome	JJ	7
anti-cytokine	anti-cytokine	JJ	2
anti-dancing	anti-dancing	JJ	1
anti-dating	anti-dating	JJ	1
anti-death	anti-death	JJ	1
anti-defamation	anti-defamation	JJ	2
anti-democratic	anti-democratic	JJ	9
anti-dengue	anti-dengue	JJ	1
anti-depressant	anti-depressant	NN	6
anti-depressants	anti-depressant	JJ	13
anti-depressants	anti-depressant	NNP	1
anti-desecration	anti-desecration	JJ	1
anti-diabetic	anti-diabetic	JJ	1
anti-diarrheal	anti-diarrheal	JJ	1
anti-digoxigenin	anti-digoxigenin	JJ	9
anti-digoxigenin-peroxidase	anti-digoxigenin-peroxidase	JJ	1
anti-digoxygenin	anti-digoxygenin	JJ	2
anti-discrimination	anti-discrimination	JJ	16
anti-diva	anti-diva	JJ	1
anti-divorce	anti-divorce	JJ	1
anti-doomsaying	anti-doomsaying	JJ	2
anti-doping	anti-doping	JJ	1
anti-draft	anti-draft	JJ	1
anti-dramatic	anti-dramatic	JJ	1
anti-dreyfusard-poujadist-lepenist	anti-dreyfusard-poujadist-lepenist	JJ	1
anti-drinking	anti-drinking	JJ	1
anti-drug	anti-drug	JJ	53
anti-drug-war	anti-drug-war	JJ	1
anti-drunk	anti-drunk	JJ	2
anti-ds	anti-d	JJ	1
anti-duck	anti-duck	JJ	1
anti-e	anti-e	JJ	2
anti-economics	anti-economic	JJ	1
anti-economist	anti-economist	JJ	1
anti-education	anti-education	JJ	2
anti-elastin	anti-elastin	JJ	2
anti-electric-car	anti-electric-car	JJ	1
anti-electrons	anti-electron	JJ	1
anti-elimination	anti-elimination	JJ	7
anti-elitism	anti-elitism	JJ	2
anti-elitist	anti-elitist	JJ	2
anti-emotion	anti-emotion	JJ	1
anti-empathy	anti-empathy	JJ	1
anti-endomysial	anti-endomysial	JJ	1
anti-endothelial	anti-endothelial	JJ	2
anti-enthusiasm	anti-enthusiasm	JJ	2
anti-entrepreneurial	anti-entrepreneurial	JJ	1
anti-environment	anti-environment	JJ	13
anti-environmental	anti-environmental	JJ	3
anti-environmentalist	anti-environmentalist	JJ	1
anti-epilepsy	anti-epilepsy	JJ	1
anti-epileptic	anti-epileptic	JJ	3
anti-eradication	anti-eradication	JJ	1
anti-erotic	anti-erotic	JJ	1
anti-essentialism	anti-essentialism	JJ	1
anti-establishment	anti-establishment	JJ	9
anti-estrogen	anti-estrogen	JJ	2
anti-estrogenic	anti-estrogenic	JJ	1
anti-estrogens	anti-estrogen	JJ	1
anti-evolutionary	anti-evolutionary	JJ	1
anti-expansion	anti-expansion	NNP	1
anti-expert	anti-expert	JJ	1
anti-expos	anti-expo	NNP	1
anti-fade	anti-fade	JJ	4
anti-fading	anti-fading	JJ	1
anti-family	anti-family	JJ	5
anti-fan	anti-fan	JJ	1
anti-fascist	anti-fascist	JJ	3
anti-fashion	anti-fashion	JJ	2
anti-father	anti-father	JJ	1
anti-federal-government	anti-federal-government	JJ	1
anti-female	anti-female	JJ	1
anti-feminism	anti-feminism	JJ	1
anti-feminist	anti-feminist	JJ	3
anti-feminists	anti-feminist	JJ	2
anti-fibrillarin	anti-fibrillarin	JJ	1
anti-fibrinolytic	anti-fibrinolytic	JJ	1
anti-fibronectin	anti-fibronectin	NNP	2
anti-flag	anti-flag	JJ	1
anti-flag	anti-flag	NNP	1
anti-flair	anti-flair	JJ	1
anti-flour	anti-flour	JJ	1
anti-flu	anti-flu	JJ	3
anti-fluorescein	anti-fluorescein	JJ	2
anti-foreign	anti-foreign	JJ	1
anti-fraud	anti-fraud	JJ	2
anti-free	anti-free	JJ	1
anti-free-enterprise	anti-free-enterprise	JJ	1
anti-free-trade	anti-free-trade	JJ	1
anti-freeze	anti-freeze	JJ	1
anti-fungal	anti-fungal	JJ	2
anti-fxxx	anti-fxxx	JJ	1
anti-gag	anti-gag	JJ	1
anti-gamblers	anti-gambler	JJ	1
anti-gambling	anti-gambling	JJ	12
anti-gang	anti-gang	JJ	2
anti-gay	anti-gay	JJ	19
anti-gay	anti-gay	NNP	2
anti-gay-discrimination	anti-gay-discrimination	JJ	1
anti-gay-job-discrimination	anti-gay-job-discrimination	JJ	1
anti-gaydar	anti-gaydar	JJ	1
anti-genomic	anti-genomic	JJ	1
anti-germ-warfare	anti-germ-warfare	JJ	1
anti-gliadin	anti-gliadin	NNP	1
anti-glitter	anti-glitter	JJ	1
anti-global	anti-global	JJ	1
anti-globalization	anti-globalization	JJ	2
anti-glucagon	anti-glucagon	JJ	1
anti-glucocorticoid	anti-glucocorticoid	JJ	1
anti-glucocorticoid-independent	anti-glucocorticoid-independent	JJ	1
anti-glucokinase	anti-glucokinase	JJ	1
anti-glutamate	anti-glutamate	JJ	1
anti-goat	anti-goat	JJ	7
anti-government	anti-government	JJ	23
anti-government	anti-government	NN	1
anti-gp	anti-gp	JJ	4
anti-granny	anti-granny	JJ	1
anti-grape	anti-grape	JJ	1
anti-gravin	anti-gravin	JJ	2
anti-gravitons	anti-graviton	JJ	1
anti-gravity	anti-gravity	JJ	2
anti-grown-up	anti-grown-up	JJ	1
anti-growth	anti-growth	JJ	1
anti-guilt	anti-guilt	JJ	1
anti-guinea	anti-guinea	JJ	1
anti-guitar	anti-guitar	JJ	1
anti-gun	anti-gun	JJ	3
anti-gun-control	anti-gun-control	JJ	1
anti-h	anti-h	JJ	4
anti-h	anti-h	NNP	1
anti-haemorrhagic	anti-haemorrhagic	JJ	1
anti-hamster	anti-hamster	JJ	1
anti-haredi	anti-haredi	JJ	2
anti-health	anti-health	JJ	1
anti-hemagglutinin	anti-hemagglutinin	JJ	2
anti-hero	anti-hero	JJ	4
anti-heroes	anti-hero	NNS	1
anti-histamines	anti-histamine	JJ	1
anti-historianism	anti-historianism	JJ	1
anti-historical	anti-historical	JJ	2
anti-homosexual	anti-homosexual	JJ	2
anti-horse	anti-horse	JJ	1
anti-horse-meat	anti-horse-meat	JJ	1
anti-hsp	anti-hsp	JJ	2
anti-human	anti-human	JJ	65
anti-human	anti-human	NNP	3
anti-human-sarcospan	anti-human-sarcospan	NNP	1
anti-humanitarian	anti-humanitarian	JJ	1
anti-humectant	anti-humectant	JJ	1
anti-humor	anti-humor	NNP	1
anti-hurricane	anti-hurricane	JJ	1
anti-hydrogen	anti-hydrogen	JJ	3
anti-hypertensive	anti-hypertensive	JJ	2
anti-hypertensives	anti-hypertensive	JJ	2
anti-i	anti-i	JJ	2
anti-i	anti-us	NNP	1
anti-id	anti-id	JJ	1
anti-idealist	anti-idealist	JJ	1
anti-idiotype	anti-idiotype	JJ	2
anti-idiotypic	anti-idiotypic	JJ	5
anti-illegal	anti-illegal	JJ	1
anti-image	anti-image	JJ	1
anti-immigrant	anti-immigrant	JJ	10
anti-immigration	anti-immigration	JJ	3
anti-impeachment	anti-impeachment	JJ	8
anti-imperialist	anti-imperialist	JJ	4
anti-impotence	anti-impotence	JJ	5
anti-incarceration	anti-incarceration	JJ	1
anti-income-tax	anti-income-tax	JJ	1
anti-independence	anti-independence	JJ	11
anti-independence	anti-independence	NNP	2
anti-indie	anti-indie	JJ	1
anti-infection	anti-infection	JJ	1
anti-infective	anti-infective	JJ	1
anti-inflammatories	anti-inflammatory	JJ	2
anti-inflammatory	anti-inflammatory	JJ	73
anti-inflationary	anti-inflationary	JJ	1
anti-initiation	anti-initiation	JJ	1
anti-insect	anti-insect	JJ	1
anti-insight	anti-insight	JJ	1
anti-insulin	anti-insulin	JJ	1
anti-intellectual	anti-intellectual	JJ	16
anti-intellectualism	anti-intellectualism	NN	3
anti-intellectualism	anti-intellectualism	NNP	1
anti-intellectualisms	anti-intellectualism	JJ	1
anti-intellectualization	anti-intellectualization	JJ	1
anti-interleukin	anti-interleukin	JJ	1
anti-interventionism	anti-interventionism	JJ	1
anti-interventionist	anti-interventionist	JJ	1
anti-iraq	anti-iraq	NNP	1
anti-islet	anti-islet	JJ	1
anti-ita	anti-ita	JJ	2
anti-itch	anti-itch	JJ	2
anti-jam	anti-jam	JJ	1
anti-karyopherin	anti-karyopherin	JJ	1
anti-kayak	anti-kayak	NNP	1
anti-kid	anti-kid	JJ	1
anti-lamin	anti-lamin	JJ	7
anti-lamins	anti-lamin	JJ	1
anti-language	anti-language	JJ	14
anti-language	anti-language	NNP	2
anti-languages	anti-language	NNP	1
anti-latent	anti-latent	NNP	1
anti-left	anti-left	JJ	1
anti-liberal	anti-liberal	JJ	1
anti-life	anti-life	JJ	1
anti-ligand	anti-ligand	JJ	1
anti-light	anti-light	JJ	1
anti-line-item	anti-line-item	JJ	1
anti-lipoic	anti-lipoic	JJ	3
anti-liquor	anti-liquor	JJ	1
anti-little	anti-little	JJ	1
anti-lock	anti-lock	JJ	2
anti-lock	anti-lock	NNP	1
anti-log	anti-log	JJ	1
anti-lottery	anti-lottery	JJ	1
anti-m	anti-m	JJ	2
anti-magnetized	anti-magnetized	JJ	1
anti-majoritarian	anti-majoritarian	JJ	1
anti-malarial	anti-malarial	JJ	15
anti-malarials	anti-malarial	JJ	5
anti-mandate	anti-mandate	JJ	1
anti-manipulation	anti-manipulation	NNP	3
anti-market	anti-market	JJ	4
anti-matches	anti-match	JJ	1
anti-materialistic	anti-materialistic	JJ	1
anti-math	anti-math	JJ	1
anti-matter	anti-matter	JJ	4
anti-me	anti-me	JJ	1
anti-media	anti-media	JJ	1
anti-meliorism	anti-meliorism	JJ	1
anti-meliorism	anti-meliorism	NNP	1
anti-meliorist	anti-meliorist	JJ	1
anti-meliorists	anti-meliorist	JJ	8
anti-microbial	anti-microbial	JJ	1
anti-middle	anti-middle	JJ	1
anti-military	anti-military	JJ	1
anti-militia	anti-militia	JJ	1
anti-mineralocorticoid	anti-mineralocorticoid	JJ	1
anti-miscegenation	anti-miscegenation	JJ	1
anti-missile	anti-missile	JJ	33
anti-missiles	anti-missile	JJ	2
anti-mitochondrial	anti-mitochondrial	NNP	1
anti-mitochondrial	anti-mitochondrial	JJ	1
anti-mitotic	anti-mitotic	JJ	1
anti-moisture	anti-moisture	JJ	1
anti-monarchists	anti-monarchist	JJ	1
anti-monarchy	anti-monarchy	JJ	1
anti-monopolistic	anti-monopolistic	JJ	1
anti-mosquito	anti-mosquito	JJ	1
anti-mouse	anti-mouse	JJ	117
anti-mouse	anti-mouse	NNP	2
anti-mugging	anti-mugging	JJ	1
anti-murine	anti-murine	JJ	7
anti-murine	anti-murine	NNP	1
anti-muscarinic	anti-muscarinic	JJ	8
anti-myc	anti-myc	JJ	8
anti-myocilin	anti-myocilin	JJ	2
anti-myosin	anti-myosin	JJ	1
anti-mystical	anti-mystical	JJ	1
anti-myth	anti-myth	JJ	1
anti-n	anti-n	JJ	1
anti-narcotics	anti-narcotic	JJ	1
anti-nationalist	anti-nationalist	JJ	1
anti-natural	anti-natural	JJ	1
anti-nausea	anti-nausea	JJ	1
anti-neoplastic	anti-neoplastic	JJ	2
anti-neoplastic	anti-neoplastic	NNP	1
anti-nerve	anti-nerve	JJ	1
anti-neurofilament	anti-neurofilament	JJ	1
anti-neurokinin	anti-neurokinin	JJ	2
anti-new	anti-new	JJ	1
anti-nipple	anti-nipple	JJ	1
anti-nmt	anti-nmt	NNP	1
anti-nociceptive	anti-nociceptive	JJ	1
anti-normative	anti-normative	JJ	1
anti-nuclear	anti-nuclear	JJ	2
anti-nuke	anti-nuke	JJ	1
anti-obesity	anti-obesity	JJ	3
anti-oestrogen	anti-oestrogen	JJ	1
anti-oestrogens	anti-oestrogen	NNP	1
anti-oil	anti-oil	JJ	1
anti-olivers	anti-oliver	JJ	1
anti-oncogene	anti-oncogene	JJ	1
anti-onomatopoeia	anti-onomatopoeia	JJ	1
anti-oppression	anti-oppression	JJ	1
anti-orange-vegetable	anti-orange-vegetable	JJ	1
anti-osteocalcin	anti-osteocalcin	JJ	2
anti-osteoclast	anti-osteoclast	JJ	1
anti-osteoclastogenic	anti-osteoclastogenic	JJ	6
anti-ovalbumin	anti-ovalbumin	JJ	2
anti-ownership	anti-ownership	JJ	1
anti-oxidant	anti-oxidant	JJ	2
anti-oxidants	anti-oxidant	JJ	1
anti-oxidation	anti-oxidation	JJ	1
anti-p	anti-p	JJ	13
anti-p	anti-p	NNP	1
anti-pain	anti-pain	JJ	1
anti-papacy	anti-papacy	JJ	1
anti-paparazzi	anti-paparazzi	JJ	1
anti-parallel	anti-parallel	JJ	2
anti-party	anti-party	JJ	1
anti-patriarchal	anti-patriarchal	JJ	1
anti-peace	anti-peace	JJ	3
anti-pedophile	anti-pedophile	JJ	1
anti-penton	anti-penton	JJ	1
anti-peptide	anti-peptide	JJ	7
anti-peptide	anti-peptide	NNP	1
anti-personnel	anti-personnel	JJ	5
anti-phantom	anti-phantom	JJ	1
anti-phospho	anti-phospho	JJ	13
anti-phospho-c-jun	anti-phospho-c-jun	JJ	2
anti-phospho-histone	anti-phospho-histone	JJ	1
anti-phospho-moesin	anti-phospho-moesin	JJ	1
anti-phospho-p	anti-phospho-p	JJ	5
anti-phospho-p	anti-phospho-p	NNP	1
anti-phospholipid	anti-phospholipid	JJ	1
anti-phosphorylated	anti-phosphorylated	JJ	5
anti-phosphorylated	anti-phosphorylated	NNP	1
anti-phosphoserine	anti-phosphoserine	JJ	1
anti-phosphotyrosine	anti-phosphotyrosine	JJ	11
anti-phosphotyrosine	anti-phosphotyrosine	NNP	1
anti-phthalate	anti-phthalate	JJ	2
anti-pimp	anti-pimp	JJ	1
anti-piracy	anti-piracy	JJ	2
anti-planned	anti-planned	JJ	1
anti-plasmin	anti-plasmin	JJ	1
anti-playoff	anti-playoff	JJ	1
anti-pledge	anti-pledge	JJ	3
anti-plushie	anti-plushie	JJ	1
anti-poker	anti-poker	JJ	4
anti-political	anti-political	JJ	1
anti-politician	anti-politician	JJ	1
anti-politics	anti-politic	JJ	1
anti-pollution	anti-pollution	JJ	3
anti-polysaccharide	anti-polysaccharide	JJ	1
anti-pop	anti-pop	JJ	1
anti-popular-culture	anti-popular-culture	JJ	1
anti-pork	anti-pork	JJ	2
anti-porn	anti-porn	JJ	1
anti-pornography	anti-pornography	JJ	5
anti-pot	anti-pot	JJ	1
anti-poverty	anti-poverty	JJ	14
anti-preference	anti-preference	JJ	1
anti-pregnancy	anti-pregnancy	JJ	1
anti-prejudice	anti-prejudice	JJ	1
anti-prenatal	anti-prenatal	JJ	2
anti-press	anti-press	JJ	3
anti-primary	anti-primary	JJ	1
anti-profilin	anti-profilin	JJ	2
anti-proinsulin	anti-proinsulin	JJ	1
anti-proliferation	anti-proliferation	JJ	1
anti-proliferationists	anti-proliferationist	JJ	1
anti-proliferative	anti-proliferative	JJ	14
anti-promotion	anti-promotion	JJ	1
anti-property	anti-property	JJ	1
anti-protectionism	anti-protectionism	JJ	1
anti-protein	anti-protein	JJ	1
anti-protons	anti-proton	JJ	2
anti-psychiatrists	anti-psychiatrist	JJ	1
anti-psychotic	anti-psychotic	JJ	1
anti-public-education	anti-public-education	JJ	1
anti-pyretic	anti-pyretic	JJ	3
anti-pyretics	anti-pyretic	JJ	5
anti-rabbit	anti-rabbit	JJ	73
anti-raccoon	anti-raccoon	JJ	1
anti-race	anti-race	JJ	1
anti-racialism	anti-racialism	JJ	1
anti-racism	anti-racism	JJ	3
anti-racist	anti-racist	JJ	7
anti-rape	anti-rape	JJ	1
anti-rat	anti-rat	JJ	18
anti-realist	anti-realist	JJ	1
anti-reform	anti-reform	JJ	2
anti-reggae	anti-reggae	JJ	1
anti-regulation	anti-regulation	JJ	3
anti-regulatory	anti-regulatory	JJ	3
anti-rejection	anti-rejection	JJ	3
anti-religious	anti-religious	JJ	6
anti-repression	anti-repression	JJ	1
anti-republican	anti-republican	JJ	1
anti-resorbing	anti-resorbing	JJ	3
anti-resorptive	anti-resorptive	JJ	3
anti-retaliation	anti-retaliation	NNP	1
anti-retaliation	anti-retaliation	JJ	1
anti-retroviral	anti-retroviral	JJ	7
anti-right	anti-right	JJ	2
anti-riot	anti-riot	JJ	1
anti-roll	anti-roll	JJ	4
anti-rotation	anti-rotation	JJ	1
anti-royal	anti-royal	JJ	1
anti-royalist	anti-royalist	JJ	5
anti-sanction	anti-sanction	JJ	1
anti-sarcospan	anti-sarcospan	JJ	1
anti-sassy	anti-sassy	JJ	1
anti-satire	anti-satire	JJ	1
anti-scalping	anti-scalping	JJ	1
anti-scanning	anti-scanning	JJ	1
anti-secession	anti-secession	JJ	1
anti-seizure	anti-seizure	JJ	3
anti-semantic	anti-semantic	JJ	1
anti-semite	anti-semite	JJ	1
anti-semitic	anti-semitic	JJ	1
anti-semitism	anti-semitism	JJ	3
anti-semitism	anti-semitism	NNP	1
anti-sense	anti-sense	JJ	18
anti-sense	anti-sense	NNP	2
anti-sera	anti-sera	JJ	3
anti-serotonergic	anti-serotonergic	JJ	1
anti-serum	anti-serum	JJ	4
anti-sex	anti-sex	JJ	2
anti-sheep	anti-sheep	JJ	3
anti-ship	anti-ship	JJ	3
anti-shredding	anti-shredding	JJ	1
anti-sigma	anti-sigma	JJ	1
anti-sin	anti-sin	JJ	1
anti-skid	anti-skid	JJ	1
anti-slavery	anti-slavery	JJ	3
anti-smoking	anti-smoking	JJ	22
anti-smoking	anti-smoking	NNP	3
anti-smooth	anti-smooth	JJ	1
anti-smuggling	anti-smuggling	JJ	1
anti-snakebite	anti-snakebite	JJ	1
anti-snarkiness	anti-snarkiness	JJ	1
anti-snore	anti-snore	JJ	1
anti-social	anti-social	JJ	22
anti-socialist	anti-socialist	JJ	1
anti-sodomy	anti-sodomy	JJ	6
anti-soy	anti-soy	JJ	4
anti-spectrin	anti-spectrin	JJ	2
anti-sprawl	anti-sprawl	JJ	1
anti-ss	anti-ss	JJ	1
anti-stalker	anti-stalker	JJ	1
anti-stalking	anti-stalking	JJ	2
anti-statism	anti-statism	JJ	1
anti-statist	anti-statist	JJ	1
anti-stereotype	anti-stereotype	JJ	1
anti-streptavidin	anti-streptavidin	JJ	3
anti-submarine	anti-submarine	JJ	2
anti-substance	anti-substance	JJ	1
anti-super	anti-super	JJ	1
anti-sweatshop	anti-sweatshop	JJ	2
anti-takeover	anti-takeover	JJ	1
anti-talent	anti-talent	JJ	2
anti-tank	anti-tank	JJ	4
anti-tax	anti-tax	JJ	16
anti-teacher	anti-teacher	JJ	1
anti-technological	anti-technological	JJ	1
anti-technology	anti-technology	JJ	2
anti-teen	anti-teen	JJ	1
anti-telemarketing	anti-telemarketing	JJ	1
anti-terror	anti-terror	JJ	6
anti-terror	anti-terror	NNP	2
anti-terrorism	anti-terrorism	JJ	40
anti-terrorism	anti-terrorism	NNP	1
anti-terrorist	anti-terrorist	JJ	21
anti-testimonials	anti-testimonial	JJ	1
anti-testosterone	anti-testosterone	JJ	1
anti-teuro	anti-teuro	JJ	1
anti-that	anti-that	JJ	1
anti-theft	anti-theft	JJ	1
anti-theophylline	anti-theophylline	JJ	10
anti-thrombin	anti-thrombin	JJ	1
anti-thrombotic	anti-thrombotic	JJ	1
anti-tiramisu	anti-tiramisu	JJ	4
anti-tobacco	anti-tobacco	JJ	19
anti-tobacco	anti-tobacco	NNP	2
anti-tobacco-company	anti-tobacco-company	JJ	1
anti-tobacconist	anti-tobacconist	JJ	1
anti-tobacconists	anti-tobacconist	JJ	6
anti-tobacconists	anti-tobacconist	NNP	1
anti-topoisomerase	anti-topoisomerase	JJ	2
anti-total	anti-total	JJ	3
anti-toxin	anti-toxin	JJ	2
anti-trade	anti-trade	JJ	2
anti-traditional	anti-traditional	JJ	1
anti-truancy	anti-truancy	JJ	2
anti-trust	anti-trust	JJ	24
anti-trypsin	anti-trypsin	JJ	3
anti-tuberculosis	anti-tuberculosis	JJ	4
anti-tuberculous	anti-tuberculous	JJ	1
anti-tubulin	anti-tubulin	JJ	2
anti-tumor	anti-tumor	JJ	46
anti-tumour	anti-tumour	JJ	2
anti-type	anti-type	JJ	4
anti-tyrosinase	anti-tyrosinase	JJ	1
anti-tyrosine	anti-tyrosine	JJ	1
anti-u	anti-u	JJ	1
anti-ubiquitin	anti-ubiquitin	JJ	2
anti-union	anti-union	JJ	7
anti-unionism	anti-unionism	JJ	1
anti-urban	anti-urban	JJ	2
anti-urban-poverty	anti-urban-poverty	JJ	1
anti-v	anti-v	JJ	1
anti-vamp	anti-vamp	JJ	2
anti-vampire	anti-vampire	JJ	1
anti-vengeance	anti-vengeance	JJ	1
anti-venom	anti-venom	JJ	4
anti-veto	anti-veto	JJ	1
anti-vibration	anti-vibration	JJ	1
anti-vimentin	anti-vimentin	JJ	1
anti-vinculin	anti-vinculin	JJ	1
anti-violence	anti-violence	JJ	3
anti-viral	anti-viral	JJ	4
anti-virus	anti-virus	JJ	8
anti-visible	anti-visible	JJ	1
anti-vivisectionist	anti-vivisectionist	JJ	1
anti-voucher	anti-voucher	JJ	2
anti-war	anti-war	JJ	32
anti-white	anti-white	JJ	5
anti-wilderness	anti-wilderness	JJ	1
anti-willey	anti-willey	NNP	1
anti-woman	anti-woman	JJ	1
anti-worker	anti-worker	JJ	1
anti-wrod	anti-wrod	NNP	1
anti-wrod	anti-wrod	JJ	1
antiabortion	antiabortion	NN	3
antiabortion	antiabortion	NNP	1
antiaircraft	antiaircraft	NN	9
antiallergic	antiallergic	JJ	1
antiamericanism	antiamericanism	NN	1
antiandrogen	antiandrogen	NN	6
antiandrogens	antiandrogen	NNS	3
antiangiogenic	antiangiogenic	JJ	1
antianxiety	antianxiety	NN	1
antiapoptotic	antiapoptotic	JJ	11
antiarrhythmics	antiarrhythmic	NNS	1
antiarthritic	antiarthritic	JJ	1
antiatherogenic	antiatherogenic	JJ	1
antibacterial	antibacterial	NN	20
antibacterials	antibacterial	NNS	3
antiballistic	antiballistic	NNP	1
antibeach	antibeach	NN	2
antibes	antibe	NNP	2
antibiograms	antibiogram	NNS	3
antibiosis	antibiosis	NNS	3
antibiotic	antibiotic	JJ	189
antibiotic	antibiotic	NN	47
antibiotic	antibiotic	NNP	13
antibiotic-antimycotic	antibiotic-antimycotic	JJ	3
antibiotic-free	antibiotic-free	JJ	2
antibiotic-mycotic	antibiotic-mycotic	JJ	1
antibiotic-resistance	antibiotic-resistance	JJ	1
antibiotic-resistant	antibiotic-resistant	JJ	9
antibiotics	antibiotic	NNS	363
antibiotics	antibiotic	NNP	21
antiblood	antiblood	NN	1
antibodies	antibody	NNS	1139
antibodies	antibody	NNP	67
antibody	antibody	NN	1390
antibody	antibody	NNP	30
antibody	antibody	UNC	1
antibody-amplification	antibody-amplification	JJ	1
antibody-antigen	antibody-antigen	JJ	1
antibody-associated	antibody-associated	JJ	1
antibody-based	antibody-based	JJ	3
antibody-biotin	antibody-biotin	JJ	1
antibody-bound	antibody-bound	JJ	2
antibody-bound	antibody-bound	NNP	1
antibody-coated	antibody-coated	JJ	1
antibody-coated-bead	antibody-coated-bead	JJ	1
antibody-coding	antibody-coding	JJ	1
antibody-conjugated	antibody-conjugated	JJ	1
antibody-conjugated-beads	antibody-conjugated-bead	JJ	1
antibody-containing	antibody-containing	JJ	1
antibody-directed	antibody-directed	NNP	1
antibody-drug	antibody-drug	JJ	1
antibody-enhanced	antibody-enhanced	JJ	4
antibody-enzyme	antibody-enzyme	JJ	1
antibody-matrix	antibody-matrix	JJ	2
antibody-mediated	antibody-mediated	JJ	1
antibody-protein	antibody-protein	NNP	1
antibody-related	antibody-related	JJ	1
antibody-stained	antibody-stained	JJ	1
antibody–antigen	antibody–antigen	NN	1
antibuddhist	antibuddhist	NN	1
antic	antic	JJ	4
antica	antica	NNP	3
antica	antica	UNC	1
anticancer	anticancer	NN	37
anticapitalism	anticapitalism	NN	1
anticapsular	anticapsular	NN	17
anticardiolipin	anticardiolipin	NN	1
anticarsia	anticarsium	NNP	1
antichaos	antichao	NNS	1
antichi	antichus	NNP	1
antichoice	antichoice	NN	2
anticholinergic	anticholinergic	JJ	6
antichrist	antichrist	NNP	75
antichrist	antichrist	NN	6
antichrist	antichrist	UNC	3
antichymotrypsin	antichymotrypsin	NN	2
antici	antici	JJ	1
antici	anticus	NN	1
anticipate	anticipate	VB	100
anticipate	anticipate	VBP	62
anticipate	anticipate	NNP	2
anticipated	anticipate	VBN	235
anticipated	anticipate	VBD	48
anticipated	anticipated	JJ	3
anticipated	anticipated	UNC	2
anticipates	anticipate	VBZ	28
anticipatethis	anticipatethi	NNS	1
anticipating	anticipate	VBG	81
anticipation	anticipation	NN	124
anticipation	anticipation	NNP	2
anticipation-making	anticipation-making	JJ	2
anticipations	anticipation	NNS	2
anticipatory	anticipatory	NN	7
anticlerical	anticlerical	JJ	2
anticlericalism	anticlericalism	NN	1
anticlimactic	anticlimactic	JJ	9
anticlimax	anticlimax	NN	11
antico	antico	NNP	1
anticoagulant	anticoagulant	NN	13
anticoagulant-treated	anticoagulant-treated	NNP	1
anticoagulant-treated	anticoagulant-treated	JJ	1
anticoagulated	anticoagulated	JJ	2
anticoagulation	anticoagulation	NN	6
anticodon	anticodon	NN	4
anticodon-codon	anticodon-codon	JJ	1
anticollagen	anticollagen	NN	8
anticollagen	anticollagen	NNP	1
anticollegio	anticollegio	NNP	1
anticolonial	anticolonial	NN	3
anticommunist	anticommunist	NN	3
anticompetitive	anticompetitive	JJ	3
anticomplementary	anticomplementary	JJ	1
anticonvulsant	anticonvulsant	NN	12
anticonvulsant	anticonvulsant	NNP	1
anticonvulsants	anticonvulsant	NNS	7
anticorrelated	anticorrelated	JJ	2
anticorrelation	anticorrelation	NN	3
anticorrelations	anticorrelation	NNS	3
anticorruption	anticorruption	NN	1
anticrime	anticrime	NN	1
antics	antics	NNS	57
antics	antics	NNP	2
anticyclic	anticyclic	NNP	1
anticytokine	anticytokine	NN	1
antideficiency	antideficiency	NNP	1
antidepressant	antidepressant	NN	34
antidepressants	antidepressant	NNS	22
antidepressants	antidepressant	NNP	1
antidepressents	antidepressent	NNS	1
antidepressive	antidepressive	JJ	1
antidevelopment	antidevelopment	NN	1
antidiabetic	antidiabetic	JJ	4
antidigoxigenin	antidigoxigenin	NN	1
antidisestablishmentarians	antidisestablishmentarian	NNS	2
antidiuretic	antidiuretic	JJ	3
antidody	antidody	NN	1
antidogmatic	antidogmatic	JJ	1
antidopaminergic	antidopaminergic	JJ	1
antidote	antidote	NN	46
antidote	antidote	NNP	2
antidotes	antidote	NNS	4
antidrug	antidrug	NN	2
antiedematogenic	antiedematogenic	JJ	1
antiekmarkt	antiekmarkt	NNP	2
antiemetic	antiemetic	JJ	1
antiemetics	antiemetic	NNS	2
antienviron	antienviron	NN	1
antienvironment	antienvironment	NN	1
antiepileptic	antiepileptic	JJ	1
antiepileptics	antiepileptic	NNS	1
antierosive	antierosive	JJ	4
antiestrogenic	antiestrogenic	JJ	2
antiestrogens	antiestrogen	NNS	4
antiestrogens	antiestrogen	NNP	1
antietam	antietam	NNP	4
antiethical	antiethical	JJ	2
antifade	antifade	NNP	5
antifade	antifade	NN	3
antiferromagnet	antiferromagnet	NN	6
antiferromagnetic	antiferromagnetic	JJ	2
antifibrogenic	antifibrogenic	JJ	1
antifibrotic	antifibrotic	JJ	2
antifolates	antifolate	NNS	1
antifraud	antifraud	NN	1
antifreeze	antifreeze	NN	9
antifreeze-like	antifreeze-like	JJ	1
antifungal	antifungal	NN	11
antifungals	antifungal	NNS	4
antiga	antiga	NNP	4
antigame	antigame	NNP	1
antiganglioside	antiganglioside	NN	1
antigay	antigay	NN	2
antigen	antigen	NN	396
antigen	antigen	NNP	21
antigen-antibody	antigen-antibody	NNP	5
antigen-antibody	antigen-antibody	JJ	3
antigen-binding	antigen-binding	JJ	1
antigen-challenged	antigen-challenged	JJ	1
antigen-coated	antigen-coated	JJ	2
antigen-containing	antigen-containing	JJ	1
antigen-dependent	antigen-dependent	JJ	1
antigen-depleted	antigen-depleted	JJ	1
antigen-driven	antigen-driven	JJ	3
antigen-enriched	antigen-enriched	JJ	1
antigen-free	antigen-free	JJ	1
antigen-induced	antigen-induced	JJ	18
antigen-presentation	antigen-presentation	JJ	1
antigen-presenting	antigen-presenting	JJ	19
antigen-processing	antigen-processing	JJ	1
antigen-receptor	antigen-receptor	JJ	2
antigen-retrieval	antigen-retrieval	JJ	1
antigen-selected	antigen-selected	JJ	1
antigen-specific	antigen-specific	JJ	31
antigen-specific	antigen-specific	NNP	2
antigen-unmasking	antigen-unmasking	NNP	1
antigenic	antigenic	JJ	55
antigenic	antigenic	NNP	2
antigenically	antigenically	RB	1
antigenicity	antigenicity	NN	4
antigenome	antigenome	NN	1
antigenomic	antigenomic	JJ	3
antigens	antigen	NNS	153
antigens	antigen	NNP	3
antiglobalist	antiglobalist	NN	1
antiglucocorticoid	antiglucocorticoid	NN	1
antiglur	antiglur	NN	1
antigoat	antigoat	NN	1
antigone	antigone	NNP	3
antigonus	antigonus	NNP	1
antigovernment	antigovernment	NN	2
antigravity	antigravity	NN	5
antigua	antigua	NNP	21
antigun	antigun	NN	1
antiguo	antiguo	NNP	1
antiguos	antiguo	NNP	1
antihaemorrhagic	antihaemorrhagic	JJ	1
antihepatocarcinogen	antihepatocarcinogen	NN	1
antihero	antihero	NN	3
antihistamine	antihistamine	NN	6
antihistamines	antihistamine	NNS	9
antihistamines	antihistamine	NNP	1
antihistimine	antihistimine	NN	1
antihuman	antihuman	NN	8
antihydrogen	antihydrogen	NN	1
antihyperlipidemic	antihyperlipidemic	JJ	1
antihyperlipidemic	antihyperlipidemic	NNP	1
antihypertensive	antihypertensive	JJ	26
antihypertensive	antihypertensive	NNP	3
antihypertensives	antihypertensive	NNS	2
antiinfectives	antiinfective	NNS	1
antiinflammatory	antiinflammatory	NN	11
antik	antik	NNP	1
antikenmuseum	antikenmuseum	NNP	1
antilabor	antilabor	NN	1
antilipoxigenase	antilipoxigenase	NN	1
antillean	antillean	NNP	2
antilles	antille	NNPS	27
antilock	antilock	NN	17
antilog	antilog	NN	2
antilogarithm-transformed	antilogarithm-transformed	JJ	1
antimacassar	antimacassar	NN	1
antimalaria	antimalarium	NN	2
antimalarial	antimalarial	NN	12
antimalarials	antimalarial	NNS	5
antimalarials	antimalarials	UNC	1
antimatter	antimatter	NN	15
antimetabolic	antimetabolic	JJ	1
antimetric	antimetric	JJ	2
antimicrobial	antimicrobial	NN	42
antimicrobial	antimicrobial	NNP	1
antimicrobials	antimicrobial	NNS	5
antimissile	antimissile	JJ	4
antimitotic	antimitotic	JJ	10
antimitotics	antimitotic	NNS	4
antimonial	antimonial	NNP	1
antimonos	antimono	NNS	1
antimony	antimony	NN	4
antimony	antimony	NNP	1
antimorphic	antimorphic	JJ	1
antimouse	antimouse	NN	8
antimurine	antimurine	NN	1
antimuscarinic	antimuscarinic	JJ	10
antimuscarinic	antimuscarinic	NNP	1
antimutator	antimutator	NN	5
antimycin	antimycin	NN	1
antimycotic	antimycotic	JJ	7
antimyosin	antimyosin	NN	1
antimyotoxic	antimyotoxic	JJ	1
antin	antin	NNP	2
antinatalist	antinatalist	NN	2
antineoplastic	antineoplastic	JJ	5
antineutrinos	antineutrino	NNS	1
antinociception	antinociception	NN	2
antinociceptive	antinociceptive	JJ	4
antinomian	antinomian	NN	1
antinomianism	antinomianism	NN	2
antinor	antinor	NNP	1
antinori	antinorus	NNP	4
antinuclear	antinuclear	NN	2
antinuclear	antinuclear	NNP	2
antioch	antioch	NNP	3
antiochus	antiochus	NNP	1
antioco	antioco	NNP	1
antioestrogen	antioestrogen	NN	1
antiopa	antiopa	NN	1
antioxidant	antioxidant	NN	78
antioxidant	antioxidant	NNP	2
antioxidant-free	antioxidant-free	JJ	1
antioxidants	antioxidant	NNS	58
antioxidants	antioxidant	NNP	1
antioxidative	antioxidative	JJ	2
antipain	antipain	NN	1
antiparallel	antiparallel	NN	11
antiparasitic	antiparasitic	JJ	4
antiparasitic	antiparasitic	NNP	1
antiparietal	antiparietal	NNP	1
antiparkinson	antiparkinson	NN	2
antiparkinsonian	antiparkinsonian	NN	3
antiparos	antiparo	NNP	7
antiparticles	antiparticle	NNS	1
antipasta	antipasta	NN	1
antipasti	antipastus	NN	1
antipathies	antipathy	NNS	1
antipathy	antipathy	NN	18
antipeptide	antipeptide	NNP	1
antiperinuclear	antiperinuclear	NN	1
antiperiplanar	antiperiplanar	NN	3
antipersonnel	antipersonnel	NN	1
antiperspirant	antiperspirant	NN	1
antiphase	antiphase	NN	1
antiphlogistic	antiphlogistic	JJ	1
antipholi	antipholus	NNP	1
antipholus	antipholus	NNP	6
antipholuses	antipholus	NNP	1
antiphospholipase	antiphospholipase	NN	2
antiphospholipid	antiphospholipid	NN	2
antiphosphotyrosine	antiphosphotyrosine	NNP	1
antipiracy	antipiracy	NN	1
antiplasmodial	antiplasmodial	NN	1
antiplatelet	antiplatelet	NN	4
antipneumococcal	antipneumococcal	NN	1
antipodean	antipodean	NNP	15
antipodean	antipodean	NN	3
antipodeans	antipodean	NNS	2
antipodeans	antipodean	NNP	2
antipollution	antipollution	NN	3
antipolyadp-ribose	antipolyadp-ribose	JJ	1
antiport	antiport	NN	2
antiporter	antiporter	NN	3
antipoverty	antipoverty	NN	4
antiprejudice	antiprejudice	NNP	1
antiprivatization	antiprivatization	NN	1
antiprogesterone	antiprogesterone	NN	1
antiprogestrone	antiprogestrone	NN	1
antiproliferative	antiproliferative	JJ	9
antiproteases	antiprotease	NNS	1
antiproteoglycan	antiproteoglycan	NN	1
antiproteolytic	antiproteolytic	JJ	1
antipruritic	antipruritic	JJ	1
antipsychotic	antipsychotic	JJ	14
antipsychotic	antipsychotic	NNP	2
antipsychotics	antipsychotic	NNS	5
antipyretic	antipyretic	JJ	1
antipyretics	antipyretic	NNS	1
antiquaille	antiquaille	NNP	1
antiquaires	antiquaire	NNP	1
antiquarian	antiquarian	NN	14
antiquarian	antiquarian	NNP	1
antiquarians	antiquarian	NNS	2
antiquaris	antiquari	NNP	2
antiquaris	antiquari	NNS	1
antiquated	antiquated	JJ	40
antiquatedness	antiquatedness	NNS	1
antique	antique	JJ	149
antique	antique	NNP	10
antique	antique	NN	6
antique-car-collecting	antique-car-collecting	JJ	1
antique-furnished	antique-furnished	NNP	1
antique-ish	antique-ish	JJ	2
antique-store	antique-store	JJ	2
antiqued	antiqued	JJ	1
antiquedress	antiquedress	NNS	2
antiques	antique	NNS	142
antiques	antique	NNPS	44
antiques	antique	NNP	3
antiques	antiques	UNC	1
antiques-collector	antiques-collector	JJ	1
antiques-column	antiques-column	NNP	2
antiques-column-bw	antiques-column-bw	NNP	1
antiques-hunter	antiques-hunter	JJ	1
antiques-lovers	antiques-lover	JJ	1
antiquey	antiquey	NN	1
antiquing	antique	VBG	1
antiquities	antiquity	NNS	29
antiquities	antiquity	NNP	7
antiquity	antiquity	NN	37
antiquity	antiquity	UNC	2
antiquus	antiquus	JJ	1
antirabbit	antirabbit	NN	4
antiracism	antiracism	NN	1
antiregulatory	antiregulatory	NN	1
antireligious	antireligious	JJ	3
antirepressor	antirepressor	NN	1
antirepressors	antirepressor	NNS	1
antiresorptive	antiresorptive	JJ	3
antiretroviral	antiretroviral	NN	126
antiretroviral	antiretroviral	NNP	6
antiretroviral-experienced	antiretroviral-experienced	JJ	10
antiretroviral-naïve	antiretroviral-naïve	JJ	12
antiretroviral-treated	antiretroviral-treated	JJ	1
antiretrovirals	antiretroviral	NNS	12
antirheu	antirheu	NN	1
antirheumatic	antirheumatic	JJ	12
antirrhinum	antirrhinum	NNP	1
antis	anti	NNS	2
antiscian	antiscian	NN	1
antiscientism	antiscientism	NN	2
antisedition	antisedition	NN	1
antisemitic	antisemitic	JJ	1
antisense	antisense	NN	265
antisense	antisense	NNP	15
antisense-expressing	antisense-expressing	JJ	2
antisense-induced	antisense-induced	JJ	1
antisense-infected	antisense-infected	JJ	3
antisense-mediated	antisense-mediated	JJ	3
antisense-orientation	antisense-orientation	JJ	1
antisense-strand	antisense-strand	JJ	2
antisense-transfected	antisense-transfected	JJ	4
antisepsis	antisepsis	NNS	1
antiseptic	antiseptic	JJ	17
antiseptic	antiseptic	NNP	1
antiseptically	antiseptically	RB	2
antiseptics	antiseptic	NNS	1
antisera	antisera	NN	42
antisera	antisera	NNP	4
antiserum	antiserum	NN	65
antiserum	antiserum	NNP	3
antises	antises	NN	1
antisex	antisex	NN	1
antisexist	antisexist	NN	2
antislavery	antislavery	NN	1
antismog	antismog	NN	2
antismoking	antismoke	VBG	2
antisociable	antisociable	JJ	1
antisocial	antisocial	JJ	19
antisocial	antisocial	NNP	5
antistatism	antistatism	NNP	1
antistáseos	antistáseos	NNP	2
antisupporters	antisupporter	NNS	1
antitank	antitank	NN	6
antitax	antitax	NN	4
antitermination	antitermination	NN	2
antiterrorism	antiterrorism	NN	9
antiterrorism	antiterrorism	NNP	3
antiterrorist	antiterrorist	NN	2
antithesis	antithesis	NNS	28
antithetical	antithetical	JJ	12
antithetically	antithetically	RB	1
antithrombin	antithrombin	NN	7
antithrombotic	antithrombotic	JJ	7
antithyroid	antithyroid	NN	3
antithyroid	antithyroid	NNP	2
antitobacco	antitobacco	NN	1
antitrade	antitrade	NN	1
antitrust	antitrust	JJ	247
antitrust	antitrust	NNP	10
antitrust	antitrust	UNC	1
antitrypsin	antitrypsin	NN	3
antituberculous	antituberculous	JJ	1
antitumor	antitumor	NN	21
antitumoral	antitumoral	NN	1
antitumour	antitumour	NN	1
antitussives	antitussive	NNS	1
antivenin	antivenin	NN	2
antivenom	antivenom	NNP	1
antiviral	antiviral	JJ	74
antiviral	antiviral	NNP	4
antiviral-resistant	antiviral-resistant	JJ	1
antivirals	antiviral	NNS	6
antivirus	antivirus	JJ	2
antiwar	antiwar	NN	16
antiwar	antiwar	NNP	1
antiwoman	antiwoman	NN	1
antizyme	antizyme	NN	4
anti­democratic	anti­democratic	JJ	1
anti–cleaved	anti–cleaved	JJ	1
antje	antje	NNP	1
antler	antler	NN	4
antler	antler	NNP	2
antler-topped	antler-topped	JJ	2
antlered	antlered	JJ	1
antlers	antler	NNS	15
antley	antley	NNP	2
antognini	antogninus	NNP	2
antoine	antoine	NNP	24
antoinette	antoinette	NNP	30
anton	anton	NNP	19
antona	antona	NNP	1
antonacci	antonaccus	NNP	1
antone	antone	NNP	2
antonelli	antonellus	NNP	3
antonelliana	antonelliana	NNP	1
antonello	antonello	NNP	2
antoni	antonus	NNP	26
antonia	antonium	NNP	20
antonie	antonie	NNP	1
antoniesbreestraat	antoniesbreestraat	NNP	2
antonin	antonin	NNP	25
antonine	antonine	NNP	2
antoninus	antoninus	NNP	1
antonio	antonio	NNP	378
antonio-based	antonio-based	NNP	1
antonioni	antonionus	NNP	1
antonius	antonius	NNP	1
antonovich	antonovich	NNP	5
antonucci	antonuccus	NNP	1
antony	antony	NNP	26
antonym	antonym	NN	3
antonyms	antonym	NNS	3
antonyms	antonym	NNP	1
antoní	antoní	NNP	1
antopocerus	antopocerus	JJ	1
antosh	antosh	NNP	2
antowain	antowain	NNP	4
antp	antp	NNP	8
antproof	antproof	NNP	1
antral	antral	NN	17
antral	antral	NNP	1
antrim	antrim	NNP	1
antron	antron	NNP	1
antropología	antropología	NNP	1
antrum	antrum	NN	1
ants	ant	NNS	71
ants	ant	NNP	7
ants	ants	UNC	1
antsy	antsy	JJ	14
antuna	antuna	NNP	1
antunes	antune	NNP	1
antwaan	antwaan	NNP	1
antwerp	antwerp	NNP	6
antwerp	antwerp	UNC	1
antwoine	antwoine	NNP	1
antz	antz	NNP	6
antónia	antónia	NNP	1
antónio	antónio	NNP	17
antônio	antônio	NNP	1
anu	anu	NNP	5
anubis	anubi	NNS	1
anubis	anubi	NNP	1
anuff	anuff	NNP	5
anuk	anuk	NNP	1
anumber	anumber	NN	1
anumber	anumber	NNP	1
anunciada	anunciada	NNP	1
anup	anup	NNP	1
anuradha	anuradha	NNP	1
anurans	anuran	NNS	1
anuria	anurium	NN	1
anus	anus	JJ	7
anus	anus	NNP	3
anuses	anus	NNS	2
anusol	anusol	NNP	1
anv	anv	NNP	1
anvers	anver	NNP	1
anvil	anvil	NN	20
anvil	anvil	NNP	5
anvil-heavy	anvil-heavy	NNP	1
anvilicious	anvilicious	JJ	6
anviliscious	anviliscious	JJ	1
anvillery	anvillery	NN	1
anvillicious	anvillicious	JJ	1
anvillicious	anvillicious	NNP	1
anvilling	anvill	VBG	1
anvilly	anvilly	RB	8
anvils	anvil	NNS	11
anvils	anvil	NNP	3
anwar	anwar	NNP	23
anway	anway	NNP	4
anwer	anwer	NN	1
anwering	anwer	VBG	1
anwr	anwr	NNP	11
anx	anx	NNP	2
anx	anx	NN	1
anxieties	anxiety	NNS	50
anxieties	anxiety	NNP	1
anxiety	anxiety	NN	350
anxiety	anxiety	NNP	2
anxiety	anxiety	UNC	1
anxiety-booster	anxiety-booster	JJ	1
anxiety-filled	anxiety-filled	JJ	1
anxiety-free	anxiety-free	JJ	1
anxiety-inducing	anxiety-inducing	JJ	1
anxiety-making	anxiety-making	JJ	2
anxiety-provoking	anxiety-provoking	JJ	1
anxiety-reducing	anxiety-reducing	JJ	1
anxiety-reliever	anxiety-reliever	JJ	1
anxiety-ridden	anxiety-ridden	JJ	3
anxiolytic	anxiolytic	JJ	2
anxiolytics	anxiolytic	NNS	2
anxiolytics	anxiolytic	NNP	1
anxious	anxious	JJ	238
anxious	anxious	NNP	1
anxiously	anxiously	RB	29
any	any	DT	21806
any	any	RB	79
any	any	NNP	39
any	any	UNC	34
any	any	NN	5
any-angled	any-angled	JJ	1
any-kind-of-adjective	any-kind-of-adjective	JJ	1
any-where	any-where	JJ	1
anya	anya	NNP	559
anya	anya	NN	1
anya	anya	UNC	1
anya-centric	anya-centric	NNP	1
anya-slaggage	anya-slaggage	NNP	1
anyaka	anyaka	NNP	1
anyang	anyang	NNP	3
anyangiles	anyangile	NNP	1
anyanka	anyanka	NNP	6
anyankah	anyankah	NNP	1
anyar	anyar	NNP	1
anyas	anya	NNP	3
anybody	anybody	NN	1427
anybody	anybody	UNC	4
anybody	anybody	NNP	4
anychanges	anychange	NNS	1
anyday	anyday	NN	3
anyexisting	anyexist	VBG	1
anyhitng	anyhitng	NN	2
anyhoo	anyhoo	NNP	4
anyhoo	anyhoo	NN	2
anyhow	anyhow	RB	133
anyhow	anyhow	NNP	30
anyhow	anyhow	UNC	2
anymooooooore	anymooooooore	NN	1
anymore	anymore	RB	1463
anymore	anymore	NNP	13
anymore	anymore	UNC	6
anyohe	anyohe	NN	1
anyone	anyone	NN	4089
anyone	anyone	NNP	16
anyone	anyone	UNC	14
anyone-black	anyone-black	JJ	1
anyones	anyone	NNS	1
anyother	anyother	NN	1
anyplace	anyplace	RB	28
anysing	anyse	VBG	1
anystandard	anystandard	NN	1
anyt	anyt	NN	1
anyth	anyth	NN	3
anythign	anythign	NN	1
anythin	anythin	NN	1
anything	anything	NN	7755
anything	anything	NNP	19
anything	anything	UNC	16
anything	anything	JJ	1
anything-as	anything-a	JJ	1
anything-goes	anything-go	JJ	5
anythings	anything	NNS	1
anythng	anythng	NN	1
anythoing	anytho	VBG	1
anytime	anytime	RB	234
anytime	anytime	NNP	17
anytime	anytime	UNC	1
anyting	anyte	VBG	1
anytone	anytone	NN	1
anytown	anytown	NNP	2
anyutility	anyutility	NN	2
anywaaan	anywaaan	NN	1
anyway	anyway	RB	3464
anyway	anyway	UNC	18
anyway	anyway	NNP	7
anyway	anyway	JJ	4
anyways	anyway	NNS	68
anyways	anyway	NNP	5
anywhere	anywhere	RB	916
anywhere	anywhere	NNP	20
anywhere	anywhere	UNC	2
anywhere	anywhere	NN	1
anywho	anywho	NNP	1
anywhoo	anywhoo	NNP	1
anywhoo	anywhoo	NN	1
anzac	anzac	NNP	2
anzacs	anzac	NNP	1
anzaisho	anzaisho	NNP	1
anzak	anzak	NNP	1
anzio	anzio	NNP	1
an­cient	an­cient	NN	1
anís	anís	NNS	4
anís	anís	NNP	1
anógia	anógia	NNP	4
anópoli	anópoli	NNP	1
ao	ao	NNP	17
aoa	aoa	NN	2
aoa	aoa	NNP	1
aoac	aoac	NNP	3
aoanet	aoanet	NNP	1
aobut	aobut	NN	2
aod	aod	NNP	4
aof	aof	NNP	1
aoh	aoh	NNP	1
aoi	aous	NNP	1
aoife	aoife	NNP	1
aoki	aokus	NNP	3
aol	aol	NNP	713
aol	aol	NN	18
aol	aol	UNC	3
aol-ads	aol-ad	NNP	4
aol-albrecht	aol-albrecht	NNP	4
aol-albrect	aol-albrect	NNP	1
aol-case	aol-case	NNP	2
aol-earnings	aol-earning	NNP	4
aol-kellner	aol-kellner	NNP	1
aol-merge-assess	aol-merge-assess	NNP	1
aol-microsoft-sony-clear	aol-microsoft-sony-clear	NNP	2
aol-moore	aol-moore	NNP	2
aol-next	aol-next	NNP	3
aol-the-corporation	aol-the-corporation	NNP	1
aol-time	aol-time	NNP	13
aol-time-moore	aol-time-moore	NNP	3
aol-time-scene	aol-time-scene	NNP	2
aol-turmoil	aol-turmoil	NNP	3
aol-type	aol-type	NNP	1
aols	aol	NNP	1
aoltw	aoltw	NNP	3
aon	aon	NNP	18
aon	aon	NN	1
aoolw	aoolw	NN	1
aopa	aopa	NNP	1
aor	aor	NNP	7
aor	aor	NN	5
aord	aord	NN	5
aordable	aordable	JJ	2
aorded	aorded	JJ	1
aords	aord	NNS	3
aors	aor	NNP	1
aort	aort	NN	1
aorta	aorta	NN	43
aortas	aorta	NNS	15
aortic	aortic	JJ	46
aortic	aortic	NNP	3
aorticbanding	aorticband	VBG	1
aortocaval	aortocaval	NN	3
aoshima	aoshima	NNP	2
aosta	aosta	NNP	2
aot	aot	NNP	1
aotc	aotc	NNP	1
aotm	aotm	NNP	1
aotus	aotus	NNP	1
aoua	aoua	NNP	1
aoud	aoud	NN	1
aout	aout	NN	2
aovca	aovca	NNP	1
aow	aow	NNP	1
aoyama	aoyama	NNP	2
août	août	NNP	1
ap	ap	NNP	418
ap	ap	NN	24
ap-dna	ap-dna	NNP	1
ap-endonucleases	ap-endonuclease	NNP	1
ap-induced	ap-induced	NNP	2
ap-inhibition	ap-inhibition	NNP	1
ap-pcr	ap-pcr	NNP	1
ap-ph	ap-ph	NNP	4
ap-sensitive	ap-sensitive	NNP	2
ap-site	ap-site	NNP	2
ap-treated	ap-treated	NNP	1
apa	apa	NNP	36
apace	apace	NN	16
apace	apace	UNC	1
apache	apache	NNP	191
apache	apache	NN	2
apache-ii	apache-ius	NNP	3
apacheii	apacheius	NNP	1
apaches	apach	NNP	24
apachú	apachú	NN	1
apaf	apaf	NNP	15
apah	apah	NNP	1
apai	apaus	NNP	6
apair	apair	NNP	1
apak	apak	NNP	1
apalachi	apalachus	NNP	1
apalled	apalled	JJ	2
apalling	apall	VBG	1
apalrc	apalrc	NNP	2
apaprently	apaprently	RB	1
apaprently	apaprently	NNP	1
aparent	aparent	NN	1
aparicio	aparicio	NNP	5
apariciones	aparicione	NNP	1
aparición	aparición	NNP	1
apart	apart	RB	869
apart	apart	RP	34
apart	apart	UNC	7
apart	apart	NNP	2
apart-about	apart-about	JJ	1
apartheid	apartheid	NN	37
apartheid	apartheid	NNP	3
apartheid-era	apartheid-era	JJ	5
apartheid-era	apartheid-era	NNP	1
apartheid-like	apartheid-like	JJ	1
aparthotel	aparthotel	NNP	1
apartment	apartment	NN	1143
apartment	apartment	NNP	10
apartment	apartment	JJ	2
apartment	apartment	UNC	2
apartment-block	apartment-block	JJ	1
apartment-finding	apartment-finding	JJ	1
apartment-haver	apartment-haver	JJ	1
apartment-mate	apartment-mate	JJ	1
apartment-private	apartment-private	JJ	1
apartmented	apartmented	JJ	2
apartmenti	apartmentus	NN	1
apartmentma	apartmentma	NN	1
apartments	apartment	NNS	249
apartments	apartment	NNP	25
apartments	apartments	JJ	2
apartments	apartments	UNC	1
apartness	apartness	NNS	2
apart­ments	apart­ments	NNS	1
apathetic	apathetic	JJ	16
apathy	apathy	NN	44
apathy	apathy	NNP	5
apattern	apattern	NN	1
apb	apb	NNP	3
apba	apba	NNP	58
apc	apc	NNP	66
apc-resistant	apc-resistant	NNP	1
apcs	apc	NNP	21
apd	apd	NNP	2
ape	ape	NNP	57
ape	ape	NN	43
ape-man	ape-man	JJ	1
apear	apear	NN	1
apec	apec	NNP	3
aped	aped	JJ	2
apeiis	apeii	NNP	1
apelike	apelike	NN	2
apellation	apellation	NNP	1
apennine	apennine	NNP	2
apennines	apennine	NNP	8
aper	aper	NN	1
apercu	apercu	NN	1
apercus	apercus	JJ	1
apergillus	apergillus	NNP	1
aperiodic	aperiodic	JJ	10
aperiodicity	aperiodicity	NN	2
aperitif	aperitif	NN	7
aperitifs	aperitif	NNS	2
apermaking	apermake	VBG	1
aperta	aperta	NNP	4
aperteneth	aperteneth	NN	1
aperture	aperture	NN	7
apertures	aperture	NNS	2
aperçu	aperçu	NN	1
aperçus	aperçus	JJ	3
apes	ape	NNS	48
apes	ape	NNP	30
apes	apes	UNC	1
apeshit	apeshit	NN	5
apet	apet	NNP	1
apetite	apetite	NN	1
apex	apex	NN	56
apex	apex	NNP	5
apf	apf	NNP	10
apgar	apgar	NNP	3
apgars	apgar	NNP	1
aph	aph	NN	12
aph	aph	NNP	2
apha	apha	NNP	7
aphaease	aphaease	NNP	1
aphaia	aphaium	NNP	1
aphasia	aphasia	NN	6
aphasic	aphasic	JJ	1
aphasics	aphasic	NNS	1
apheresis	apheresis	NNS	10
aphetic	aphetic	JJ	1
aphid	aphid	NN	19
aphidicola	aphidicolum	NN	3
aphidoidea	aphidoidea	NNP	1
aphids	aphid	NNS	13
aphids	aphid	NNP	1
aphis	aphis	NNP	49
apholate	apholate	NN	2
aphorism	aphorism	NN	11
aphorisms	aphorism	NNS	6
aphorist	aphorist	NN	1
aphra	aphra	NNP	1
aphrenia	aphrenium	NN	2
aphrodesiac	aphrodesiac	NNP	1
aphrodisac	aphrodisac	NNP	1
aphrodisiac	aphrodisiac	NN	16
aphrodisiac	aphrodisiac	NNP	1
aphrodisiacal	aphrodisiacal	NN	1
aphrodisiacs	aphrodisiac	NNS	2
aphrodisias	aphrodisia	NNP	1
aphrodite	aphrodite	NNP	11
aphronesia	aphronesium	NN	2
aphthong	aphthong	NN	1
api	api	NNP	2
api	apus	NNP	25
apiaceae	apiacea	NNP	2
apical	apical	JJ	75
apical-basal	apical-basal	JJ	1
apically	apically	RB	4
apicomplexa	apicomplexa	NNP	1
apicomplexan	apicomplexan	NNP	3
apicomplexans	apicomplexan	NNS	2
apiculture	apiculture	NN	1
apiece	apiece	RB	42
apiece	apiece	UNC	2
apigenin	apigenin	NN	1
apilim	apilim	NN	1
apin	apin	NNP	2
aping	ape	VBG	6
apired	apired	JJ	1
apis	api	NNP	12
apita	apita	NN	1
apiñar	apiñar	NN	1
apl	apl	NNP	3
aplace	aplace	NN	1
aplasia	aplasium	NN	11
aplastic	aplastic	JJ	6
aplenty	aplenty	JJ	9
apley	apley	NNP	1
apliplations	apliplation	NNS	1
aplogise	aplogise	NN	1
aplomb	aplomb	NN	17
aplomb	aplomb	NNP	1
aplp	aplp	NNP	1
aplysia	aplysium	NNP	6
aplysia	aplysium	NN	2
apma	apma	NN	1
apn	apn	NNP	57
apn-containing	apn-containing	NNP	1
apn-sized	apn-sized	NNP	1
apnea	apnea	NN	6
apnea-hypopnea	apnea-hypopnea	JJ	1
apneas	apnea	NNS	1
apnoea	apnoea	NN	1
apns	apn	NNP	4
apnsa-designate	apnsa-designate	NNP	1
apo	apo	NNP	14
apo	apo	NN	2
apo-titin	apo-titin	JJ	1
apo-transferrin	apo-transferrin	JJ	1
apoa	apoa	NNP	10
apoa	apoa	NN	3
apoaiv	apoaiv	NNP	2
apoalert	apoalert	NNP	1
apob	apob	NN	3
apob	apob	NNP	3
apobec	apobec	NNP	19
apoc	apoc	NNP	8
apocaclypse	apocaclypse	NNP	1
apocaclyspe	apocaclyspe	NNP	1
apocali	apocalus	NN	3
apocalii	apocalius	NN	1
apocalpyse	apocalpyse	NNP	1
apocalpyse	apocalpyse	NN	1
apocalyi	apocalyus	NNP	1
apocalypse	apocalypse	NN	103
apocalypse	apocalypse	NNP	98
apocalypse	apocalypse	UNC	1
apocalypse-awaiters	apocalypse-awaiter	JJ	1
apocalypse-causing	apocalypse-causing	JJ	2
apocalypse-defender	apocalypse-defender	JJ	1
apocalypse-nowish	apocalypse-nowish	JJ	1
apocalypse-tipping	apocalypse-tipping	NNP	1
apocalypses	apocalypse	NNS	7
apocalypses	apocalypse	NNP	4
apocalypsey	apocalypsey	NN	1
apocalypsi	apocalypsus	NN	1
apocalypsi	apocalypsus	NNP	1
apocalypsim	apocalypsim	NNP	1
apocalypso	apocalypso	NNP	3
apocalypso	apocalypso	NN	1
apocalypsos	apocalypso	NNP	2
apocalypsy	apocalypsy	NN	2
apocalyptae	apocalypta	NN	1
apocalyptae	apocalypta	NNP	1
apocalyptarian	apocalyptarian	NNP	1
apocalyptarians	apocalyptarian	NNP	1
apocalypti	apocalyptus	NN	3
apocalyptic	apocalyptic	JJ	62
apocalyptic	apocalyptic	NNP	5
apocalyptically	apocalyptically	RB	1
apocalypting	apocalypt	VBG	1
apocalyses	apocalyse	NNS	1
apocalysi	apocalysus	NN	2
apocalysis	apocalysis	NNS	1
apocawhatsis	apocawhatsis	NNS	1
apochryphal	apochryphal	NN	1
apoclaypse	apoclaypse	NNP	2
apocofashionlypse	apocofashionlypse	NN	1
apocol	apocol	NN	1
apocolaypse	apocolaypse	NNP	1
apocolypse	apocolypse	NNP	7
apocolypse	apocolypse	NN	1
apocolypses	apocolypse	NNS	1
apocolypsii	apocolypsius	NN	2
apocolyptic	apocolyptic	JJ	1
apocolyptic	apocolyptic	NNP	1
apocolyptimus	apocolyptimus	JJ	2
apocopated	apocopated	JJ	1
apocrine	apocrine	NN	1
apocrypha	apocrypha	NN	5
apocryphal	apocryphal	NN	14
apod	apod	NNP	3
apodictically	apodictically	RB	1
apodosis	apodosis	NNS	1
apoe	apoe	NNP	24
apoe	apoe	NN	7
apogee	apogee	NN	7
apolar	apolar	NN	3
apolcalyptic	apolcalyptic	JJ	1
apolipoprotein	apolipoprotein	NN	28
apolipoprotein	apolipoprotein	NNP	6
apolipoproteins	apolipoprotein	NNS	5
apolipoproteins	apolipoprotein	NNP	1
apolitcal	apolitcal	NN	1
apolitical	apolitical	JJ	18
apollinaire	apollinaire	NNP	4
apollinare	apollinare	NNP	2
apollinaris	apollinari	NNP	2
apollo	apollo	NNP	145
apollo-fucked	apollo-fucked	NNP	1
apollo-like	apollo-like	NNP	1
apollodataadapteri	apollodataadapterus	NNP	1
apollon	apollon	NNP	6
apollonia	apollonium	NNP	2
apollonian	apollonian	NNP	11
apollonians	apollonian	NNP	1
apollyon	apollyon	NNP	1
apologetic	apologetic	JJ	31
apologetic	apologetic	NNP	3
apologetically	apologetically	RB	7
apologetics	apologetics	NNS	2
apologia	apologium	NN	10
apologia	apologium	NNP	1
apologies	apology	NNS	92
apologies	apology	NNP	22
apologise	apologise	NN	23
apologised	apologised	JJ	6
apologist	apologist	NN	17
apologist	apologist	NNP	1
apologists	apologist	NNS	15
apologists	apologist	NNP	1
apologize	apologize	VB	231
apologize	apologize	UNC	3
apologize	apologize	NNP	1
apologized	apologize	VBD	105
apologizes	apologize	VBZ	28
apologizes	apologize	NNP	1
apologizing	apologize	VBG	52
apology	apology	NN	262
apology	apology	NNP	8
apology	apology	UNC	2
apology	apology	JJ	1
apology-strewn	apology-strewn	JJ	2
apomorphine	apomorphine	NN	1
apophyseal	apophyseal	NN	3
apoplast	apoplast	NN	3
apoplastic	apoplastic	JJ	8
apoplasts	apoplast	NNS	1
apoplectic	apoplectic	JJ	11
apoplexy	apoplexy	NN	6
apoprotein	apoprotein	NN	4
apoproteins	apoprotein	NNS	2
apoptag	apoptag	NNP	4
apoptogenic	apoptogenic	JJ	3
apoptose	apoptose	NN	2
apoptosis	apoptosis	NNS	842
apoptosis	apoptosis	NNP	48
apoptosis-associated	apoptosis-associated	NNP	1
apoptosis-associated	apoptosis-associated	JJ	1
apoptosis-derived	apoptosis-derived	JJ	1
apoptosis-inducing	apoptosis-inducing	JJ	5
apoptosis-regulating	apoptosis-regulating	JJ	2
apoptosis-regulatory	apoptosis-regulatory	JJ	1
apoptosis-related	apoptosis-related	JJ	4
apoptosis-resistance	apoptosis-resistance	JJ	1
apoptosisby	apoptosisby	NN	1
apoptosisin	apoptosisin	NN	2
apoptosisis	apoptosisis	NNS	1
apoptosisof	apoptosisof	NN	1
apoptotic	apoptotic	JJ	243
apoptotic	apoptotic	NNP	17
apoptotic-inducing	apoptotic-inducing	JJ	1
apoptotic-like	apoptotic-like	JJ	2
apoptotic-positive	apoptotic-positive	JJ	1
apoptotic-signaling	apoptotic-signaling	JJ	1
apoptotically	apoptotically	RB	1
apoptoticcells	apoptoticcell	NNS	1
apoptoticmyocytes	apoptoticmyocyte	NNS	1
apoptygma	apoptygma	NNP	2
aposelene	aposelene	NN	2
aposelenium	aposelenium	NN	2
apositive	apositive	JJ	1
apossibly	apossibly	NNP	1
aposta	aposta	NNP	2
apostain	apostain	NNP	2
apostasies	apostasy	NNS	1
apostasy	apostasy	NN	14
apostate	apostate	NN	7
apostate	apostate	NNP	3
apostates	apostate	NNS	3
apostil	apostil	NN	1
apostle	apostle	NNP	34
apostle	apostle	NN	14
apostle	apostle	UNC	1
apostles	apostle	NNS	15
apostles	apostle	NNP	15
apostolate	apostolate	NNP	1
apostolic	apostolic	NNP	4
apostolic	apostolic	JJ	2
apostolical	apostolical	JJ	2
apostoloi	apostolous	NNP	1
apostrophe	apostrophe	NN	22
apostrophe	apostrophe	NNP	1
apostrophes	apostroph	NNS	11
apotag	apotag	NNP	1
apothecaries	apothecary	NNS	3
apothecary	apothecary	JJ	3
apothecary	apothecary	NNP	1
apothegm	apothegm	NN	1
apotheosis	apotheosis	NNS	20
apotheosis	apotheosis	NNP	1
apoyo	apoyo	NNP	1
app	app	NNP	75
app	app	NN	31
app-fd	app-fd	NNP	1
app-like	app-like	NNP	3
appa	appa	NNP	1
appalachia	appalachium	NNP	10
appalachian	appalachian	NNP	45
appalachian	appalachian	NN	1
appalachians	appalachian	NNP	9
appaling	appale	VBG	1
appall	appall	NN	6
appall	appall	NNP	1
appall-worthy	appall-worthy	JJ	1
appalled	appall	VBN	124
appalled	appalled	UNC	2
appalled	appalled	JJ	2
appalled	appalled	NNP	1
appalling	appalling	JJ	90
appalling	appalling	NNP	4
appalling	appalling	UNC	1
appallingly	appallingly	RB	12
appallingly	appallingly	NNP	1
appalls	appall	NNS	5
appalls	appalls	UNC	1
appaloosa	appaloosa	NNP	1
appaloosas	appaloosa	NNS	1
appalred	appalred	NNP	3
appar	appar	NN	1
apparantly	apparantly	NNP	2
apparantly	apparantly	RB	1
apparatchik	apparatchik	NN	12
apparatchiks	apparatchik	NNS	4
apparate	apparate	NN	1
apparatii	apparatius	NN	1
apparatus	apparatus	NN	163
apparatus	apparatus	NNP	19
apparatus	apparatus	UNC	3
apparatuses	apparatus	NNS	3
appareance	appareance	NN	1
apparel	apparel	NN	384
apparel	apparel	NNP	18
apparel	apparel	UNC	2
apparel-consumption	apparel-consumption	JJ	1
apparel-maker	apparel-maker	JJ	5
apparel-makers	apparel-maker	JJ	15
apparel-makers	apparel-maker	NNP	1
apparel-making	apparel-making	JJ	1
apparent	apparent	JJ	1021
apparent	apparent	NNP	10
apparent	apparent	UNC	1
apparentl	apparentl	NN	1
apparentlly	apparentlly	NNP	1
apparently	apparently	RB	2218
apparently	apparently	UNC	17
apparently	apparently	NNP	1
apparently-dissipating	apparently-dissipating	JJ	1
apparition	apparition	NN	21
apparition	apparition	NNP	1
apparitional	apparitional	NN	1
apparitions	apparition	NNS	16
apparrent	apparrent	NN	1
appartamenti	appartamentus	NNP	1
appartements	appartement	NNP	1
appartment	appartment	NN	1
apparuit	apparuit	NN	1
appeaerance	appeaerance	NN	1
appeal	appeal	NN	692
appeal	appeal	VB	241
appeal	appeal	VBP	26
appeal	appeal	UNC	6
appeal	appeal	NNP	4
appealed	appeal	VBD	71
appealed	appeal	VBN	29
appealing	appeal	VBG	327
appealing	appealing	UNC	1
appealingly	appealingly	RB	10
appealling	appealle	VBG	2
appeals	appeal	NNS	302
appeals	appeal	NNPS	136
appeals	appeal	NNP	7
appeals	appeals	UNC	1
appeals-court	appeals-court	NN	1
appear	appear	VB	1142
appear	appear	VBP	859
appear	appear	UNC	5
appear	appear	NNP	3
appear-at	appear-at	JJ	1
appearance	appearance	NN	937
appearance	appearance	NNP	7
appearance	appearance	UNC	3
appearance-obsessed	appearance-obsessed	JJ	1
appearances	appearance	NNS	209
appearances	appearance	NNP	6
appearances	appearances	UNC	1
appearance–	appearance–	NN	1
appearance–reality	appearance–reality	NN	2
appeard	appeard	NN	2
appeared	appear	VBD	1361
appeared	appear	VBN	155
appeared	appeared	UNC	2
appearence	appearence	NN	4
appearences	appearence	NNS	4
appearing	appear	VBG	263
appearing	appearing	NNP	26
appears	appear	VBZ	2085
appears	appear	NNS	24
appears	appear	NNP	3
appears	appears	UNC	4
appease	appease	VB	41
appeased	appease	VBD	8
appeased	appeased	NNP	1
appeasement	appeasement	NN	18
appeasement	appeasement	NNP	2
appeasers	appeaser	NNS	1
appeases	appease	NNS	4
appeasing	appease	VBG	12
appeasing	appeasing	NNP	2
appel	appel	NNP	2
appelation	appelation	NN	2
appelbaum	appelbaum	NNP	3
appelbome	appelbome	NNP	1
appelfeld	appelfeld	NNP	3
appellants	appellant	NNP	2
appellants	appellant	NNS	1
appellate	appellate	JJ	37
appellate	appellate	NNP	4
appellation	appellation	NN	23
appellations	appellation	NNS	8
appellatives	appellative	NNS	1
appelle	appelle	NN	1
appellees	appellee	NNP	3
append	append	VB	7
append	append	NNP	2
appendage	appendage	NN	10
appendages	appendage	NNS	19
appendectomies	appendectomy	NNS	1
appendectomy	appendectomy	NN	1
appendectomy	appendectomy	NNP	1
appended	append	VBN	33
appended	appended	NNP	1
appendices	appendix	NNS	15
appendices	appendix	NNP	10
appendicitis	appendicitis	NNS	8
appendiculatum	appendiculatum	NN	3
appending	append	VBG	6
appending	appending	NNP	2
appendix	appendix	NNP	333
appendix	appendix	NN	106
appendixes	appendix	NNS	5
appendixes	appendix	NNP	4
appendixlists	appendixlist	NNP	1
appends	append	NNS	2
appenines	appenine	NNP	1
appennine	appennine	NNP	1
appens	appen	NNS	1
appenzell	appenzell	NNP	1
apperances	apperance	NNS	1
apperantly	apperantly	UNC	1
apperson	apperson	NNP	1
appertain	appertain	NN	1
appetentem	appetentem	NN	1
appetit	appetit	NN	4
appetit	appetit	NNP	1
appetite	appetite	NN	174
appetite	appetite	NNP	9
appetite	appetite	UNC	1
appetite-stimulating	appetite-stimulating	JJ	1
appetites	appetite	NNS	36
appetites	appetites	UNC	1
appetizer	appetizer	NN	16
appetizer	appetizer	NNP	1
appetizers	appetizer	NNS	16
appetizers	appetizer	NNP	1
appetizing	appetizing	JJ	14
appetizingly	appetizingly	RB	1
appia	appium	NNP	3
appiah	appiah	NNP	13
appiah	appiah	UNC	1
appian	appian	NNP	2
appication	appication	NN	1
appier	appier	NNP	23
appl	appl	NNP	2
appl	appl	NN	1
applachian	applachian	NNP	3
applaud	applaud	VBP	55
applaud	applaud	VB	31
applaud	applaud	UNC	1
applaud	applaud	NNP	1
applauded	applaud	VBD	73
applauded	applauded	NNP	1
applauding	applaud	VBG	20
applauding	applauding	NNP	1
applauds	applaud	VBZ	52
applauds	applauds	UNC	1
applause	applause	NN	90
applause	applause	NNP	1
applause-getters	applause-getter	JJ	1
apple	apple	NNP	320
apple	apple	NN	198
apple	apple	UNC	1
apple-biting	apple-biting	JJ	1
apple-branded	apple-branded	NNP	1
apple-cheeked	apple-cheeked	JJ	1
apple-everything	apple-everything	JJ	1
apple-hosted	apple-hosted	NNP	1
apple-pear	apple-pear	JJ	1
apple-pie	apple-pie	NN	2
apple-supplied	apple-supplied	NNP	1
applebaum	applebaum	NNP	1
applebee	applebee	NNP	5
applebees	applebee	NNP	1
applebome	applebome	NNP	18
appleby	appleby	NNP	14
applecare	applecare	NNP	1
applegarth	applegarth	NNP	1
applegate	applegate	NNP	4
appleman	appleman	NNP	2
apples	apple	NNS	140
apples	apple	NNP	17
apples	apples	UNC	1
apples-and-oranges	apples-and-orange	JJ	1
apples-to-apples	apples-to-apple	JJ	1
applesauce	applesauce	NN	8
applesauce	applesauce	NNP	1
appleseed	appleseed	NNP	8
applet	applet	NN	7
applet-generated	applet-generated	JJ	1
appleton	appleton	NNP	10
appletons	appleton	NNP	1
applets	applet	NNS	5
applewhite	applewhite	NNP	3
applewood	applewood	NN	3
applewood	applewood	NNP	1
applewood-smoked	applewood-smoked	JJ	1
appliance	appliance	NN	35
appliance	appliance	NNP	1
applianced	applianced	JJ	1
appliances	appliance	NNS	84
appliances	appliance	NNP	6
applic	applic	NN	2
applicability	applicability	NN	49
applicability	applicability	NNP	27
applicable	applicable	JJ	434
applicable	applicable	NNP	7
applicableemission	applicableemission	NN	2
applicableimplementation	applicableimplementation	NN	1
applicandum	applicandum	NN	1
applicant	applicant	NN	72
applicant	applicant	NNP	2
applicants	applicant	NNS	174
applicants	applicant	NNP	6
applicarent	applicarent	NN	1
application	application	NN	938
application	application	NNP	62
application	application	UNC	1
application-listed	application-listed	JJ	1
application-targeted	application-targeted	NNP	1
application-what	application-what	JJ	1
applications	application	NNS	623
applications	application	NNP	2
applications	applications	UNC	1
applicatn	applicatn	NN	1
applicator	applicator	NN	4
applicuerunt	applicuerunt	NN	1
applicuisset	applicuisset	NN	1
applicuisti	applicuistus	NN	1
applied	applied	NNP	151
applied	applied	JJ	3
applied	applied	UNC	2
applied	apply	VBN	1105
applied	apply	VBD	234
applies	apply	VBZ	294
applies	apply	NNP	1
appling	appling	NNP	3
applipicable	applipicable	JJ	1
applique	applique	NN	4
appliqued	appliqued	JJ	1
appliques	applique	NNS	3
appliqué	appliqué	NN	1
appliqués	appliqués	NNS	2
appliqués	appliqués	UNC	1
apply	apply	VB	749
apply	apply	VBP	214
apply	apply	NNP	31
apply	apply	UNC	2
applying	apply	VBG	347
appoint	appoint	VB	97
appoint	appoint	UNC	1
appointed	appoint	VBN	240
appointed	appoint	VBD	80
appointed	appointed	UNC	1
appointed-for-life	appointed-for-life	JJ	1
appointee	appointee	NN	42
appointee	appointee	NNP	1
appointees	appointee	NNS	44
appointees	appointee	NNP	1
appointees	appointees	UNC	1
appointers	appointer	NNS	1
appointing	appoint	VBG	34
appointing	appointing	NNP	1
appointive	appointive	JJ	3
appointment	appointment	NN	342
appointment	appointment	NNP	7
appointments	appointment	NNS	109
appointments	appointment	NNP	4
appointmet	appointmet	NN	1
appoints	appoint	NNS	15
appoints	appoint	NNP	2
appold	appold	NNP	2
appomattox	appomattox	NNP	7
apponens	apponen	NNS	1
apporpriate	apporpriate	NN	1
apport	apport	NN	1
apportion	apportion	NN	5
apportioned	apportioned	JJ	6
apportionment	apportionment	NN	6
apportionment	apportionment	NNP	2
apportions	apportion	NNS	1
apporve	apporve	NN	1
appose	appose	NN	1
apposed	apposed	JJ	4
apposing	appose	VBG	1
apposite	apposite	NN	6
apposition	apposition	NN	8
appositional	appositional	NN	3
appositional	appositional	NNP	1
appositions	apposition	NNS	4
appositions	apposition	NNP	1
appositive	appositive	JJ	5
appositus	appositus	JJ	1
appp	appp	NNP	1
apppa	apppa	NNP	12
apppa-binding	apppa-binding	NNP	1
apppbodipy	apppbodipy	NNP	2
apppn	apppn	NNP	33
appppa	appppa	NNP	14
appppn	appppn	NNP	29
appraisal	appraisal	NN	78
appraisal	appraisal	NNP	3
appraisal	appraisal	UNC	1
appraisals	appraisal	NNS	10
appraise	appraise	VB	28
appraised	appraise	VBN	26
appraiser	appraiser	NN	8
appraisers	appraiser	NNS	2
appraises	appraise	NNS	7
appraising	appraise	VBG	2
appraising	appraising	NNP	2
appreciable	appreciable	JJ	35
appreciably	appreciably	RB	35
appreciate	appreciate	VB	433
appreciate	appreciate	VBP	185
appreciate	appreciate	NNP	5
appreciate	appreciate	UNC	1
appreciated	appreciate	VBN	184
appreciated	appreciate	VBD	74
appreciated	appreciated	NNP	2
appreciated	appreciated	UNC	1
appreciates	appreciate	VBZ	31
appreciates	appreciate	NNP	1
appreciating	appreciate	VBG	34
appreciation	appreciation	NN	200
appreciation	appreciation	NNP	19
appreciations	appreciation	NNS	3
appreciations	appreciation	NNP	1
appreciative	appreciative	JJ	42
appreciatively	appreciatively	RB	12
appreciator	appreciator	NN	5
appredendissent	appredendissent	NN	1
apprehend	apprehend	NN	10
apprehended	apprehended	JJ	23
apprehenderof	apprehenderof	NN	1
apprehending	apprehend	VBG	5
apprehension	apprehension	NN	29
apprehension	apprehension	UNC	2
apprehension	apprehension	NNP	2
apprehensions	apprehension	NNS	7
apprehensive	apprehensive	JJ	15
apprehensive	apprehensive	NNP	1
apprehensively	apprehensively	RB	2
apprend	apprend	NN	1
apprendi	apprendus	NNP	4
apprendre	apprendre	NN	1
apprentice	apprentice	NN	17
apprentice	apprentice	NNP	9
apprentice-work	apprentice-work	JJ	1
apprenticed	apprenticed	JJ	7
apprentices	apprentice	NNS	8
apprenticeship	apprenticeship	NN	16
apprenticeship	apprenticeship	NNP	1
apprenticeships	apprenticeship	NNS	4
apprenticing	apprentice	VBG	2
apprise	apprise	NN	4
apprised	apprise	VBN	4
appro-priateness	appro-priateness	JJ	1
approach	approach	NN	2757
approach	approach	VB	121
approach	approach	VBP	96
approach	approach	NNP	42
approach	approach	UNC	6
approach	approach	JJ	1
approachability	approachability	NN	1
approachable	approachable	JJ	8
approached	approach	VBD	172
approached	approach	VBN	91
approached	approached	UNC	3
approachers	approacher	NNS	1
approaches	approach	NNS	779
approaches	approach	VBZ	49
approaches	approach	NNP	29
approaches	approaches	UNC	4
approaching	approach	VBG	203
approaching	approaching	NNP	8
approachoutlined	approachoutlined	JJ	1
approbation	approbation	NN	9
approbative	approbative	JJ	1
approching	approch	VBG	1
appropos	appropo	NNP	2
appropria	appropria	NNP	1
appropriable	appropriable	JJ	1
appropriacy	appropriacy	NN	1
appropriate	appropriate	JJ	2012
appropriate	appropriate	NNP	43
appropriate	appropriate	UNC	4
appropriate-according	appropriate-according	JJ	1
appropriate-for-gestational	appropriate-for-gestational	JJ	1
appropriate-in	appropriate-in	JJ	1
appropriate-sounding	appropriate-sounding	JJ	1
appropriate-that	appropriate-that	JJ	1
appropriatearchitecture	appropriatearchitecture	NN	1
appropriated	appropriate	VBN	54
appropriated	appropriate	VBD	21
appropriated	appropriated	UNC	1
appropriately	appropriately	RB	214
appropriately	appropriately	NNP	14
appropriately	appropriately	UNC	1
appropriateness	appropriateness	NN	46
appropriates	appropriate	NNS	4
appropriating	appropriate	VBG	15
appropriating	appropriating	NNP	1
appropriation	appropriation	NN	83
appropriation	appropriation	NNP	4
appropriations	appropriation	NNS	149
appropriations	appropriation	NNP	84
appropriations	appropriation	NNPS	23
appropriations	appropriations	UNC	1
appropriations-defense	appropriations-defense	JJ	1
appropriations-will	appropriations-will	JJ	1
appropriators	appropriator	NNS	1
approval	approval	NN	774
approval	approval	NNP	30
approval	approval	UNC	7
approval	approval	JJ	1
approval-disapproval	approval-disapproval	JJ	1
approvals	approval	NNS	38
approvals	approval	NNP	4
approve	approve	VB	276
approve	approve	VBP	41
approve	approve	NNP	10
approved	approve	VBN	600
approved	approve	VBD	582
approved	approved	NNP	8
approved	approved	JJ	8
approved	approved	UNC	1
approveddesignation	approveddesignation	NN	1
approver	approver	NN	1
approves	approve	VBZ	33
approves	approve	NNP	6
approving	approve	VBG	69
approving	approving	NNP	4
approvingchanges	approvingchange	NNS	1
approvingly	approvingly	RB	15
approx	approx	NN	14
approx	approx	NNP	1
approximate	approximate	JJ	157
approximate	approximate	NNP	8
approximate-match	approximate-match	JJ	1
approximated	approximated	JJ	35
approximated	approximated	NNP	2
approximately	approximately	RB	1901
approximately	approximately	UNC	1
approximates	approximate	VBZ	20
approximating	approximate	VBG	13
approximation	approximation	NN	113
approximations	approximation	NNS	15
approximatley	approximatley	NN	1
approximatly	approximatly	RB	1
approximators	approximator	NNS	1
apps	app	NNS	5
appt	appt	NN	2
appts	appt	NNS	3
appurtenances	appurtenance	NNS	2
appurtences	appurtence	NNS	1
appurtences	appurtence	NNP	1
appuyer	appuyer	NN	2
appx	appx	NN	2
appétit	appétit	NNP	2
apr	apr	NNP	446
apra	apra	NNP	5
aprataxin	aprataxin	NNP	2
apraxia	apraxium	NN	2
apreciate	apreciate	NN	1
apres	apr	NNP	1
apresents	apresent	NNS	2
apresyan	apresyan	NNP	1
aprex	aprex	NNP	1
apre­mont	apre­mont	NNP	1
apri	aprus	NNP	1
aprice	aprice	NN	1
apricot	apricot	NN	11
apricot	apricot	NNP	2
apricots	apricot	NNS	14
april	april	NNP	1672
april	april	UNC	3
april	april	NN	1
april-bot	april-bot	NNP	1
april-early	april-early	NNP	1
april-june	april-june	NNP	1
april-through	april-through	NNP	1
aprilbot	aprilbot	NNP	4
aprilbot	aprilbot	NN	1
aprile	aprile	NNP	2
april–	april–	NNP	10
aprimary	aprimary	NNP	1
aprivate	aprivate	NN	1
aprofile	aprofile	NNP	1
apron	apron	NN	27
apron	apron	NNP	2
apron-clad	apron-clad	JJ	1
apron-staged	apron-staged	JJ	1
aproned	aproned	JJ	1
aprons	apron	NNS	14
apropos	apropo	NNP	34
apropos	apropo	NNS	18
aprotinin	aprotinin	NN	41
aprotinin	aprotinin	NNP	8
aproved	aproved	JJ	1
aprovides	aprovide	NNS	1
aprt	aprt	NNP	1
aprt	aprt	NN	1
aprtment	aprtment	NN	2
après	après	NNS	2
aprés	aprés	NNP	1
aprés-ski	aprés-ski	JJ	1
aps	ap	NNP	3
aps	aps	NN	1
apsara	apsara	NN	1
apse	apse	NN	29
apse	apse	NNP	1
apses	apse	NNP	33
apses-like	apses-like	NNP	1
apsley	apsley	NNP	2
apso	apso	NNP	1
apt	apt	JJ	148
apt	apt	UNC	1
apt	apt	NNP	1
aptamer	aptamer	NN	16
aptamers	aptamer	NNS	5
aptazyme	aptazyme	NN	19
aptazymes	aptazyme	NNS	16
apted	apted	NNP	3
apteek	apteek	NN	1
aptenodytes	aptenodyte	NNP	1
apteronotus	apteronotus	NNP	1
apterous	apterous	JJ	5
aptest	aptest	NN	2
aptitude	aptitude	NN	32
aptitude	aptitude	NNP	4
aptitudes	aptitude	NNS	3
aptly	aptly	RB	37
aptly	aptly	NNP	1
aptly-named	aptly-named	JJ	1
aptly-titled	aptly-titled	JJ	1
aptness	aptness	NNS	2
apu	apu	NNP	3
apuleius	apuleius	NNP	1
apulia	apulium	NNP	3
apurinic	apurinic	JJ	5
apv	apv	NNP	135
apw	apw	NNP	1
apyrase	apyrase	NN	2
apyrimidinic	apyrimidinic	JJ	3
apátság	apátság	NNP	1
apéritif	apéritif	NN	3
aq	aq	NNP	19
aqaarib	aqaarib	NN	2
aqaba	aqaba	NNP	3
aqmd	aqmd	NNP	2
aqp	aqp	NNP	128
aqp-like	aqp-like	NNP	3
aqp-type	aqp-type	NNP	1
aqps	aqp	NNP	64
aqsa	aqsa	NNP	9
aqua	aqua	NNP	14
aqua	aqua	JJ	8
aqua-cycling	aqua-cycling	JJ	1
aqua-glyceroporin	aqua-glyceroporin	JJ	1
aquacide	aquacide	NNP	1
aquacise	aquacise	NN	1
aquacity	aquacity	NNP	1
aquaculture	aquaculture	NN	7
aquaculture	aquaculture	NNP	2
aquadextrous	aquadextrous	NNP	1
aquae	aqua	NNP	4
aquafina	aquafina	NNP	2
aquafresh	aquafresh	NNP	5
aquagrill	aquagrill	NNP	3
aquaintance	aquaintance	NN	1
aquaintances	aquaintance	NNS	1
aqualand	aqualand	NNP	1
aqualebrium	aqualebrium	NNP	1
aqualeisure	aqualeisure	NNP	1
aqualife	aqualife	NN	1
aqualine	aqualine	NN	1
aqualosers	aqualoser	NNS	1
aquaman	aquaman	NNP	10
aquamarine	aquamarine	NN	8
aquamarine	aquamarine	NNP	2
aquanetta	aquanetta	NNP	1
aquantifies	aquantify	NNP	1
aquapark	aquapark	NNP	2
aquaplaning	aquaplan	VBG	1
aquaporin	aquaporin	NN	10
aquaporin	aquaporin	NNP	2
aquaporin-related	aquaporin-related	JJ	2
aquaporins	aquaporin	NNS	3
aquaporins	aquaporin	NNP	1
aquaria	aquarium	NN	2
aquarian	aquarian	NNP	4
aquarians	aquarian	NNP	2
aquarium	aquarium	NN	75
aquarium	aquarium	NNP	48
aquariums	aquarium	NNS	9
aquarius	aquarius	NNP	21
aquascope	aquascope	NNP	2
aquasur	aquasur	NNP	1
aquateric	aquateric	NNP	14
aquaterra	aquaterra	NNP	1
aquathon	aquathon	NN	1
aquatic	aquatic	JJ	80
aquatic	aquatic	NNP	7
aquatic-sports	aquatic-sport	JJ	1
aquatics	aquatic	NNP	4
aquatics	aquatic	NNS	3
aquatint	aquatint	NN	1
aquaworld	aquaworld	NNP	4
aquaworld	aquaworld	NN	1
aquba	aquba	NNP	1
aquebogue	aquebogue	NNP	1
aqueduct	aqueduct	NN	25
aqueduct	aqueduct	NNP	12
aqueducts	aqueduct	NNS	6
aqueducts	aqueduct	NNP	1
aqueduto	aqueduto	NNP	1
aquel	aquel	NN	1
aquella	aquellum	NNP	1
aquellas	aquella	NNS	1
aquensem	aquensem	NNP	1
aqueous	aqueous	JJ	125
aqueous	aqueous	NNP	5
aqueous-phase	aqueous-phase	JJ	1
aqueously	aqueously	RB	2
aqueria	aquerium	NNP	2
aqui	aquus	NN	2
aqui	aquus	NNP	1
aquifer	aquifer	NN	3
aquifer	aquifer	NNP	3
aquifers	aquifer	NNS	6
aquifex	aquifex	NNP	27
aquificales	aquificale	NNP	2
aquila	aquilum	NNP	14
aquiline	aquiline	NN	1
aquinas	aquina	NNP	14
aquinas	aquinas	UNC	1
aquincum	aquincum	NNP	9
aquinnah	aquinnah	NNP	1
aquino	aquino	NNP	2
aquire	aquire	NNP	1
aquire	aquire	NN	1
aquis	aqui	NNP	1
aquisition	aquisition	NN	1
aquitaine	aquitaine	NNP	8
aquitania	aquitanium	NNP	2
aquitted	aquitted	JJ	1
aquiver	aquiver	NN	1
aquàrium	aquàrium	NNP	1
aquárium	aquárium	NNP	1
aquí	aquí	NN	3
aquí	aquí	NNP	1
ar	ar	NNP	364
ar	ar	NN	31
ar	ar	UNC	1
ar-ar	ar-ar	JJ	1
ar-are	ar-are	NNP	1
ar-dependent	ar-dependent	NNP	6
ar-dna	ar-dna	NNP	1
ar-expressing	ar-expressing	NNP	1
ar-inactivating	ar-inactivating	NNP	2
ar-initiated	ar-initiated	NNP	1
ar-mediated	ar-mediated	NNP	5
ar-mi	ar-mi	JJ	1
ar-rafiiq	ar-rafiiq	JJ	1
ar-rajl	ar-rajl	JJ	1
ar-responsive	ar-responsive	NNP	1
ar-specific	ar-specific	NNP	1
ar-turmerone	ar-turmerone	JJ	1
ara	ara	NNP	15
ara	ara	NN	6
arab	arab	JJ	680
arab	arab	NNP	165
arab	arab	NN	3
arab-dominated	arab-dominated	NNP	3
arab-led	arab-led	NNP	1
arab-looking	arab-looking	NNP	2
arab-majority	arab-majority	NNP	1
arab-manufactured	arab-manufactured	NNP	1
arab-owned	arab-owned	NNP	1
arab-poet	arab-poet	NNP	1
arab-run	arab-run	NNP	2
arab-sponsored	arab-sponsored	JJ	1
arab-style	arab-style	NNP	2
arabah	arabah	NNP	1
arabe	arabe	NNP	2
arabe	arabe	NN	1
arabella	arabellum	NNP	1
arabesque	arabesque	NN	5
arabesques	arabesque	NNS	10
arabi	arabus	NNP	33
arabia	arabia	NNP	4
arabia	arabium	NNP	308
arabian	arabian	NNP	59
arabian-sponsored	arabian-sponsored	NNP	1
arabians	arabian	NNP	4
arabic	arabic	NNP	298
arabic-language	arabic-language	NNP	6
arabic-sounding	arabic-sounding	NNP	2
arabic-speaking	arabic-speaking	NNP	5
arabica	arabica	NN	1
arabicgreek	arabicgreek	UNC	1
arabicincluded	arabicincluded	NNP	1
arabictravel	arabictravel	NNP	1
arabidopis	arabidopi	NNP	1
arabidopsis	arabidopsis	NNP	518
arabidopsis	arabidopsis	NNS	20
arabidopsisaqp	arabidopsisaqp	NNP	1
arabidopsischromosomes	arabidopsischromosome	NNP	1
arabidopsisgenome	arabidopsisgenome	NNP	2
arabidopsismyosins	arabidopsismyosin	NNP	2
arabiensis	arabiensis	NNS	2
arabino	arabino	NN	1
arabino-heptulosonate	arabino-heptulosonate	JJ	1
arabinofuranoside	arabinofuranoside	NN	4
arabinofuranosyl	arabinofuranosyl	NN	1
arabinose	arabinose	NN	4
arabinose-binding	arabinose-binding	JJ	1
arabiopsis	arabiopsis	NNP	1
arabipdosis	arabipdosis	NNP	1
arabism	arabism	NNP	3
arabist	arabist	NNP	1
arabists	arabist	NNP	1
arabization	arabization	NNP	1
arable	arable	JJ	9
arablish	arablish	NNP	1
arabs	arab	NNPS	230
arabs	arab	NNS	4
arabs	arab	NNP	1
arabs	arabs	UNC	1
arabs-u	arabs-u	NNP	1
arabsthink	arabsthink	NNP	1
araby	araby	NNP	1
arabí	arabí	NNP	2
arac	arac	NNP	3
arac-like	arac-like	NNP	2
araca	araca	NNP	1
araceae	aracea	NNP	1
aracena	aracena	NNP	1
arachadyl	arachadyl	NNP	1
arachaeoglobus	arachaeoglobus	NNP	1
arachidic	arachidic	JJ	1
arachidonate	arachidonate	NN	2
arachidonic	arachidonic	JJ	30
arachidonic	arachidonic	NNP	1
arachidonoyl	arachidonoyl	NN	1
arachidonyl	arachidonyl	NN	1
arachidoyl	arachidoyl	NN	5
arachinodic	arachinodic	JJ	1
arachis	arachi	NNP	1
arachnaphobe	arachnaphobe	NN	1
arachnid	arachnid	NNP	1
arachnids	arachnid	NNS	3
arachnodactyly	arachnodactyly	RB	2
arachnologist	arachnologist	NN	1
arachnophobia	arachnophobia	NNP	1
arachova	arachova	NNP	2
aracoeli	aracoelus	NNP	1
aradam	aradam	NNP	1
arade	arade	NNP	4
arafa	arafa	NNP	1
arafat	arafat	NNP	371
arafat	arafat	UNC	3
arago	arago	NNP	1
aragon	aragon	NNP	18
aragones	aragone	NNP	1
aragonese	aragonese	NNP	4
aragorn	aragorn	NNP	32
aragorn	aragorn	NN	1
aragornesque	aragornesque	NNP	1
aragó	aragó	NNP	3
aragón	aragón	NNP	12
arah	arah	NNP	1
arah	arah	NN	1
araiguma	araiguma	NNP	1
arakeen	arakeen	NNP	1
araki	arakus	NNP	1
aral	aral	NNP	1
araldite	araldite	NNP	1
araldite	araldite	NN	1
arama	arama	NNP	1
aramaic	aramaic	NNP	24
aramark	aramark	NNP	3
aramburuzabala	aramburuzabalum	NNP	17
aramco	aramco	NNP	1
arame	arame	NNP	2
aramean	aramean	NNP	1
aramic	aramic	NNP	1
aramis	arami	NNP	2
aramony	aramony	NNP	2
arana	arana	NNP	2
aranca	aranca	NNP	1
aranda	aranda	NNP	1
aranesp	aranesp	NNP	8
arange	arange	NN	2
aranguez	aranguez	NNP	1
aranha	aranha	NNP	1
aranibar	aranibar	NNP	1
aranjaized	aranjaized	JJ	1
aranjuez	aranjuez	NNP	7
aransas	aransa	NNP	20
arany	arany	NNP	1
aranyhordó	aranyhordó	NNP	1
araoz	araoz	NNP	2
arap	arap	NN	3
arap	arap	NNP	1
arapaho	arapaho	NNP	6
arapaho	arapaho	NN	1
arapahoe	arapahoe	NNP	4
arappco	arappco	NNP	1
aras	ara	NNP	1
arashiyama	arashiyama	NNP	4
arasteh	arasteh	NNP	1
arata	ara	NNP	2
arati	aratus	NNP	1
araton	araton	NNP	1
arau	arau	NNP	1
arava	arava	NNP	3
aravalli	aravallus	NNP	4
aravi	aravus	NN	1
aravinda	aravinda	NNP	1
aravis	aravi	NNP	1
arawak	arawak	NNP	25
arawaks	arawak	NNP	1
arax	arax	NNP	2
araújo	araújo	NNP	1
arb	arb	NNP	26
arb	arb	NN	1
arb-home	arb-home	JJ	2
arbacia	arbacium	NNP	7
arbed	arbed	NNP	1
arbeiter	arbeiter	NNP	1
arbenz	arbenz	NNP	1
arber	arber	NNP	4
arbeter	arbeter	NNP	4
arbeter	arbeter	NN	1
arbi	arbi	NN	1
arbi	arbus	NNP	1
arbib	arbib	NNP	2
arbiter	arbiter	NN	18
arbiter	arbiter	NNP	1
arbiters	arbiter	NNS	8
arbitrage	arbitrage	NN	5
arbitragers	arbitrager	NNS	1
arbitrageur	arbitrageur	NN	2
arbitrageurs	arbitrageur	NNS	2
arbitraging	arbitrage	VBG	1
arbitrarily	arbitrarily	RB	71
arbitrarily	arbitrarily	UNC	1
arbitrariness	arbitrariness	NNS	7
arbitrary	arbitrary	JJ	242
arbitrary	arbitrary	UNC	2
arbitrary	arbitrary	NNP	2
arbitrate	arbitrate	NN	6
arbitrating	arbitrate	VBG	1
arbitration	arbitration	NN	39
arbitration	arbitration	NNP	2
arbitrator	arbitrator	NN	14
arbitrators	arbitrator	NNS	4
arbitrators	arbitrator	NNP	1
arbitray	arbitray	NNP	1
arbitrium	arbitrium	NN	1
arbitron	arbitron	NNP	1
arbo	arbo	NN	1
arbois	arboi	NNP	4
arbor	arbor	NNP	82
arbor	arbor	NN	11
arborea	arborea	NN	1
arboreal	arboreal	NN	6
arborescens	arborescen	NNS	1
arboretum	arboretum	NNP	6
arboretum	arboretum	NN	3
arboretums	arboretum	NNS	1
arboreus	arboreus	JJ	2
arborio	arborio	NN	1
arborites	arborite	NNP	1
arborizations	arborization	NNS	2
arbors	arbor	NNS	1
arborway	arborway	NNP	1
arbour	arbour	NNP	3
arbre	arbre	NN	1
arbs	arb	NNP	1
arbuckle	arbuckle	NNP	5
arbuckles	arbuckle	NNP	2
arbus	arbus	NNP	7
arbuscular	arbuscular	NN	2
arbusto	arbusto	NNP	3
arbutus	arbutus	JJ	1
arby	arby	NNP	15
arby	arby	NN	3
arc	arc	NN	286
arc	arc	NNP	66
arc-as-a-whole	arc-as-a-whole	JJ	1
arc-dependent	arc-dependent	JJ	2
arc-driven	arc-driven	JJ	6
arc-et	arc-et	NNP	1
arc-heavy	arc-heavy	JJ	1
arc-ier	arc-ier	NNP	1
arc-iness	arc-iness	JJ	1
arc-jet	arc-jet	JJ	1
arc-light	arc-light	JJ	1
arc-massage	arc-massage	JJ	1
arc-ness	arc-ness	JJ	1
arc-relevant	arc-relevant	JJ	1
arc-wise	arc-wise	NNP	1
arc-y	arc-y	JJ	5
arca	arca	NNP	5
arcade	arcade	NN	53
arcade	arcade	NNP	12
arcade-covered	arcade-covered	JJ	1
arcaded	arcaded	JJ	25
arcades	arcade	NNS	36
arcades	arcade	NNP	1
arcadia	arcadium	NNP	11
arcadia	arcadium	NN	1
arcadian	arcadian	NNP	4
arcadis	arcadi	NNP	3
arcana	arcana	NN	8
arcand	arcand	NNP	2
arcane	arcane	JJ	66
arcanely	arcanely	RB	1
arcangel	arcangel	NNP	1
arcanum	arcanum	NN	1
arcata	arca	NNP	1
arcaícos	arcaícos	NNP	1
arce	arce	NNP	7
arced	arced	JJ	1
arceli	arcelus	NNP	1
arcelor	arcelor	NNP	4
arcfu	arcfu	NNP	1
arch	arch	VBP	94
arch	arch	NNP	43
arch	arch	NN	43
arch-backed	arch-backed	JJ	1
arch-cockney	arch-cockney	JJ	1
arch-concern	arch-concern	JJ	1
arch-conservative	arch-conservative	JJ	2
arch-dragoness	arch-dragoness	JJ	1
arch-enemies	arch-enemy	JJ	1
arch-enemy	arch-enemy	JJ	2
arch-foe	arch-foe	JJ	2
arch-like	arch-like	JJ	1
arch-nemesis	arch-nemesis	JJ	2
arch-nemisis	arch-nemisis	JJ	1
arch-patriarch	arch-patriarch	JJ	1
arch-progressive	arch-progressive	JJ	1
arch-protectionist	arch-protectionist	JJ	1
arch-representative	arch-representative	JJ	1
arch-rival	arch-rival	JJ	2
arch-rivals	arch-rival	JJ	2
arch-sleuth	arch-sleuth	JJ	1
arch-supported	arch-supported	JJ	1
arch-terrorists	arch-terrorist	JJ	1
arch-villain	arch-villain	JJ	1
archaea	archaea	NN	82
archaea	archaea	NNP	69
archaea-eukaryotes	archaea-eukaryote	JJ	1
archaea-specific	archaea-specific	JJ	2
archaeal	archaeal	NN	87
archaeal	archaeal	NNP	13
archaeal-bacterial	archaeal-bacterial	JJ	1
archaean	archaean	NN	1
archaebacteria	archaebacterium	NN	19
archaebacteria	archaebacterium	NNP	3
archaebacteria-derived	archaebacteria-derived	JJ	1
archaebacterial	archaebacterial	NN	8
archaebacterium	archaebacterium	NN	3
archael	archael	NN	1
archaelog	archaelog	NN	1
archaelogist	archaelogist	NN	1
archaelogy	archaelogy	NNP	1
archaeo-eukaryotic	archaeo-eukaryotic	JJ	11
archaeoglobus	archaeoglobus	NNP	20
archaeological	archaeological	JJ	157
archaeological	archaeological	NNP	50
archaeologist	archaeologist	NN	36
archaeologist	archaeologist	NNP	1
archaeologists	archaeologist	NNS	63
archaeologists	archaeologist	NNP	22
archaeology	archaeology	NN	47
archaeology	archaeology	NNP	12
archaeology-related	archaeology-related	JJ	1
archaeometallurgist	archaeometallurgist	NN	1
archaeon	archaeon	NN	16
archaic	archaic	JJ	54
archaic	archaic	NNP	8
archaics	archaic	NNP	2
archaisms	archaism	NNS	4
archangel	archangel	NNP	9
archangel	archangel	NN	4
archbigot	archbigot	NN	1
archbishop	archbishop	NN	39
archbishop	archbishop	NNP	36
archbishopric	archbishopric	NNP	1
archbishops	archbishop	NNS	4
archdale	archdale	NNP	2
archdeacon	archdeacon	NNP	4
archdiocesan	archdiocesan	NN	9
archdiocese	archdiocese	NN	94
archdiocese	archdiocese	NNP	44
archdioceses	archdiocese	NNS	2
archduchess	archduchess	NNS	1
archduke	archduke	NNP	11
archduke	archduke	NN	1
arche	arche	NNP	7
archea	archea	NN	1
archeabacteria	archeabacterium	NN	3
arched	arched	JJ	60
arched	arched	NNP	4
archegetis	archegeti	NNP	1
archenemies	archenemy	NNS	2
archenemy	archenemy	NN	7
archeologica	archeologica	NNP	1
archeological	archeological	JJ	18
archeological	archeological	NNP	1
archeologico	archeologico	NNP	3
archeologist	archeologist	NN	2
archeologists	archeologist	NNS	6
archeologists	archeologist	NNP	1
archeology	archeology	NN	10
archeology	archeology	NNP	4
archeology-in-reverse	archeology-in-reverse	JJ	1
archer	archer	NNP	162
archer	archer	NN	4
archerd	archerd	NNP	2
archers	archer	NNS	6
archers	archer	NNP	4
archery	archery	NN	12
archery	archery	NNP	1
arches	arch	NNS	115
arches	arch	NNP	14
archetti	archettus	NNP	1
archetypal	archetypal	NN	36
archetypal	archetypal	UNC	2
archetype	archetype	NN	28
archetype-haunted	archetype-haunted	JJ	1
archetypes	archetype	NNS	10
archetypes	archetypes	UNC	1
archevêché	archevêché	NNP	1
archfiend	archfiend	NN	1
archia	archium	NNP	1
archibald	archibald	NNP	18
archibold	archibold	NNP	4
archie	archie	NNP	38
archie	archie	NN	4
archie-faction	archie-faction	NNP	1
archies	archy	NNP	9
archilochos	archilocho	NNP	1
archimbaud	archimbaud	NNP	2
archimedes	archimede	NNP	3
arching	arch	VBG	13
archipelago	archipelago	NN	40
archipelago	archipelago	NNP	4
archipelagoes	archipelago	NNS	1
archipiélago	archipiélago	NNP	3
architect	architect	NN	338
architect	architect	NNP	14
architect	architect	UNC	1
architect-engineer	architect-engineer	JJ	1
architect-mathematician-poet	architect-mathematician-poet	JJ	1
architect-sculptor	architect-sculptor	JJ	1
architect-to-be	architect-to-be	JJ	1
architected	architected	JJ	6
architectengineer	architectengineer	NNP	1
architecting	architect	VBG	2
architective	architective	JJ	1
architects	architect	NNS	181
architects	architect	NNPS	24
architects	architects	UNC	2
architectural	architectural	JJ	270
architectural	architectural	NNP	20
architecturally	architecturally	RB	16
architecturally	architecturally	NNP	3
architecture	architecture	NN	659
architecture	architecture	NNP	83
architecture	architecture	UNC	5
architecture-specific	architecture-specific	JJ	1
architecturefor	architecturefor	NN	1
architectureis	architecturei	NNS	1
architectureoptimization	architectureoptimization	NN	1
architectures	architecture	NNS	41
architecturesis	architecturesis	NNS	1
architraves	architrave	NNS	1
archiv	archiv	NNP	2
archivage	archivage	NN	1
archival	archival	JJ	47
archival	archival	NNP	3
archive	archive	NN	112
archive	archive	NNP	29
archive	archive	UNC	1
archive-surfing	archive-surfing	JJ	1
archive-sweat	archive-sweat	JJ	1
archived	archived	JJ	24
archived	archived	NNP	1
archives	archive	NNS	129
archives	archive	NNPS	42
archives	archives	UNC	1
archiving	archive	VBG	16
archiving	archiving	NNP	1
archivist	archivist	NN	6
archivists	archivist	NNS	9
archivo	archivo	NNP	1
archi­tec­ture	archi­tec­ture	NN	1
archly	archly	RB	12
archnemesis	archnemesis	NNS	1
archos	archo	NNP	3
archos	archo	NNS	1
archrationalist	archrationalist	NN	1
archrival	archrival	JJ	9
archrivals	archrival	NNS	1
archvillain	archvillain	NN	2
archvillains	archvillain	NNS	1
archway	archway	NN	15
archways	archway	NNS	2
archwork	archwork	NN	2
archy	archy	NN	1
arch­bishop	arch­bishop	NN	1
archéologique	archéologique	NNP	2
arcing	arc	VBG	2
arcjet	arcjet	NN	2
arclet	arclet	NN	1
arclight	arclight	NNP	4
arcman	arcman	NN	1
arco	arco	NNP	16
arcopedico	arcopedico	NNP	3
arcopedicos	arcopedico	NNP	1
arcos	arco	NNP	3
arcs	arc	NNS	42
arcs	arc	NNP	2
arcs	arcs	UNC	1
arcsin	arcsin	NN	3
arctan	arctan	NN	1
arctanthemum	arctanthemum	NNP	5
arctic	arctic	NNP	61
arctic	arctic	JJ	6
arctic-dwelling	arctic-dwelling	NNP	1
arctoides	arctoide	NNS	1
arctos	arcto	NNS	1
arcturus	arcturus	NNP	2
arcuate	arcuate	NN	5
arcuate	arcuate	NNP	1
arcus	arcus	JJ	1
arcview	arcview	NNP	1
arcy	arcy	NN	5
arcy	arcy	NNP	5
ard	ard	NNP	47
ard	ard	NN	8
ard-immunoreactivity	ard-immunoreactivity	NNP	2
arda	arda	NNP	2
ardabil	ardabil	NNP	1
ardagh	ardagh	NNP	1
ardannabon	ardannabon	NN	1
ardastra	ardastra	NNP	1
ardea	ardea	NNP	1
ardeatine	ardeatine	NNP	1
ardeche	ardeche	NNP	1
arden	arden	NNP	17
ardennes	ardenn	NNP	4
ardent	ardent	JJ	45
ardently	ardently	RB	14
ardhanarishvara	ardhanarishvara	NNP	1
ardilla	ardillum	NN	1
ardine	ardine	NNP	1
ardipithecus	ardipithecus	NNP	1
ardittou	ardittou	NNP	1
ardlie	ardlie	NNP	1
ardmore	ardmore	NNP	4
ardolino	ardolino	NNP	2
ardor	ardor	NN	15
ardor	ardor	NNP	1
ardour	ardour	NN	1
ardoyne	ardoyne	NNP	1
ardoz	ardoz	NNP	1
ardrey	ardrey	NNP	1
ards	ard	NNP	54
ards	ard	NNS	2
ardsley	ardsley	NNP	2
arduous	arduous	JJ	34
ardèche	ardèche	NNP	2
are	are	NN	358
are	are	UNC	273
are	are	JJ	4
are	are	NNP	1
are	be	VBP	106108
are-jet	are-jet	JJ	1
are-mrna	are-mrna	NNP	2
are-tata-luciferase	are-tata-luciferase	NNP	7
area	area	NN	5457
area	area	NNP	215
area	area	UNC	4
area	area	JJ	1
area-code	area-code	JJ	1
area-istas	area-ista	NNP	2
area-ites	area-ite	NNP	1
area-product	area-product	JJ	1
area-sources	area-source	JJ	1
area-to-volume	area-to-volume	JJ	2
area-under-the-curve	area-under-the-curve	NNP	1
areaandtutmosis	areaandtutmosis	NNS	1
areactively	areactively	RB	1
areal	areal	NNP	1
areapplied	areapplied	JJ	1
arear	arear	NN	1
areas	area	NNS	2759
areas	area	NNP	5
areas	areas	UNC	13
areas	areas	JJ	2
areas-backing	areas-backing	JJ	1
areas-control	areas-control	JJ	1
areas-corporate	areas-corporate	JJ	1
areas-urban	areas-urban	JJ	1
areasin	areasin	NN	1
areasonable	areasonable	NNP	1
areasonn	areasonn	NN	2
areawide	areawide	NN	1
arecession	arecession	NNP	1
arecibo	arecibo	NNP	5
arecoming	arecome	VBG	1
arediscounted	arediscounted	JJ	1
aree	aree	NNP	1
areet	areet	NNP	1
arefers	arefer	NNS	1
arefrom	arefrom	NN	1
areg	erg	NNP	1
areheart	areheart	NNP	1
areia	areium	NNP	1
arein	arein	NN	1
arelated	arelated	NNP	1
areligious	areligious	UNC	2
arellano	arellano	NNP	5
aremore	aremore	NN	1
aren	aren	NN	37
aren	aren	NNP	11
arena	arena	NN	227
arena	arena	NNP	57
arena	arena	UNC	1
arena-rigging	arena-rigging	JJ	1
arena-rock	arena-rock	JJ	4
arena-rocking	arena-rocking	JJ	1
arena-scale	arena-scale	JJ	1
arenabowl	arenabowl	NNP	1
arenal	arenal	NNP	6
arenaria	arenarium	NN	4
arenas	arena	NNS	31
arenas	arena	NNP	1
arend	arend	NNP	1
arendt	arendt	NNP	29
arens	aren	NNP	2
arensky	arensky	NNP	5
arenson	arenson	NNP	8
arent	arent	NN	1
areopagos	areopago	NNP	2
areos	areo	NNP	2
arep	arep	NN	3
areplotted	areplotted	JJ	1
areport	areport	NNP	1
arepresent	arepresent	NN	1
arepublican	arepublican	NNP	1
arequipa	arequipa	NNP	3
ares	are	NNP	16
ares	are	NNS	1
areselected	areselected	JJ	1
areso	areso	NN	1
areste	areste	NN	1
arestegui	aresteguus	NNP	1
arete	arete	NN	1
arete	arete	NNP	1
areterminally	areterminally	RB	1
aretha	aretha	NNP	15
arethites	arethite	NNP	1
aretsky	aretsky	NNP	2
aretusa	aretusa	NNP	1
aretz	aretz	NN	130
areuniversal	areuniversal	NN	1
areused	areused	JJ	2
arey	arey	NNP	2
arezzo	arezzo	NNP	3
arf	arf	NNP	26
arf	arf	NN	4
arfbinds	arfbind	NNP	1
arfgene	arfgene	NNP	1
arfogwl	arfogwl	NN	1
arfs	arf	NNP	1
arg	arg	NNP	101
arg	arg	NN	6
arg-?	arg-?	NNP	1
arg-paranitroanilide	arg-paranitroanilide	NNP	1
arga	arga	NN	2
argaman	argaman	NNP	1
argana	argana	NNP	4
argenbright	argenbright	NNP	3
argent	argent	NNP	2
argent	argent	NN	1
argent-antarctic-review	argent-antarctic-review	NNP	1
argentaria	argentarium	NNP	4
argentario	argentario	NNP	3
argentea	argentea	NNP	1
argenteria	argenterium	NNP	1
argenti	argentus	NNP	2
argentina	argentina	NNP	263
argentina-coverup	argentina-coverup	NNP	3
argentina-evita	argentina-evita	NNP	4
argentina-style	argentina-style	NNP	2
argentine	argentine	JJ	82
argentine	argentine	NNP	5
argentine-style	argentine-style	NNP	1
argentinean	argentinean	NNP	4
argentines	argentine	NNP	12
argentinian	argentinian	JJ	11
argentinians	argentinian	NNP	1
argento	argento	NNP	6
argentum	argentum	NN	2
argf	argf	NN	1
arggghhhh	arggghhhh	NNP	3
arggh	arggh	NNP	2
argghhhhhhhh	argghhhhhhhh	NNP	1
argh	argh	NNP	95
argh	argh	NN	25
argh	argh	UNC	1
argillite	argillite	NN	1
arginine	arginine	NN	73
arginine	arginine	NNP	3
arginine-rich	arginine-rich	JJ	4
arginines	arginine	NNS	9
argininosuccinate	argininosuccinate	NN	1
argmax	argmax	NN	6
argo	argo	NNP	3
argolid	argolid	NNP	5
argon	argon	NN	9
argon	argon	NNP	6
argon-ion	argon-ion	JJ	1
argonath	argonath	NNP	1
argonaut	argonaut	NNP	1
argonaute	argonaute	NNP	1
argonauts	argonaut	NNP	3
argonauts	argonaut	NNS	1
argonne	argonne	NNP	11
argos	argo	NNP	9
argosy	argosy	NNP	1
argot	argot	NN	18
argot	argot	NNP	3
args	arg	NNP	3
arguable	arguable	JJ	14
arguably	arguably	RB	174
arguably	arguably	UNC	3
argue	argue	VB	488
argue	argue	VBP	414
argue	argue	UNC	5
argue	argue	NNP	5
argue-y	argue-y	JJ	1
argued	argue	VBD	530
argued	argue	VBN	217
argued	argued	NNP	5
argued	argued	UNC	1
argued-might	argued-might	JJ	1
arguello	arguello	NNP	3
arguement	arguement	NN	3
argues	argue	VBZ	627
argues	argue	NNP	1
argues	argues	UNC	6
argueta	argueta	NNP	5
arguineguín	arguineguín	NNP	1
arguing	argue	VBG	405
arguing	arguing	UNC	1
argumantar	argumantar	NN	1
argument	argument	NN	1303
argument	argument	UNC	19
argument	argument	NNP	15
argument-ender	argument-ender	JJ	1
argument-stopping	argument-stopping	JJ	1
argumentación	argumentación	NN	1
argumentation	argumentation	NN	5
argumentative	argumentative	JJ	10
argumentativeness	argumentativeness	NNS	1
argumentgative	argumentgative	JJ	1
argumento	argumento	NN	1
argumento	argumento	NNP	1
arguments	argument	NNS	485
arguments	argument	NNP	18
arguments	arguments	UNC	3
argureoio	argureoio	NN	1
argureoiou	argureoiou	NN	1
argureolou	argureolou	NN	1
argus	argus	NNP	6
argus	argus	JJ	1
argye	argye	NNP	1
argyle	argyle	NNP	3
argyll	argyll	NNP	2
arhats	arhat	NNS	1
ari	arus	NNP	86
aria	aria	NN	7
aria	aria	NNP	5
ariab	ariab	NN	1
ariadne	ariadne	NNP	4
arian	arian	NNP	8
ariana	ariana	NNP	4
ariane	ariane	NNP	4
arianna	arianna	NNP	30
arianne	arianne	NNP	2
arians	arian	NNP	3
arias	aria	NNS	5
arias	aria	NNP	4
ariation	ariation	NN	1
ariba	ariba	NNP	2
aribau	aribau	NNP	1
aricept	aricept	NNP	1
arid	arid	NN	38
arid	arid	NNP	1
aridane	aridane	NNP	1
aridity	aridity	NN	3
arie	arie	NNP	3
arief	arief	NNP	3
arieh	arieh	NNP	1
arieiro	arieiro	NNP	6
ariel	ariel	NNP	84
arielle	arielle	NNP	4
arienzo	arienzo	NN	1
aries	ary	NNP	15
arif	arif	NNP	1
arigato	arigato	NN	1
aright	aright	NN	1
arihleka	arihleka	NNP	1
arikara	arikara	NNP	1
arikara	arikara	NN	1
arim	arim	NN	1
arima	arima	NNP	2
arimathea	arimathea	NNP	2
ariminium	ariminium	NNP	1
arina	arina	NNP	1
arinc	arinc	NNP	4
arince	arince	NNP	4
arinrummy	arinrummy	NNP	1
ario	ario	NNP	1
arioch	arioch	NNP	1
arion	arion	NNP	1
aripiprazole	aripiprazole	NN	1
aris	ari	NNP	1
arise	arise	VB	198
arise	arise	VBP	129
arise	arise	NNP	4
arise	arise	UNC	1
arisen	arise	VBN	78
arises	arise	VBZ	183
arises	arises	UNC	2
arisia	arisium	NNP	5
arising	arise	VBG	162
arison	arison	NNP	3
arista	arista	NN	28
arista	arista	NNP	3
aristae	arista	NN	17
aristide	aristide	NNP	46
aristo	aristo	NN	1
aristocats	aristocat	NNP	1
aristocracy	aristocracy	NN	65
aristocracy	aristocracy	NNP	3
aristocrat	aristocrat	NN	21
aristocrat	aristocrat	JJ	1
aristocratic	aristocratic	JJ	57
aristocratic	aristocratic	NNP	2
aristocratic-mandated	aristocratic-mandated	JJ	1
aristocratically	aristocratically	RB	1
aristocrats	aristocrat	NNS	39
aristocrats	aristocrat	NNP	2
aristocrats	aristocrats	UNC	1
aristolochia	aristolochium	NNP	9
aristolochic	aristolochic	JJ	3
aristolochic	aristolochic	NNP	2
aristophanes	aristophane	NNP	9
aristoplan	aristoplan	NNP	1
aristotelian	aristotelian	NNP	7
aristotle	aristotle	NNP	51
aristrockracy	aristrockracy	NN	1
aristú	aristú	NN	1
arithmetic	arithmetic	NN	81
arithmetical	arithmetical	JJ	5
arithmetically	arithmetically	RB	3
arithmetric	arithmetric	JJ	1
aritsugu	aritsugu	NNP	1
ariv	ariv	NN	2
arivaca	arivaca	NNP	1
ariway	ariway	NN	1
arix	arix	NNP	16
arixmutation	arixmutation	NNP	1
ariya	ariya	NNP	1
ariz	ariz	NNP	64
ariz-fire-indians	ariz-fire-indian	NNP	3
arizmendi	arizmendus	NNP	2
arizona	arizona	NNP	729
arizona	arizona	NN	7
arizona	arizona	UNC	2
arizona-based	arizona-based	NNP	3
arizonan	arizonan	NNP	1
arizonans	arizonan	NNP	6
arizonarepublic	arizonarepublic	JJ	23
arjen	arjen	NNP	1
arjun	arjun	NNP	1
arjuna	arjuna	NNP	1
ark	ark	NNP	52
ark	ark	NN	10
arkaden	arkaden	NNP	2
arkadíou	arkadíou	NNP	2
arkan	arkan	NNP	4
arkan	arkan	UNC	1
arkansan	arkansan	NNP	1
arkansans	arkansan	NNP	1
arkansas	arkansa	NNP	297
arkansas	arkansas	NNP	1
arkansas-based	arkansas-based	JJ	3
arkard	arkard	NNP	1
arkart	arkart	NN	1
arkasota	arkasota	NNP	1
arked	arked	JJ	1
arkeoloji	arkeolojus	NNP	1
arkestra	arkestra	NNP	6
arkham	arkham	NNP	2
arkhipelag	arkhipelag	NNP	1
arkie	arkie	NNP	1
arkin	arkin	NNP	7
arkla	arklum	NNP	1
arkle	arkle	NNP	1
arkwright	arkwright	NNP	3
arkádi	arkádi	NNP	2
arl	arl	NNP	12
arledge	arledge	NNP	11
arlen	arlen	NNP	34
arlene	arlene	NNP	17
arlene	arlene	UNC	1
arlequin	arlequin	NNP	2
arles	arle	NN	19
arlet	arlet	NNP	1
arlett	arlett	NNP	1
arletta	arletta	NNP	3
arli	arlus	NNP	1
arlie	arlie	NNP	10
arlington	arlington	NNP	255
arlinton	arlinton	NNP	1
arliss	arliss	NNP	1
arlo	arlo	NNP	1
arlozorof	arlozorof	NNP	1
arly	arly	RB	1
arm	arm	NN	988
arm	arm	VB	39
arm	arm	UNC	3
arm	arm	NNP	3
arm-alone	arm-alone	NNP	1
arm-alone	arm-alone	JJ	1
arm-around-the-shoulder	arm-around-the-shoulder	JJ	1
arm-by-arm	arm-by-arm	JJ	1
arm-distal	arm-distal	JJ	9
arm-fz	arm-fz	JJ	4
arm-holes	arm-hole	JJ	1
arm-in-arm	arm-in-arm	JJ	1
arm-less	arm-less	JJ	1
arm-like	arm-like	JJ	1
arm-loppage	arm-loppage	JJ	1
arm-task	arm-task	JJ	2
arm-thick	arm-thick	JJ	1
arm-twisting	arm-twisting	JJ	13
arm-waving	arm-waving	JJ	1
arm-wrestle	arm-wrestle	JJ	1
arm-wrestle	arm-wrestle	NNP	1
arm-wrestles	arm-wrestle	JJ	1
arm-wrestling	arm-wrestling	JJ	1
armada	armada	NNP	6
armada	armada	NN	5
armadas	armada	NNP	1
armadillo	armadillo	NN	13
armadillo	armadillo	NNP	6
armadillos	armadillo	NNS	4
armado	armado	NNP	1
armageddon	armageddon	NN	60
armageddon	armageddon	UNC	1
armageddon-clone	armageddon-clone	NNP	1
armageddon-time	armageddon-time	NNP	1
armaggeddon	armaggeddon	NN	1
armaggedon	armaggedon	NNP	4
armagh	armagh	NNP	2
armament	armament	NN	3
armamentarium	armamentarium	NN	4
armaments	armament	NNS	8
armand	armand	NNP	11
armando	armando	NNP	9
armani	armani	UNC	1
armani	armani	NNP	1
armani	armanus	NNP	35
armapophar	armapophar	NN	2
armar	armar	NNP	1
armas	arma	NNP	13
armas	arma	NNS	1
armathwaite	armathwaite	NNP	1
armature	armature	NN	1
armação	armação	NNP	2
armband	armband	NN	2
armbands	armband	NNS	4
armbands	armband	NNP	1
armbar	armbar	NN	1
armbars	armbar	NNS	2
armbro	armbro	NNP	1
armbrust	armbrust	NNP	4
armbuster	armbuster	NNP	1
armc	armc	NNP	1
armchair	armchair	NN	28
armchair	armchair	NNP	2
armchairs	armchair	NNS	10
armdageddon	armdageddon	NNP	1
armed	arm	VBN	413
armed	armed	NNP	71
armed	armed	JJ	3
armed-citizen	armed-citizen	NNP	1
armed-forces	armed-force	JJ	1
armen	arman	NNP	16
armenia	armenium	NNP	34
armenia-specific	armenia-specific	NNP	2
armenian	armenian	JJ	48
armenian	armenian	NNP	2
armenians	armenian	NNPS	9
armeria	armerium	NNP	1
armería	armería	NNP	2
armes	arm	NNP	5
armes	arm	NNS	3
armesto	armesto	NNP	1
armey	armey	NNP	197
armey-retire	armey-retire	NNP	2
armfuls	armful	NNS	1
armholes	armhole	NNS	2
armi	armus	NNP	1
armidale	armidale	NNP	1
armies	armies	UNC	1
armies	army	NNS	112
armies	army	NNP	5
armigera	armigera	NN	3
armii	armius	NNP	1
armiles	armile	NNP	1
armin	armin	NNP	3
armina	armina	NNP	3
arming	arming	NN	37
arming	arming	NNP	3
arminio	arminio	NNP	2
armisen	armisen	NNP	1
armistead	armistead	NNP	1
armistice	armistice	NN	7
armistice	armistice	NNP	3
armitage	armitage	NNP	43
armitt	armitt	NNP	2
armload	armload	NN	2
armoire	armoire	NN	6
armoire	armoire	UNC	1
armoire	armoire	NNP	1
armoires	armoire	NNS	1
armon	armon	NNP	1
armona	armona	NNP	1
armonk	armonk	NNP	1
armor	armor	NN	81
armor	armor	UNC	1
armor-piercing	armor-piercing	JJ	1
armor-plated	armor-plated	JJ	1
armor-plating	armor-plating	JJ	1
armored	armored	JJ	46
armored	armored	NNP	4
armored-car	armored-car	JJ	1
armored-plated	armored-plated	JJ	1
armorers	armorer	NNS	2
armories	armory	NNS	1
armorique	armorique	NNP	1
armory	armory	NNP	6
armory	armory	NN	5
armour	armour	NN	6
armour	armour	NNP	1
armoured	armoured	JJ	1
armouries	armoury	NNS	1
armoury	armoury	NN	2
armpit	armpit	NN	19
armpit	armpit	NNP	3
armpits	armpit	NNS	8
armpits	armpit	NNP	1
armrest	armrest	NN	2
arms	arm	NNS	1074
arms	arm	NNP	7
arms	arms	UNC	5
arms-control	arms-control	NN	2
arms-cut	arms-cut	NNP	1
arms-dealing	arms-dealing	JJ	1
arms-for-hostages	arms-for-hostage	JJ	8
arms-manufacturing	arms-manufacturing	JJ	1
arms-pcr	arms-pcr	NNP	2
arms-reduction	arms-reduction	JJ	1
arms-selling	arms-selling	JJ	2
arms-shopping	arms-shopping	JJ	1
arms-smuggling	arms-smuggling	JJ	1
arms-toting	arms-toting	JJ	1
armstead	armstead	NNP	5
armstong	armstong	NNP	1
armstrong	armstrong	NNP	664
armstrongs	armstrong	NNP	1
armsunbending	armsunbend	VBG	1
armwrestling	armwrestle	VBG	1
army	army	NN	747
army	army	NNP	745
army	army	UNC	5
army-domestic-violence	army-domestic-violence	NNP	1
army-language	army-language	JJ	1
army-navy	army-navy	JJ	1
army-technology	army-technology	JJ	1
armée	armée	NNP	6
armó	armó	NN	1
arn	arn	NNP	4
arna	arna	NN	54
arna-based	arna-based	JJ	1
arnaldo	arnaldo	NNP	1
arnamai	arnamaus	NN	3
arnaout	arnaout	NNP	16
arnatsiaq	arnatsiaq	NNP	1
arnaud	arnaud	NNP	2
arnault	arnault	NNP	7
arnavutköy	arnavutköy	NNP	2
arnaz	arnaz	NNP	1
arndt	arndt	NNP	2
arne	arne	NNP	3
arner	arner	NNP	2
arnet	arnet	NNP	1
arnett	arnett	NNP	17
arni	arnus	NNP	1
arnica	arnica	NN	4
arnie	arnie	NNP	7
arnies	arny	NNP	1
arnies	arny	NN	1
arnimallee	arnimallee	NNP	1
arno	arno	NNP	14
arnold	arnold	NNP	250
arnold	arnold	NN	2
arnoldian	arnoldian	NNP	1
arnoldo	arnoldo	NNP	3
arnolds	arnold	NNP	1
arnolfini	arnolfinus	NNP	1
arnolfo	arnolfo	NNP	6
arnott	arnott	NNP	9
arnow	arnow	NNP	2
arnp	arnp	NNP	2
arnt	arnt	NNP	3
arntz	arntz	NNP	1
arnu	arnu	NNP	1
aroa	aroa	NN	23
aroa	aroa	NNP	15
arob	arob	NNP	7
arob	arob	NN	7
aroc	aroc	NNP	2
aroche	aroche	NNP	1
aroclor	aroclor	NN	1
arod	arod	NN	1
aroe	aroe	NNP	1
arof	arof	NN	2
arog	arog	NN	2
arogenate	arogenate	NN	9
arogenate	arogenate	NNP	1
arogenate-specificity	arogenate-specificity	JJ	1
arogers	aroger	NNS	1
aroh	aroh	NNP	5
aroh	aroh	NN	3
arok	arok	NN	1
arol	arol	NN	1
arola	arolum	NNP	2
arollos	arollo	NNS	1
aroma	aroma	NN	32
aroma	aroma	UNC	1
aroma	aroma	NNP	1
aromahealthtexas	aromahealthtexa	NNS	1
aromas	aroma	NNS	24
aromatase	aromatase	NN	12
aromatherapist	aromatherapist	NN	1
aromatherapists	aromatherapist	NNS	1
aromatherapy	aromatherapy	NN	7
aromatic	aromatic	JJ	91
aromatic	aromatic	NNP	4
aromatic-pathway	aromatic-pathway	JJ	3
aromatically	aromatically	RB	1
aromaticivorans	aromaticivoran	NNS	1
aromatics	aromatic	NNS	1
aron	aron	NNP	8
aron	aron	NN	5
arona	arona	NNP	2
aronne	aronne	NNP	3
aronofsky	aronofsky	NNP	3
aronow	aronow	NNP	1
aronowitz	aronowitz	NNP	2
arons	aron	NNP	4
aronsohn	aronsohn	NNP	1
aronson	aronson	NNP	5
arooaroo	arooaroo	NN	1
arooaroo	arooaroo	NNP	1
aroq	aroq	NNP	75
aroq	aroq	NN	28
aror	aror	NNP	6
arora	arora	NNP	1
arosa	arosa	NNP	1
arose	arise	VBD	219
arose	arose	UNC	1
aross	aross	NNS	2
arou	arou	NN	1
aroud	aroud	NN	1
around	around	IN	11694
around	around	RP	331
around	around	RB	74
around	around	UNC	25
around	around	NNP	17
around	around	JJ	4
around-comes	around-come	JJ	1
around-the	around-the	NNP	3
around-the-clock	around-the-clock	JJ	7
around-the-world	around-the-world	JJ	10
around-town	around-town	JJ	1
arounder	arounder	NNP	1
arounds	around	NNS	1
arousal	arousal	NN	18
arouse	arouse	VB	21
aroused	arouse	VBN	35
aroused	arouse	VBD	12
aroused	aroused	UNC	1
arouser	arouser	NN	1
arouses	arousee	VBZ	12
arousing	arouse	VBG	9
arowana	arowana	NN	4
arp	arp	NNP	41
arpa	arpa	NNP	1
arpana	arpana	NNP	1
arpanet	arpanet	NNP	5
arpe	arpe	NNP	22
arpeggiated	arpeggiated	JJ	1
arpeggio	arpeggio	NN	1
arpeggios	arpeggio	NNS	1
arpel	arpel	NNP	1
arpens	arpen	NNS	1
arpet	arpet	NN	1
arpey	arpey	NNP	2
arppaapp	arppaapp	NN	1
arpppapp	arpppapp	NN	1
arps	arp	NNP	4
arpád	arpád	NNP	5
arqueologica	arqueologica	NNP	1
arqueología	arqueología	NNP	2
arqueològic	arqueològic	NNP	2
arqueológico	arqueológico	NNP	15
arquett	arquett	NNP	1
arquette	arquette	NNP	33
arquette	arquette	UNC	1
arquitectes	arquitect	NNP	1
arquitectura	arquitectura	NNP	1
arr	arr	NNP	48
arr	arr	NN	1
arr-specific	arr-specific	NNP	1
arra	arra	NNP	1
arrabiata	arrabia	NN	1
arrabiatta	arrabiatta	NN	1
arrah	arrah	NN	1
arraigned	arraigned	JJ	11
arraigned	arraigned	NNP	1
arraignment	arraignment	NN	18
arraiolos	arraiolo	NNP	2
arrakis	arraki	NNP	1
arran	arran	NNP	3
arran	arran	NN	1
arrange	arrange	VB	185
arrange	arrange	NNP	9
arranged	arrange	VBD	210
arranged	arrange	VBN	177
arranged	arranged	NNP	2
arrangement	arrangement	NN	311
arrangement	arrangement	UNC	2
arrangement	arrangement	NNP	1
arrangements	arrangement	NNS	284
arrangements	arrangement	NNP	2
arrangements	arrangements	UNC	2
arrangements-in	arrangements-in	JJ	2
arranger	arranger	NN	12
arranger	arranger	NNP	1
arrangers	arranger	NNS	1
arranges	arrange	VBZ	7
arranging	arrange	VBG	69
arranging	arranging	NNP	2
arrangments	arrangment	NNS	1
arrant	arrant	NN	3
arraras	arrara	NNP	1
arras	arras	NNP	3
arras	arras	NNS	2
array	array	NN	1025
array	array	NNP	63
array-and-string	array-and-string	JJ	1
array-based	array-based	JJ	4
array-bound	array-bound	JJ	1
array-id	array-id	JJ	3
array-level	array-level	JJ	1
array-specific	array-specific	NNP	1
array-specific	array-specific	JJ	1
array-to-array	array-to-array	JJ	3
array-wise	array-wise	JJ	1
arraydesign	arraydesign	NNP	5
arraydesigns	arraydesign	NNP	2
arrayed	arrayed	JJ	28
arrayed	arrayed	NNP	1
arrayer	arrayer	NN	7
arrayexpress	arrayexpress	NNP	9
arrayexpress	arrayexpress	NNS	1
arraygroup	arraygroup	NNP	2
arraying	array	VBG	3
arraymaker	arraymaker	NNP	1
arrayoligoselector	arrayoligoselector	NNP	17
arrays	array	NNS	701
arrays	array	NNP	16
arraysuite	arraysuite	NNP	1
arraytools	arraytool	NNS	1
arrayvision	arrayvision	NNP	2
arrearage	arrearage	NN	1
arrears	arrears	NNS	9
arrears	arrears	NNP	1
arrecife	arrecife	NNP	3
arrendataria	arrendatarium	NNP	1
arrephoroi	arrephorous	NNP	1
arres	arr	NNP	1
arrest	arrest	NN	526
arrest	arrest	VB	57
arrest	arrest	NNP	9
arrest	arrest	UNC	5
arrest-associated	arrest-associated	JJ	1
arrest-proficient	arrest-proficient	JJ	1
arrest-slaying	arrest-slaying	NNP	1
arrest-story	arrest-story	JJ	1
arrested	arrest	VBN	516
arrested	arrest	VBD	103
arrested	arrested	NNP	12
arrested	arrested	UNC	3
arrestee	arrestee	NN	2
arrestees	arrestee	NNS	2
arrestin	arrestin	NN	3
arrestin	arrestin	NNP	3
arrestin-dependent	arrestin-dependent	JJ	1
arresting	arrest	VBG	55
arresting	arresting	NNP	2
arrestins	arrestin	NNP	1
arrests	arrest	NNS	123
arrests	arrest	NNP	4
arrests	arrests	UNC	1
arrests-very	arrests-very	JJ	1
arrggggh	arrggggh	NNP	1
arrgghh	arrgghh	NNP	3
arrgh	arrgh	NNP	21
arrgh	arrgh	NN	6
arrghh	arrghh	NNP	1
arrghhh	arrghhh	NNP	1
arrhenius	arrhenius	NNP	2
arrhthmia	arrhthmium	NN	1
arrhythmia	arrhythmium	NN	14
arrhythmias	arrhythmia	NNS	22
arrhythmias	arrhythmia	NNP	2
arrhythmic	arrhythmic	JJ	9
arrhythmically	arrhythmically	RB	1
arrhythmicity	arrhythmicity	NN	2
arrhythmogenic	arrhythmogenic	JJ	1
arri	arrus	NN	1
arriaga	arriaga	NNP	8
arriagada	arriagada	NNP	2
arriba	arriba	NNP	1
arrick	arrick	NN	2
arrifana	arrifana	NNP	1
arrigan	arrigan	NNP	6
arrigo	arrigo	NNP	2
arrijalu	arrijalu	NNP	1
arrington	arrington	NNP	5
arripui	arripuus	NN	1
arris	arri	NNP	1
arrison	arrison	NNP	1
arrival	arrival	NN	368
arrival	arrival	NNP	7
arrival	arrival	UNC	1
arrivals	arrival	NNS	46
arrivals	arrival	NNP	3
arrive	arrive	VB	288
arrive	arrive	VBP	133
arrive	arrive	NNP	12
arrive	arrive	UNC	1
arrived	arrive	VBD	734
arrived	arrive	VBN	179
arrived	arrived	NNP	3
arrived	arrived	UNC	2
arrivees	arrivee	NNS	1
arrives	arrive	VBZ	158
arrives	arrive	NNP	6
arriving	arrive	VBG	197
arriving	arriving	NNP	17
arriviste	arriviste	NN	1
arrivistes	arrivist	NNS	2
arrizoli	arrizoli	NNP	2
arrizón	arrizón	NNP	1
arrobas	arroba	NNS	1
arrogance	arrogance	NN	104
arrogance	arrogance	NNP	4
arrogant	arrogant	JJ	99
arrogant	arrogant	NNP	4
arrogant	arrogant	UNC	1
arrogantly	arrogantly	RB	4
arrogare	arrogare	NN	1
arrogated	arrogated	JJ	1
arrojo	arrojo	NNP	9
arromanches	arromanch	NNP	1
arron	arron	NNP	1
arrondisiment	arrondisiment	NNP	1
arrondissement	arrondissement	NN	6
arrondissements	arrondissement	NNS	2
arrot	arrot	NN	1
arrota	arrota	NN	1
arroux	arroux	NNP	1
arrow	arrow	NN	163
arrow	arrow	NNP	60
arrow	arrow	UNC	1
arrow-bearing	arrow-bearing	JJ	1
arrow-stab	arrow-stab	JJ	1
arrow-straight	arrow-straight	JJ	2
arroway	arroway	NNP	5
arrowed	arrowed	NNP	1
arrowhead	arrowhead	NN	54
arrowhead	arrowhead	NNP	4
arrowheads	arrowhead	NNS	39
arrowheads	arrowhead	NNP	1
arrowood	arrowood	NNP	3
arrows	arrow	NNS	187
arrows	arrow	NNP	10
arroyo	arroyo	NNP	6
arroyo	arroyo	NN	1
arroz	arroz	NN	3
arrozricemelocotónpeach	arrozricemelocotónpeach	NN	1
arrr-eye-pee	arrr-eye-pee	JJ	3
arrrg	arrrg	NNP	1
arrrggghghgh	arrrggghghgh	NN	1
arrrggghh	arrrggghh	NNP	1
arrrggh	arrrggh	NNP	1
arrrgh	arrrgh	NNP	8
arrrghh	arrrghh	NNP	1
arrrr	arrrr	NNP	3
arrrrggggghhhhh	arrrrggggghhhhh	NNP	1
arrrrgh	arrrrgh	NN	1
arrrrgh	arrrrgh	NNP	1
arrrrr	arrrrr	NNP	4
arrrrrgh	arrrrrgh	NNP	1
arrrrrrr	arrrrrrr	NNP	1
arrrrrrrrgh	arrrrrrrrgh	NNP	1
arrrrrrrrrgh	arrrrrrrrrgh	NNP	1
arrthymia	arrthymium	NN	1
arruda	arruda	NNP	1
arry	arry	NN	1
arrábida	arrábida	NNP	4
arráez	arráez	NNP	1
ars	ar	NNS	87
ars	ar	NNP	54
arsa	arsa	NNP	5
arsa	arsa	NN	1
arsakhanova	arsakhanova	NNP	3
arsb	arsb	NN	3
arsb	arsb	NNP	3
arsc	arsc	NN	91
arsc	arsc	NNP	3
arsd	arsd	NNP	4
arsd	arsd	NN	1
arsdmut	arsdmut	NNP	1
arse	arse	NN	21
arse	arse	NNP	1
arsed	arsed	JJ	5
arseiam	arseiam	NN	1
arsenal	arsenal	NN	72
arsenal	arsenal	NNP	2
arsenali	arsenalus	NN	1
arsenals	arsenal	NNS	12
arsenate	arsenate	NN	40
arsenate	arsenate	NNP	1
arsenault	arsenault	NNP	4
arsenec	arsenec	NNP	1
arsenic	arsenic	NN	81
arsenic	arsenic	NNP	13
arsenic-contaminated	arsenic-contaminated	JJ	2
arsenic-heavy	arsenic-heavy	JJ	1
arsenic-induced	arsenic-induced	JJ	2
arsenic-tainted	arsenic-tainted	JJ	1
arsenio	arsenio	NNP	16
arsenite	arsenite	NN	12
arsenite	arsenite	NNP	1
arsenite-cerate	arsenite-cerate	JJ	1
arsenite-specific	arsenite-specific	JJ	1
arsenite-stimulated	arsenite-stimulated	JJ	1
arsepiss	arsepiss	NNP	1
arses	arse	NNS	3
arses	arse	NNP	1
arsh	arsh	NNP	5
arsh	arsh	NN	1
arshile	arshile	NNP	1
arsi	arsus	NN	1
arsinoe	arsinoe	NNP	1
arsinoion	arsinoion	NNP	1
arsinée	arsinée	NNP	1
arson	arson	NN	28
arson	arson	NNP	2
arson-caused	arson-caused	JJ	2
arson-for-profit	arson-for-profit	JJ	1
arsonist	arsonist	NN	8
arsonists	arsonist	NNS	4
arsons	arson	NNS	3
arsons	arson	NNP	1
arsr	arsr	NN	1
arsénio	arsénio	NNP	1
art	art	NN	2506
art	art	NNP	1155
art	art	UNC	17
art	art	JJ	1
art-advisory	art-advisory	JJ	1
art-ambition	art-ambition	JJ	1
art-book	art-book	JJ	1
art-buying	art-buying	JJ	1
art-cinema	art-cinema	JJ	1
art-collection	art-collection	JJ	1
art-deco	art-deco	JJ	1
art-film	art-film	JJ	1
art-harvard	art-harvard	NNP	1
art-historical	art-historical	JJ	3
art-historically	art-historically	JJ	1
art-history-minded	art-history-minded	JJ	1
art-house	art-house	JJ	20
art-house	art-house	NNP	2
art-linkletter	art-linkletter	NNP	1
art-lover	art-lover	JJ	1
art-lovers	art-lover	JJ	2
art-mediated	art-mediated	NNP	3
art-punk	art-punk	JJ	1
art-related	art-related	JJ	2
art-rock	art-rock	JJ	1
art-school	art-school	JJ	1
art-slogan	art-slogan	JJ	1
art-song	art-song	JJ	2
art-supplies	art-supply	JJ	1
art-treated	art-treated	NNP	1
art-world	art-world	NN	2
arta	arta	NNP	4
artagnan	artagnan	NNP	6
artaud	artaud	NNP	14
artc	artc	NN	5
artd	artd	NN	25
arte	arte	NNP	30
arte	arte	NN	2
arteanunk	arteanunk	NN	1
artec	artec	NNP	1
artefact	artefact	NN	9
artefacts	artefact	NNS	11
artefactually	artefactually	RB	1
artemether	artemether	NN	3
artemia	artemium	NNP	15
artemis	artemi	NNP	25
artemisia	artemisia	NNP	126
artemisia-group	artemisia-group	NNP	1
artemisias	artemisia	NNS	4
artemisiastrum	artemisiastrum	NNP	1
artemisiatrum	artemisiatrum	NNP	1
artemisiinae	artemisiina	NNP	36
artemisinin	artemisinin	NN	5
artemisinin-based	artemisinin-based	JJ	2
artemisinins	artemisinin	NNS	2
artemisinins	artemisinin	NNP	1
artemision	artemision	NNP	1
artemon	artemon	NNP	1
artenara	artenara	NNP	1
arter	arter	NN	2
arteria	arterium	NNP	1
arterial	arterial	NN	228
arterial	arterial	NNP	9
arterialized	arterialized	JJ	1
arteries	artery	NNS	109
arteries	artery	NN	3
arteriogenesis	arteriogenesis	NNS	2
arteriography	arteriography	NN	2
arteriolar	arteriolar	NN	1
arterioles	arteriole	NNS	2
arteriolosclerosis	arteriolosclerosis	NNS	2
arteriopathy	arteriopathy	NN	3
arteriosclerosis	arteriosclerosis	NNS	5
arteriosclerotic	arteriosclerotic	JJ	1
arteriosus	arteriosus	JJ	1
arteriotomy	arteriotomy	NN	1
arteriovenous	arteriovenous	JJ	3
artery	artery	NN	239
artery	artery	NNP	4
artes	art	NNP	12
artesania	artesanium	NNP	1
artesanìas	artesanìas	NNS	1
artesanía	artesanía	NN	4
artesanía	artesanía	NNP	2
artesanías	artesanías	NNP	2
artesian	artesian	NN	3
artesonado	artesonado	NN	1
artesunate	artesunate	NN	5
arteta	arteta	NNP	2
artex	artex	NNP	2
arte­sanato	arte­sanato	NNP	1
artforum	artforum	NNP	1
artful	artful	JJ	42
artful	artful	NNP	3
artful	artful	UNC	1
artfully	artfully	RB	29
artfully	artfully	UNC	1
artfully	artfully	NNP	1
artfully-torn	artfully-torn	JJ	1
artfullyby	artfullyby	NN	1
arth	arth	NN	2
artho	artho	NNP	1
arthogenic	arthogenic	JJ	1
arthouse	arthouse	NN	1
arthouse	arthouse	NNP	1
arthouses	arthouse	NNS	1
arthousey	arthousey	NN	1
arthralgias	arthralgia	NNS	1
arthritic	arthritic	JJ	70
arthritic	arthritic	NNP	3
arthritically	arthritically	RB	1
arthritides	arthritide	NNS	5
arthritis	arthritis	NN	414
arthritis	arthritis	NNP	7
arthritis	arthritis	UNC	1
arthritis-hobbled	arthritis-hobbled	JJ	1
arthritis-resistant	arthritis-resistant	JJ	1
arthritis-susceptible	arthritis-susceptible	JJ	1
arthritogenic	arthritogenic	JJ	2
arthrocentesis	arthrocentesis	NNS	1
arthroconidia	arthroconidium	NN	2
arthropathies	arthropathy	NNS	4
arthropathy	arthropathy	NN	6
arthroplasties	arthroplasty	NNS	1
arthroplasty	arthroplasty	NN	19
arthropod	arthropod	NN	8
arthropod-chordate	arthropod-chordate	JJ	1
arthropoda	arthropoda	NNP	4
arthropods	arthropod	NNS	20
arthropods	arthropod	NNP	1
arthroraphis	arthroraphi	NNP	1
arthroscopic	arthroscopic	JJ	11
arthroscopically	arthroscopically	RB	1
arthroscopy	arthroscopy	NN	3
arthur	arthur	NNP	497
arthurian	arthurian	JJ	7
arthurs	arthur	NNP	1
arti	arti	NN	1
arti	artus	NNP	1
artic	artic	NNP	3
artical	artical	JJ	1
artichoke	artichoke	NN	26
artichoke	artichoke	NNP	1
artichokes	artichoke	NNS	8
article	article	NN	3055
article	article	NNP	42
article	article	UNC	10
article	article	JJ	1
articleid	articleid	NN	1
articles	article	NNS	984
articles	article	NNPS	22
articles	article	NNP	2
articles	articles	UNC	6
articles	articles	JJ	1
articles-the	articles-the	JJ	1
articular	articular	NN	27
articular	articular	NNP	1
articulate	articulate	VB	148
articulate	articulate	NNP	3
articulated	articulated	JJ	67
articulated	articulated	NNP	1
articulately	articulately	RB	2
articulates	articulate	NNS	11
articulating	articulate	VBG	13
articulating	articulating	NNP	1
articulation	articulation	NN	18
articulations	articulation	NNS	1
articulators	articulator	NNS	1
articulatory	articulatory	NN	6
articulatory	articulatory	NNP	1
artie	artie	NNP	5
artiellia	artiellium	NN	3
artier	artier	NN	3
artifact	artifact	NN	87
artifact	artifact	NNP	1
artifact-free	artifact-free	JJ	3
artifact-y	artifact-y	JJ	1
artifacts	artifact	NNS	322
artifacts	artifact	NNP	4
artifactual	artifactual	NN	30
artifactually	artifactually	RB	5
artifical	artifical	JJ	1
artifice	artifice	NN	31
artifice	artifice	UNC	1
artificer	artificer	NN	1
artifices	artifice	NNS	1
artificial	artificial	JJ	364
artificial	artificial	NNP	13
artificial	artificial	NN	6
artificial-intelligence	artificial-intelligence	JJ	1
artificial-vision	artificial-vision	JJ	1
artificiality	artificiality	NN	4
artificially	artificially	RB	61
artificially	artificially	NNP	2
artificially	artificially	UNC	1
artillery	artillery	NN	53
artillery	artillery	NNP	5
artillery	artillery	UNC	2
artillery-wielding	artillery-wielding	JJ	1
artilleryman	artilleryman	NN	1
artillerymen	artilleryman	NN	1
artillerymen	artilleryman	NNP	1
artimedes	artimede	NNP	1
artin	artin	NNP	3
artiness	artiness	NNS	1
artis	arti	NNP	10
artisan	artisan	NN	13
artisan	artisan	NNP	13
artisanal	artisanal	NN	16
artisanal	artisanal	NNP	3
artisans	artisan	NNS	67
artisans	artisan	NNP	3
artist	artist	NN	669
artist	artist	NNP	57
artist	artist	UNC	6
artist-blacksmith	artist-blacksmith	JJ	1
artist-phenomenon	artist-phenomenon	JJ	1
artiste	artiste	NN	4
artistes	artist	NNS	3
artistic	artistic	JJ	354
artistic	artistic	NNP	13
artistic	artistic	UNC	1
artistic-like	artistic-like	JJ	1
artistically	artistically	RB	22
artistically	artistically	UNC	2
artistically	artistically	NNP	2
artistry	artistry	NN	25
artists	artist	NNS	800
artists	artist	NNP	78
artists	artists	UNC	2
artists-u	artists-u	NNP	1
artless	artless	JJ	8
artless	artless	NNP	1
artlessly	artlessly	RB	3
artlessness	artlessness	NNS	5
artnet	artnet	NNP	5
artnews	artnew	NNP	2
arto	arto	NNP	1
artrell	artrell	NNP	1
artrutx	artrutx	NNP	1
arts	art	NNS	561
arts	art	NNP	426
arts	art	NNPS	1
arts	arts	UNC	2
arts-and-crafts	arts-and-craft	JJ	3
arts-and-craftsy	arts-and-craftsy	JJ	1
arts-index-worthy	arts-index-worthy	JJ	1
arts-like	arts-like	JJ	1
arts-n-crafts	arts-n-craft	JJ	1
arts-only	arts-only	JJ	1
arts-section	arts-section	JJ	1
arts-service	arts-service	JJ	1
artsier	artsier	NN	1
artstrings	artstring	NNS	1
artsy	artsy	JJ	12
artsy-craftsy	artsy-craftsy	JJ	1
artsy-fartsies	artsy-fartsy	JJ	2
artsy-fartsy	artsy-fartsy	JJ	3
artur	artur	NNP	3
arturo	arturo	NNP	6
artwork	artwork	NN	54
artwork	artwork	NNP	3
artworks	artwork	NNS	21
arty	arty	NN	19
arty	arty	NNP	3
artystyczna	artystyczna	NNP	1
artà	artà	NNP	6
aru	aru	NNP	1
arub	arub	NNP	2
aruba	aruba	NNP	5
arucas	aruca	NNP	2
arugula	arugulum	NN	15
arugula	arugulum	NNP	4
arukeba	arukeba	NN	1
aruldhas	aruldha	NNP	1
aruldhases	aruldhase	NNP	1
arum	arum	NN	1
arun	arun	NNP	2
arunachal	arunachal	NNP	1
arundel	arundel	NNP	6
arundhati	arundhatus	NNP	11
arup	arup	NNP	1
arure	arure	NNP	2
arusha	arusha	NNP	3
arv	arv	NNP	31
arv	arv	NN	1
arv-implementation	arv-implementation	NNP	1
arvada	arvada	NNP	1
arvato	arvato	NNP	1
arvensis	arvensis	NNS	1
arvey	arvey	NNP	1
arvigarus	arvigarus	NNP	1
arvin	arvin	NNP	3
arvind	arvind	NNP	1
arvo	arvo	NNP	6
arvs	arv	NNP	54
arvydas	arvyda	NNP	1
arway	arway	NNP	1
arwen	arwen	NNP	9
ary	ary	JJ	2
aryabhatt	aryabhatt	NNP	1
aryan	aryan	NNP	20
aryans	aryan	NNP	14
aryeh	aryeh	NNP	3
aryl	aryl	NN	11
arylacetamide	arylacetamide	NN	1
arylacetamide	arylacetamide	NNP	1
aryland	aryland	NN	1
arz	arz	NNP	1
arzey-garzeys	arzey-garzey	JJ	2
arzú	arzú	NNP	1
arènes	arènes	NNP	3
arènes	arènes	NNS	2
as	as	IN	107588
as	as	RB	17107
as	as	UNC	431
as	as	NNP	244
as	as	JJ	65
as	as	NN	7
as-excellent	as-excellent	JJ	1
as-hell	as-hell	JJ	1
as-if	as-if	JJ	1
as-is	as-i	JJ	1
as-long-as-it	as-long-as-it	JJ	1
as-needed	as-needed	JJ	1
as-of-yet	as-of-yet	JJ	1
as-one	as-one	JJ	1
as-promised	as-promised	JJ	1
as-specific	as-specific	NNP	3
as-sukuut	as-sukuut	JJ	1
as-told-to	as-told-to	JJ	1
as-treated	as-treated	JJ	3
as-yet	as-yet	RB	8
as-yet-unborn	as-yet-unborn	JJ	1
as-yet-uncommitted	as-yet-uncommitted	JJ	1
as-yet-undescribed	as-yet-undescribed	JJ	1
as-yet-undetermined	as-yet-undetermined	JJ	1
as-yet-undiscovered	as-yet-undiscovered	JJ	1
as-yet-unexplored	as-yet-unexplored	JJ	1
as-yet-ungentrified	as-yet-ungentrified	JJ	1
as-yet-unheard	as-yet-unheard	JJ	1
as-yet-unidentified	as-yet-unidentified	JJ	1
as-yet-unknown	as-yet-unknown	JJ	2
as-yet-untold	as-yet-untold	JJ	2
as-yet-untouched	as-yet-untouched	JJ	1
as-yet-unwritten	as-yet-unwritten	JJ	1
as-you-go	as-you-go	JJ	1
asa	asa	NNP	32
asa-pilot	asa-pilot	NNP	2
asada	asada	NN	1
asado	asado	NN	1
asaf	asaf	NNP	1
asah	asah	NNP	1
asahi	asahus	NNP	47
asaichi	asaichus	NNP	1
asakura	asakura	NNP	1
asakusa	asakusa	NNP	12
asal	asal	NNP	1
asalto	asalto	NNP	1
asamblea	asamblea	NN	1
asamoah	asamoah	NNP	1
asan	asan	NNP	6
asano	asano	NNP	6
asante	asante	NNP	1
asantes	asant	NNP	1
asap	asap	NNP	42
asap	asap	NN	6
asappropriate	asappropriate	NN	1
asb	asb	NNP	1
asbestos	asbestos	NN	56
asbestos	asbestos	NNP	1
asbestos-related	asbestos-related	JJ	2
asbetsos	asbetso	NNS	1
asbhy	asbhy	NNP	1
asbt	asbt	NN	51
asbt	asbt	NNP	1
asbury	asbury	NNP	13
asc	asc	NNP	2
ascain	ascain	NNP	1
ascap	ascap	NNP	1
ascared	ascared	JJ	2
ascarid	ascarid	NN	2
ascarid	ascarid	NNP	1
ascaris	ascari	NNP	7
ascaris	ascari	NNS	1
ascend	ascend	NN	36
ascend	ascend	NNP	2
ascendance	ascendance	NN	13
ascendancy	ascendancy	NN	24
ascendancy	ascendancy	NNP	6
ascendant	ascendant	NN	4
ascended	ascended	JJ	42
ascended	ascended	NNP	1
ascendent	ascendent	NN	3
ascending	ascend	VBG	70
ascending	ascending	NNP	1
ascending-bid	ascending-bid	JJ	1
ascending-bid	ascending-bid	NNP	1
ascends	ascend	NNS	12
ascendy	ascendy	NNP	2
ascension	ascension	NN	25
ascension	ascension	NNP	8
ascent	ascent	NN	50
ascent	ascent	NNP	12
ascent	ascent	UNC	1
ascents	ascent	NNS	7
ascertain	ascertain	VB	74
ascertainable	ascertainable	JJ	1
ascertained	ascertained	JJ	46
ascertained	ascertained	UNC	1
ascertaining	ascertain	VBG	7
ascertainment	ascertainment	NN	21
ascertainment	ascertainment	NNP	1
ascesis	ascesis	NNS	1
ascetic	ascetic	JJ	20
asceticism	asceticism	NN	7
asceticism	asceticism	UNC	1
ascetics	ascetic	NNS	1
asch	asch	NNP	6
aschatz	aschatz	NN	3
aschenbrenner	aschenbrenner	NNP	3
ascher	ascher	NNP	9
aschoffs	aschoff	NNP	1
aschroft	aschroft	NNP	1
asci	ascus	NNP	13
asci	ascus	NN	8
ascidians	ascidian	NNS	2
ascii	ascius	NNP	12
ascii	ascius	NN	4
ascii-based	ascii-based	NNP	2
ascites	ascite	NNS	12
ascitic	ascitic	JJ	8
asclepieion	asclepieion	NNP	1
asclepion	asclepion	NNP	3
asclepium	asclepium	NNP	1
asclepius	asclepius	NNP	1
asco	asco	NN	1
ascomycetes	ascomycete	NNS	4
ascomycota	ascomycota	NNP	3
ascorbate	ascorbate	NN	4
ascorbate	ascorbate	NNP	1
ascorbic	ascorbic	JJ	32
ascorbic	ascorbic	NNP	2
ascot	ascot	NNP	5
ascot	ascot	NN	1
ascovirus	ascovirus	JJ	1
ascr	ascr	NNP	13
ascribable	ascribable	JJ	4
ascribe	ascribe	VBP	24
ascribe	ascribe	NNP	1
ascribed	ascribe	VBN	54
ascribes	ascribe	NNS	5
ascribing	ascribe	VBG	6
ascription	ascription	NN	3
ascus	ascus	JJ	2
ascvd	ascvd	NNP	4
asd	asd	NNP	8
asdlkjd	asdlkjd	NN	1
ase	ase	NN	55
ase	ase	NNP	1
ase-vacuolar	ase-vacuolar	JJ	1
asebogenin	asebogenin	NNP	1
asebogenin	asebogenin	NN	1
asec	asec	NN	1
asecond	asecond	NNP	2
asee	asee	NNP	1
aseem	aseem	NNP	1
asefi	asefus	NNP	1
aseida	aseida	NNP	3
aseltine	aseltine	NNP	1
asemissions	asemission	NNS	1
asenali	asenalus	NN	1
asending	asend	VBG	1
aseparate	aseparate	NN	1
aseptic	aseptic	JJ	6
aseptically	aseptically	RB	4
ases	ase	NNS	9
asexual	asexual	NN	52
asexual	asexual	NNP	1
asexuality	asexuality	NN	2
asexuality	asexuality	NNP	1
asexually	asexually	RB	7
asexually	asexually	UNC	1
asexually-produced	asexually-produced	JJ	2
asexuals	asexual	NNP	1
aseyi	aseyus	NN	1
asf	asf	NNP	5
asfar	asfar	NNP	1
asfarviruses	asfarvirus	NNS	1
asfendiou	asfendiou	NNP	1
asgods	asgod	NNS	2
ash	ash	NNP	124
ash	ash	NN	86
ash	ash	UNC	1
ash-covered	ash-covered	JJ	3
ash-filled	ash-filled	JJ	1
ash-swept	ash-swept	JJ	1
ash-tree	ash-tree	JJ	1
asha	asha	NNP	2
ashall	ashall	NNP	1
asham	asham	NNP	1
ashamed	ashamed	JJ	119
ashamed	ashamed	NNP	1
ashanti	ashantus	NNP	8
asharq	asharq	NNP	14
ashbery	ashbery	NNP	6
ashbrook	ashbrook	NNP	1
ashburn	ashburn	NNP	2
ashburner	ashburner	NNP	1
ashbury	ashbury	NNP	9
ashby	ashby	NNP	35
ashcroft	ashcroft	NNP	304
ashcroft-guns	ashcroft-gun	NNP	1
ashcroft-ian	ashcroft-ian	NNP	1
ashdown	ashdown	NNP	1
ashe	ashe	NNP	13
asheim	asheim	NNP	2
ashen	ashen	NN	7
ashen-faced	ashen-faced	JJ	1
ashenfelter	ashenfelter	NNP	4
asher	asher	NNP	17
ashes	ash	NNS	76
ashes	ash	NNP	22
asheville	asheville	NNP	8
ashford	ashford	NNP	11
ashforth	ashforth	NNP	1
ashi	ashus	NNP	3
ashif	ashif	NNP	1
ashikaga	ashikaga	NNP	6
ashing	ash	VBG	1
ashinstitute	ashinstitute	NN	1
ashish	ashish	NN	3
ashitaka	ashitaka	NNP	6
ashkanazi	ashkanazus	NNP	1
ashkelon	ashkelon	NNP	1
ashkenaz	ashkenaz	NNP	4
ashkenazi	ashkenazus	NNP	10
ashkenazic	ashkenazic	NNP	2
ashkenazim	ashkenazim	NNP	3
ashkenazy	ashkenazy	NNP	1
ashkhabad	ashkhabad	NNP	1
ashkin	ashkin	NNP	3
ashland	ashland	NNP	3
ashlars	ashlar	NNS	3
ashleighs	ashleigh	NNP	1
ashley	ashley	NNP	73
ashleyism	ashleyism	NNP	1
ashleys	ashley	NNP	1
ashman	ashman	NNP	1
ashmeadi	ashmeadus	NN	1
ashmolean	ashmolean	NNP	2
ashness	ashness	NNP	2
ashok	ashok	NNP	2
ashoka	ashoka	NNP	27
ashord	ashord	NNP	1
ashore	ashore	RB	42
ashore	ashore	NNP	4
ashores	ashore	NNS	1
ashour	ashour	NNP	1
ashowed	ashowed	NNP	1
ashows	ashow	NNP	38
ashows	ashow	NNS	23
ashrae	ashra	NNP	3
ashraf	ashraf	NNP	3
ashraf	ashraf	NN	1
ashram	ashram	NN	2
ashram	ashram	NNP	1
ashrams	ashram	NNS	1
ashrawi	ashrawus	NNP	1
ashtabula	ashtabulum	NNP	1
ashtanga	ashtanga	NN	2
ashtareth	ashtareth	NNP	6
ashton	ashton	NNP	24
ashtown	ashtown	NNP	1
ashtray	ashtray	NN	15
ashtray	ashtray	NNP	1
ashtrays	ashtray	NNS	2
ashutosh	ashutosh	NNP	1
ashville	ashville	NNP	1
ashwander	ashwander	NNP	1
ashy	ashy	NN	5
asi	asus	NNP	4
asi	asus	NN	2
asia	asia	NNP	15
asia	asia	UNC	1
asia	asium	NNP	730
asia	asium	NN	1
asia-focused	asia-focused	NNP	1
asia-including	asia-including	NNP	1
asia-specific	asia-specific	NNP	1
asiadontic	asiadontic	NNP	1
asiago	asiago	NN	1
asialo	asialo	NNP	1
asialo	asialo	NN	1
asian	asian	JJ	582
asian	asian	NNP	187
asian	asian	NN	9
asian-americans	asian-american	NNP	2
asian-built	asian-built	NNP	2
asian-plurality	asian-plurality	NNP	1
asian-style	asian-style	NNP	2
asianlens	asianlen	NNP	1
asians	asian	NNPS	101
asians	asian	NNP	2
asians	asians	UNC	2
asians	asians	NNP	1
asiarch	asiarch	NNP	1
asiatic	asiatic	NNP	11
asics	asic	NNP	2
asida	asida	NNP	1
aside	aside	RB	978
aside	aside	UNC	6
aside	aside	NNP	2
asides	aside	NNS	24
asile	asile	NNP	1
asilidae	asilida	NNP	1
asimakis	asimaki	NNS	2
asimilar	asimilar	NNP	1
asimov	asimov	NNP	50
asimplified	asimplified	NNP	1
asin	asin	NNP	2
asinara	asinara	NNP	1
asinelli	asinellus	NNP	1
asingleaddress	asingleaddress	NNS	1
asingsing	asingsing	NNP	1
asinine	asinine	NN	10
asinus	asinus	JJ	1
asir	asir	NNP	1
ask	ask	VB	2458
ask	ask	VBP	589
ask	ask	NNP	14
ask	ask	UNC	6
ask	ask	NN	1
ask	ask	JJ	1
ask-ee	ask-ee	NNP	1
ask-notting	ask-notting	JJ	1
askance	askance	NN	15
askanischer	askanischer	NNP	1
askar	askar	NNP	5
asked	ask	VBD	3043
asked	ask	VBN	1266
asked	asked	NNP	9
asked	asked	UNC	4
asked	asked	JJ	4
asked-for	asked-for	JJ	1
asked-or	asked-or	JJ	1
asked-whether	asked-whether	JJ	1
askedtenet	askedtenet	NN	1
askeeeeert	askeeeeert	NNP	3
askeered	askeered	JJ	1
askeert	askeert	NN	1
askeri	askerus	NNP	1
askes	ask	NNS	1
askew	askew	NN	11
askew	askew	NNP	3
askey	askey	NNP	1
askeye	askeye	NNP	1
askham	askham	NNP	3
askign	askign	NN	1
askin	askin	NNP	1
askin	askin	NN	1
asking	ask	VBG	1322
asking	asking	NN	32
asking	asking	NNP	19
asking	asking	UNC	2
asking	asking	JJ	1
askjeeves	askjeeve	NNP	2
askl	askl	NN	1
asklepios	asklepio	NNP	1
askme	askme	NNP	4
asko	asko	NNP	1
askomantoura	askomantoura	NN	1
asks	ask	VBZ	597
asks	ask	NNP	9
asks	asks	UNC	2
askthem	askthem	NN	1
askye	askye	NN	36
askye	askye	NNP	30
askyefic	askyefic	JJ	1
asl	asl	NNP	4
aslakhanov	aslakhanov	NNP	1
aslam	aslam	NNP	1
aslama	aslama	NN	2
aslan	aslan	NNP	3
aslan	aslan	NN	1
aslanbek	aslanbek	NNP	1
asleep	asleep	RB	240
asleep	asleep	NNP	2
asleep	asleep	UNC	1
asleeponthesofa	asleeponthesofa	NN	1
asli	aslus	NNP	4
aslihan	aslihan	NNP	1
aslippage	aslippage	NN	1
aslund	aslund	NNP	1
asm	asm	NNP	2
asma	asma	NNP	10
asme	asme	NNP	2
asmurai	asmuraus	NNP	2
asmussen	asmussen	NNP	4
asn	asn	NNP	43
asnd	asnd	NN	1
asner	asner	NNP	2
asnrs	asnr	NNP	2
asns	asn	NN	1
aso	aso	NNP	10
asocial	asocial	NN	1
asokan	asokan	NNP	1
asomáton	asomáton	NNP	1
asp	asp	NNP	73
asp	asp	NN	24
asp	asp	UNC	1
asp-fluoromethyl	asp-fluoromethyl	NNP	2
asp-fluromethyl-ketone	asp-fluromethyl-ketone	NNP	1
asp-fluromethylketone	asp-fluromethylketone	NNP	1
asp-t	asp-t	NNP	1
asparagine	asparagine	NN	20
asparagine	asparagine	NNP	1
asparagines	asparagine	NNS	2
asparagines-linked	asparagines-linked	JJ	1
asparaginyl-t	asparaginyl-t	JJ	2
asparagus	asparagus	JJ	34
asparagus	asparagus	NNP	9
asparagus-face	asparagus-face	JJ	1
aspargus	aspargus	JJ	1
aspart	aspart	NN	1
aspartame	aspartame	NN	2
aspartataminotransferase	aspartataminotransferase	NN	1
aspartate	aspartate	NN	49
aspartate	aspartate	NNP	1
aspartate-glutamate	aspartate-glutamate	JJ	1
aspartate-glutamate-rich	aspartate-glutamate-rich	JJ	1
aspartates	aspartate	NNS	2
aspartic	aspartic	JJ	26
aspartic	aspartic	NNP	1
aspartokinase	aspartokinase	NN	4
aspartyl	aspartyl	NN	7
aspartyl-glycine	aspartyl-glycine	JJ	1
aspartyl-t	aspartyl-t	JJ	1
aspasia	aspasium	NNP	1
aspc	aspc	NNP	5
aspca	aspca	NNP	4
aspdin	aspdin	NNP	1
aspe	aspe	NNP	1
aspect	aspect	NN	547
aspect	aspect	NNP	5
aspectos	aspecto	NNS	1
aspects	aspect	NNS	683
aspects	aspect	NNP	11
aspects	aspects	UNC	1
aspen	aspen	NNP	42
aspen	aspen	NN	13
aspens	aspen	NNS	2
asper	asper	NN	1
asperger	asperger	NNP	3
aspergillis	aspergilli	NNP	1
aspergillosis	aspergillosis	NNS	1
aspergillus	aspergillus	NNP	6
asperity	asperity	NN	2
aspermont	aspermont	NNP	1
aspersion	aspersion	NN	6
aspersions	aspersion	NNS	10
aspersions	aspersion	NNP	1
aspesi	aspesus	NNP	1
aspex	aspex	NNP	1
asphalt	asphalt	NN	49
asphalt	asphalt	NNP	8
asphyxia	asphyxia	NN	2
asphyxiate	asphyxiate	NN	3
asphyxiated	asphyxiated	JJ	4
asphyxiation	asphyxiation	NN	8
aspidistra	aspidistra	NN	1
aspin	aspin	NNP	1
aspirant	aspirant	NN	5
aspirants	aspirant	NNS	3
aspirate	aspirate	NN	9
aspirated	aspirated	JJ	27
aspirated	aspirated	NNP	1
aspirates	aspirate	NNS	5
aspiration	aspiration	NN	74
aspiration	aspiration	NNP	1
aspirational	aspirational	NN	8
aspirationally	aspirationally	RB	1
aspirations	aspiration	NNS	80
aspirations	aspiration	NNP	1
aspire	aspire	VBP	47
aspired	aspire	VBD	17
aspires	aspire	VBZ	24
aspirin	aspirin	NN	186
aspirin	aspirin	NNP	14
aspirin-treated	aspirin-treated	JJ	6
aspirin-treated	aspirin-treated	NNP	1
aspiring	aspiring	JJ	51
aspiring	aspiring	NNP	4
aspiring-to-gentility	aspiring-to-gentility	JJ	1
asplin	asplin	NNP	1
asplund	asplund	NNP	1
aspm	aspm	NNP	5
aspma	aspma	NNP	1
aspma	aspma	NN	1
asprin	asprin	NN	1
asprin-y	asprin-y	JJ	1
asps	asp	NNP	8
aspweb	aspweb	NNP	1
asqc	asqc	NNP	2
asquith	asquith	NNP	1
asra	asra	NNP	1
asrequired	asrequired	JJ	4
asrna	asrna	NNP	6
asrv	asrv	NNP	8
ass	ass	NNS	873
ass	ass	NNP	77
ass	ass	JJ	2
ass	ass	UNC	1
ass-backward	ass-backward	JJ	2
ass-backwards	ass-backward	JJ	1
ass-carressing	ass-carressing	JJ	1
ass-coverage	ass-coverage	JJ	1
ass-face	ass-face	JJ	2
ass-fat	ass-fat	JJ	1
ass-happy	ass-happy	NNP	1
ass-head	ass-head	JJ	1
ass-kicking	ass-kicking	JJ	7
ass-kickingness	ass-kickingness	JJ	1
ass-kissy	ass-kissy	JJ	1
ass-over-teakettle	ass-over-teakettle	JJ	1
ass-play	ass-play	JJ	1
ass-pull	ass-pull	JJ	4
ass-pully	ass-pully	NNP	1
ass-pully	ass-pully	JJ	1
ass-ramming	ass-ramming	JJ	1
ass-stompin	ass-stompin	NNP	1
ass-talking	ass-talking	JJ	1
ass-ticks	ass-tick	NNP	2
ass-whipping	ass-whipping	JJ	1
ass-whuppin	ass-whuppin	JJ	1
ass-wiggling	ass-wiggling	JJ	1
assad	assad	NNP	24
assail	assail	NN	5
assail	assail	NNP	1
assailant	assailant	NN	15
assailants	assailant	NNS	13
assailants	assailant	NNP	1
assailed	assail	VBD	20
assailed	assail	VBN	13
assailed	assailed	NNP	1
assailing	assail	VBG	7
assailing	assailing	NNP	1
assails	assail	NNS	6
assails	assail	NNP	1
assam	assam	NNP	8
assamese	assamese	NNP	1
assanine	assanine	NNP	2
assante	assante	NNP	4
assart	assart	NN	1
assasinated	assasinated	JJ	1
assasination	assasination	NN	7
assasination	assasination	JJ	1
assasinations	assasination	NNS	2
assasinations	assasination	NNP	1
assassin	assassin	NN	53
assassin	assassin	UNC	1
assassin	assassin	NNP	1
assassinate	assassinate	VB	34
assassinated	assassinate	VBN	46
assassinated	assassinate	VBD	24
assassinated	assassinated	NNP	1
assassinating	assassinate	VBG	14
assassination	assassination	NN	198
assassination	assassination	NNP	11
assassination-was	assassination-wa	JJ	1
assassinations	assassination	NNS	25
assassinations	assassination	NNP	1
assassines	assassine	NNP	1
assassinologists	assassinologist	NNP	1
assassins	assassin	NNS	20
assassins	assassin	NNP	7
assassins	assassins	UNC	1
assassins-then	assassins-then	JJ	1
assata	assa	NNP	2
assault	assault	NN	339
assault	assault	NNP	11
assault	assault	VBP	9
assault	assault	UNC	4
assault-type	assault-type	JJ	1
assault-weapon	assault-weapon	JJ	1
assault-weapons	assault-weapon	JJ	2
assault-with-a-deadly-weapon	assault-with-a-deadly-weapon	JJ	2
assaulted	assaulted	JJ	41
assaulting	assault	VBG	18
assaultive	assaultive	JJ	1
assaults	assault	NNS	67
assaults	assault	NNP	19
assay	assay	NN	1183
assay	assay	NNP	72
assayas	assaya	NNP	1
assayed	assayed	JJ	208
assayed	assayed	NNP	2
assaying	assay	VBG	11
assays	assay	NNS	677
assays	assay	NNP	41
assays	assays	UNC	1
asscap	asscap	NNP	4
asscap	asscap	NN	1
asscapitude	asscapitude	NN	1
asscappage	asscappage	NN	2
asscaps	asscap	NNP	12
asscaps	asscap	NNS	10
assclown	assclown	NN	3
assclown	assclown	NNP	2
asscrack	asscrack	NN	1
asscroft	asscroft	NNP	1
assed	assed	JJ	5
assemblage	assemblage	NN	20
assemblages	assemblage	NNS	2
assemble	assemble	VB	116
assemble	assemble	VBP	20
assemble	assemble	NNP	2
assemble-arms	assemble-arm	NNP	1
assembled	assemble	VBN	266
assembled	assemble	VBD	71
assembled	assembled	NNP	3
assembled	assembled	UNC	1
assembler	assembler	NN	15
assembler	assembler	NNP	1
assemblers	assembler	NNS	5
assembles	assemble	NNS	14
assemblesubclone	assemblesubclone	NN	1
assemblesubclone	assemblesubclone	NNP	1
assemblies	assembly	NNS	121
assemblies	assembly	NNP	2
assembling	assemble	VBG	61
assembling	assembling	NNP	4
assembly	assembly	NN	692
assembly	assembly	NNP	134
assembly	assembly	UNC	3
assembly-corrected	assembly-corrected	JJ	3
assembly-line	assembly-line	NN	11
assembly-line	assembly-line	NNP	1
assembly-room	assembly-room	JJ	1
assembly-state	assembly-state	JJ	1
assemblyman	assemblyman	NN	5
assemblyman	assemblyman	NNP	5
assemblywoman	assemblywoman	NNP	2
assemblée	assemblée	NNP	3
assemby	assemby	NN	1
assen	assen	NNP	1
assend	assend	NN	1
assension	assension	NNP	1
assent	assent	NN	20
assented	assented	JJ	8
assenting	assent	VBG	1
assers	asser	NNS	1
assersohn	assersohn	NNP	1
assert	assert	VB	95
assert	assert	VBP	32
assert	assert	NNP	6
assert	assert	UNC	1
asserted	assert	VBD	109
asserted	assert	VBN	25
asserted	asserted	UNC	1
assertibility	assertibility	NN	1
asserting	assert	VBG	73
asserting	asserting	UNC	1
asserting	asserting	NNP	1
assertion	assertion	NN	213
assertion	assertion	JJ	1
assertion	assertion	NNP	1
assertions	assertion	NNS	92
assertions	assertion	NNP	5
assertive	assertive	JJ	29
assertively	assertively	RB	3
assertiveness	assertiveness	NNS	11
asserts	assert	VBZ	143
asserts	assert	NNP	1
asserts	asserts	UNC	2
asses	ass	NNS	55
asses	ass	NNP	6
assess	assess	VB	755
assess	assess	VBP	41
assess	assess	NNP	24
assess-or	assess-or	JJ	1
assess-roll	assess-roll	NNP	1
assessable	assessable	JJ	1
assessed	assess	VBN	490
assessed	assess	VBD	108
assesses	assess	NNS	57
assessible	assessible	JJ	2
assessing	assess	VBG	273
assessing	assessing	NNP	82
assessing	assessing	UNC	1
assessingrisksandreturns	assessingrisksandreturn	NNP	1
assessment	assessment	NN	935
assessment	assessment	NNP	218
assessment	assessment	UNC	1
assessment-and	assessment-and	JJ	1
assessment-performing	assessment-performing	JJ	1
assessments	assessment	NNS	196
assessments	assessment	NNP	17
assessments	assessments	UNC	2
assessor	assessor	NN	4
assessor	assessor	NNP	2
assessors	assessor	NNS	3
asset	asset	NN	236
asset	asset	NNP	31
asset	asset	UNC	2
asset-building	asset-building	JJ	1
asset-intensive	asset-intensive	JJ	1
asset-its	asset-it	JJ	1
asset-market	asset-market	JJ	1
asset-our	asset-our	JJ	1
asset-public	asset-public	JJ	1
asset-two-thirds	asset-two-third	JJ	1
asseth	asseth	NN	1
assets	asset	NNS	778
assets	asset	NNPS	21
assets	asset	NNP	14
assets	assets	UNC	3
assets-has	assets-ha	JJ	1
assets-have	assets-have	JJ	1
assets-particularly	assets-particularly	JJ	1
assets-that	assets-that	JJ	1
assets-the	assets-the	JJ	1
asseverating	asseverate	VBG	1
assface	assface	NNP	6
assface	assface	NN	2
asshat	asshat	NN	8
asshat	asshat	NNP	1
asshats	asshat	NNP	2
assheads	asshead	NNS	3
asshole	asshole	NN	72
asshole	asshole	NNP	5
asshole-junkie	asshole-junkie	JJ	1
assholemoronbastard	assholemoronbastard	NNP	1
assholery	assholery	NN	2
assholes	asshole	NNS	27
assholes	asshole	NNP	2
assholetude	assholetude	NN	1
assholish	assholish	NN	3
assholishness	assholishness	NNS	1
assia	assium	NNP	1
assicot	assicot	NNP	1
assiduous	assiduous	JJ	10
assiduously	assiduously	RB	23
assiduously	assiduously	NNP	1
assign	assign	VB	154
assign	assign	VBP	35
assign	assign	NNP	3
assignable	assignable	JJ	4
assignation	assignation	NNP	1
assignations	assignation	NNS	3
assigned	assign	VBN	759
assigned	assigned	NNP	5
assignees	assignee	NNS	1
assigner	assigner	NN	1
assigning	assign	VBG	91
assigning	assigning	NNP	6
assignment	assignment	NN	343
assignment	assignment	NNP	15
assignment	assignment	UNC	2
assignments	assignment	NNS	203
assignments	assignment	NNP	7
assignments	assignments	UNC	2
assigns	assign	VBZ	47
assim	assim	NN	1
assimilable	assimilable	JJ	2
assimilate	assimilate	VB	22
assimilated	assimilated	JJ	36
assimilated	assimilated	NNP	1
assimilates	assimilate	NNS	2
assimilating	assimilate	VBG	6
assimilating	assimilating	NNP	2
assimilation	assimilation	NN	41
assimilation	assimilation	NNP	3
assimilation	assimilation	UNC	1
assimilationist	assimilationist	NN	2
assimliate	assimliate	NNP	1
assiniboin	assiniboin	NNP	1
assiniboine	assiniboine	NNP	3
assisant	assisant	NN	1
assisi	assisus	NNP	27
assissi	assissus	NNP	1
assist	assist	VB	302
assist	assist	VBP	22
assist	assist	NNP	3
assist	assist	UNC	1
assist-turnover	assist-turnover	JJ	1
assistance	assistance	NN	955
assistance	assistance	NNP	263
assistance	assistance	UNC	1
assistances	assistance	NNS	1
assistant	assistant	NN	508
assistant	assistant	NNP	159
assistant	assistant	JJ	17
assistantfiscal	assistantfiscal	NNP	1
assistants	assistant	NNS	95
assistants	assistant	NNP	4
assistantship	assistantship	NN	4
assistantships	assistantship	NNS	3
assisted	assist	VBN	209
assisted	assisted	NNP	17
assisted	assisted	UNC	1
assisted-care	assisted-care	JJ	1
assisted-conception	assisted-conception	JJ	1
assisted-living	assisted-living	JJ	3
assisted-suicide	assisted-suicide	JJ	3
assisting	assist	VBG	76
assisting	assisting	NNP	8
assistive	assistive	JJ	3
assists	assist	VBZ	61
assists	assist	NNP	3
assiter	assiter	NNP	2
assitsant	assitsant	NN	1
assiyasi	assiyasus	NNP	1
asskicking	asskick	VBG	4
asskickingly	asskickingly	NNP	1
assless	assless	JJ	1
asslicks	asslick	NNS	1
assload	assload	NN	8
assloads	assload	NNS	2
asslot	asslot	NNP	1
assma	assma	NNP	2
assmeat	assmeat	NN	1
assn	assn	NNP	7
assn	assn	NN	1
assnref	assnref	NN	2
asso	asso	NN	1
asso-ciated	asso-ciated	JJ	1
assoc	assoc	NNP	3
assocation	assocation	NN	1
assocdb	assocdb	NN	1
associació	associació	NNP	1
associate	associate	JJ	375
associate	associate	NN	68
associate	associate	NNP	62
associate	associate	VBP	11
associate	associate	UNC	3
associate-type	associate-type	JJ	1
associated	associate	VBN	3562
associated	associated	NNP	179
associated	associated	JJ	7
associates	associate	NNS	212
associates	associate	NNPS	104
associates	associate	NNP	16
associating	associate	VBG	39
associating	associating	NNP	1
association	association	NN	1337
association	association	NNP	1289
association	association	UNC	2
association-supported	association-supported	NNP	1
association-was	association-wa	NNP	1
association-wide	association-wide	JJ	1
associational	associational	NN	2
associationalism	associationalism	NN	1
associations	association	NNS	538
associations	association	NNP	18
associations	associations	UNC	2
associative	associative	JJ	10
associação	associação	NNP	1
assoillyng	assoillyng	NN	1
assonance	assonance	NN	2
assort	assort	NN	3
assorted	assorted	JJ	66
assorted	assorted	NNP	3
assortment	assortment	NN	68
assortments	assortment	NNS	1
assouline	assouline	NNP	6
assp	assp	NNP	2
asspipe	asspipe	NNP	1
asspull	asspull	NN	24
asspull	asspull	NNP	2
asspulled	asspulled	JJ	1
asspullery	asspullery	NN	1
asspulls	asspull	NNS	4
asspully	asspully	RB	9
asssayed	asssayed	JJ	1
asssume	asssume	NN	1
asssumed	asssumed	JJ	1
asst	asst	NNP	9
asst	asst	NN	5
assu	assu	NN	2
assuage	assuage	VB	28
assuage	assuage	NNP	1
assuaged	assuaged	JJ	9
assuaged	assuaged	NNP	1
assuages	assuage	NNS	1
assuaging	assuage	VBG	3
assult	assult	NN	2
assulted	assulted	JJ	2
assum	assum	NN	1
assume	assume	VB	706
assume	assume	VBP	435
assume	assume	UNC	2
assume-the	assume-the	JJ	1
assumed	assume	VBD	467
assumed	assume	VBN	418
assumed	assumed	JJ	6
assumed	assumed	UNC	2
assumed	assumed	NNP	2
assumed-in	assumed-in	JJ	1
assumedly	assumedly	NNP	1
assumers	assumer	NNS	1
assumes	assume	VBZ	269
assumes	assume	NNP	2
assumes	assumes	UNC	1
assuming	assume	VBG	658
assuming	assuming	UNC	9
assumingly	assumingly	RB	1
assummed	assummed	JJ	1
assumption	assumption	NN	668
assumption	assumption	NNP	42
assumption	assumption	UNC	1
assumptions	assumption	NNS	513
assumptions	assumption	NNP	14
assumptions	assumptions	UNC	2
assumptive	assumptive	JJ	1
assuncao	assuncao	NNP	2
assunder	assunder	NN	1
assuning	assun	VBG	1
assunpink	assunpink	NNP	1
assunta	assunta	NNP	1
assunção	assunção	NNP	4
assupmtion	assupmtion	NN	1
assurance	assurance	NN	207
assurance	assurance	NNP	51
assurances	assurance	NNS	68
assurances	assurance	NNP	1
assure	assure	VB	240
assure	assure	NNP	4
assured	assure	VBN	131
assured	assure	VBD	79
assured	assured	NNP	4
assured	assured	JJ	2
assured	assured	UNC	1
assuredly	assuredly	RB	12
assuredly	assuredly	NNP	1
assures	assure	VBZ	56
assures	assure	NNP	3
assuring	assure	VBG	60
assuring	assuring	NNP	3
assurèd	assurèd	NN	1
asswipe	asswipe	NNP	3
asswipe	asswipe	NN	1
asswipes	asswipe	NNP	3
asswipes	asswipe	NNS	1
assy	assy	NNP	1
assy	assy	NN	1
assykeen	assykeen	NNP	1
assymetrical	assymetrical	JJ	2
assyrian	assyrian	NNP	7
assyrians	assyrian	NNP	3
assézat	assézat	NNP	2
ast	ast	NNP	16
ast	ast	NN	5
asta	asta	NNP	3
astacio	astacio	NNP	7
astaire	astaire	NNP	18
astaire-style	astaire-style	NNP	1
astana	astana	NNP	4
astarte	astarte	NNP	8
astataries	astatary	NNS	1
astate	astate	NN	2
astaxanthin	astaxanthin	NN	10
astbury	astbury	NNP	1
astekar	astekar	NNP	1
asteraceae	asteracea	NNP	4
asterik	asterik	NN	1
asterisk	asterisk	NN	26
asterisked	asterisked	JJ	1
asterisks	asterisk	NNS	16
asterix	asterix	NNP	3
astern	astern	NN	1
asteroid	asteroid	NN	33
asteroid	asteroid	NNP	3
asteroid-sized	asteroid-sized	JJ	1
asteroides	asteroide	NNS	1
asteroids	asteroid	NNS	8
asteroússia	asteroússia	NNP	1
asters	aster	NNS	8
asters	aster	NNP	1
astert	astert	NN	1
asterte	asterte	NN	1
asterted	asterted	NNP	1
asterted	asterted	JJ	1
asthiswastherestingplaceofthegodamun	asthiswastherestingplaceofthegodamun	NN	1
asthma	asthma	NN	309
asthma	asthma	NNP	25
asthma-associated	asthma-associated	JJ	2
asthma-related	asthma-related	JJ	1
asthma-related	asthma-related	NNP	1
asthma-specific	asthma-specific	JJ	1
asthma-susceptibility	asthma-susceptibility	JJ	1
asthmatic	asthmatic	JJ	16
asthmatic	asthmatic	NNP	2
asthmatics	asthmatic	NNS	8
asthmatics	asthmatic	NNP	2
asthmaticus	asthmaticus	JJ	2
astigmatics	astigmatic	NNS	1
astigmatism	astigmatism	NN	4
astin	astin	NNP	10
astir	astir	NN	2
astm	astm	NNP	1
aston	aston	NNP	10
aston-hotels	aston-hotel	JJ	1
astoned	astoned	JJ	2
astonia	astonium	NNP	1
astonish	astonish	NN	2
astonished	astonished	JJ	55
astonished	astonished	UNC	1
astonished	astonished	NNP	1
astonishes	astonish	NNS	7
astonishing	astonishing	JJ	172
astonishing	astonishing	NNP	1
astonishingly	astonishingly	RB	43
astonishingly	astonishingly	NNP	4
astonishingly	astonishingly	UNC	1
astonishment	astonishment	NN	19
astonishment	astonishment	NNP	1
astor	astor	NNP	20
astoria	astorium	NNP	16
astors	astor	NNP	7
astory	astory	NNP	1
astound	astound	NN	3
astounded	astounded	JJ	26
astounding	astounding	JJ	64
astounding	astounding	NNP	2
astoundingly	astoundingly	RB	13
astounds	astound	VBZ	3
astra	astra	NN	2
astra	astra	NNP	2
astrachan	astrachan	NNP	4
astragal	astragal	NN	1
astragalin	astragalin	NN	1
astragalomancy	astragalomancy	NN	1
astragalus	astragalus	JJ	2
astrakhan	astrakhan	NNP	1
astral	astral	NNP	8
astral	astral	NN	3
astralwerks	astralwerk	NNP	2
astramuchur	astramuchur	NN	2
astramuphar	astramuphar	NN	2
astrantia	astrantium	NNP	1
astray	astray	RB	24
astray	astray	NNP	1
astrazeneca	astrazeneca	NNP	10
astride	astride	IN	15
astride	astride	NNP	2
astringence	astringence	NN	1
astringent	astringent	NN	4
astringently	astringently	RB	1
astrionics	astrionic	NNS	2
astro	astro	NNP	12
astro	astro	NN	1
astro-man	astro-man	NNP	1
astro-turf	astro-turf	JJ	1
astrobiology	astrobiology	NN	4
astrobiology	astrobiology	NNP	2
astrocam	astrocam	NNP	1
astrocyte	astrocyte	NN	11
astrocyte-specific	astrocyte-specific	JJ	1
astrocytes	astrocyte	NNS	19
astrocytic	astrocytic	JJ	1
astrocytomas	astrocytoma	NNS	5
astrodome	astrodome	NNP	11
astrofísica	astrofísica	NNP	1
astrogator	astrogator	NN	1
astroglia	astroglium	NN	1
astroglial	astroglial	NN	1
astroglide	astroglide	NN	2
astroglide	astroglide	NNP	1
astrogliosis	astrogliosis	NNS	4
astrogliotic	astrogliotic	JJ	1
astrojets	astrojet	NNP	1
astrolabe	astrolabe	NNP	1
astrolabe	astrolabe	NN	1
astrolabes	astrolabe	NNS	1
astrologer	astrologer	NN	12
astrologer	astrologer	NNP	1
astrologers	astrologer	NNS	4
astrological	astrological	JJ	4
astrological	astrological	NNP	1
astrologico	astrologico	NN	1
astrologist	astrologist	NN	1
astrologists	astrologists	UNC	1
astrology	astrology	NN	20
astrology	astrology	NNP	3
astrology	astrology	UNC	1
astrom	astrom	NNP	2
astroman	astroman	NNP	1
astronaut	astronaut	NN	72
astronaut	astronaut	NNP	10
astronaute	astronaute	NN	1
astronauts	astronaut	NNS	29
astronauts	astronaut	NNP	5
astrong	astrong	NNP	1
astronomer	astronomer	NN	27
astronomer	astronomer	NNP	2
astronomers	astronomer	NNS	46
astronomers	astronomer	NNP	9
astronomical	astronomical	JJ	51
astronomical	astronomical	NNP	3
astronomically	astronomically	RB	1
astronomy	astronomy	NN	49
astronomy	astronomy	NNP	7
astronomy-altering	astronomy-altering	JJ	1
astronomy-based	astronomy-based	JJ	1
astronouts	astronout	NNS	1
astrophysical	astrophysical	NNP	1
astrophysicist	astrophysicist	NN	3
astrophysics	astrophysics	NNS	3
astrophysics	astrophysics	NNP	1
astros	astro	NNP	133
astrospores	astrospore	NNS	1
astroturf	astroturf	NNP	17
astrov	astrov	NNP	1
astro­no­mique	astro­no­mique	NN	1
astrud	astrud	NNP	5
astudy	astudy	NN	1
astumor	astumor	NN	1
asturias	asturia	NNP	2
astute	astute	JJ	37
astutely	astutely	RB	4
astuteness	astuteness	NNS	2
astygmatism	astygmatism	NN	1
astérix	astérix	NNP	3
asu	asu	NNP	3
asume	asume	NN	2
asummary	asummary	JJ	1
asuncion	asuncion	NNP	4
asunción	asunción	NNP	4
asunder	asunder	RB	10
asunder	asunder	NNP	1
asusie	asusie	NN	1
asw	asw	NNP	45
asw-overexpressing	asw-overexpressing	NNP	1
aswaguschwadic	aswaguschwadic	NNP	1
aswan	aswan	NNP	27
aswan	aswan	NN	1
aswaq	aswaq	NNP	1
aswarm	aswarm	NN	1
aswat	aswat	NNP	1
aswell	aswell	NN	2
aswooned	aswooned	JJ	2
aswowne	aswowne	NN	2
asy	asy	NN	2
asy	asy	NNP	1
asychronous	asychronous	JJ	1
asylees	asylee	NNS	2
asylum	asylum	NN	91
asylum	asylum	NNP	24
asylum	asylum	UNC	2
asylum-seeker	asylum-seeker	NNP	1
asylum-seekers	asylum-seeker	JJ	4
asylums	asylum	NNS	9
asymbolic	asymbolic	JJ	1
asymmeticral	asymmeticral	NN	1
asymmetric	asymmetric	JJ	53
asymmetric	asymmetric	NNP	3
asymmetrical	asymmetrical	JJ	22
asymmetrical	asymmetrical	NNP	1
asymmetrically	asymmetrically	RB	10
asymmetries	asymmetry	NNS	15
asymmetries	asymmetry	NNP	3
asymmetrix	asymmetrix	NNP	1
asymmetry	asymmetry	NN	30
asymmetry	asymmetry	NNP	2
asymptomatic	asymptomatic	JJ	65
asymptomatic	asymptomatic	NNP	1
asymptomatically	asymptomatically	RB	2
asymptomatics	asymptomatic	NNS	1
asymptote	asymptote	NN	3
asymptotic	asymptotic	JJ	12
asymptotically	asymptotically	RB	2
asymptotics	asymptotic	NNS	2
asynaptic	asynaptic	NNP	1
asynchronic	asynchronic	NNP	1
asynchronous	asynchronous	JJ	13
asynchronous	asynchronous	NNP	1
asynchronously	asynchronously	RB	7
asynchrony	asynchrony	NN	3
asyrinsure	asyrinsure	NN	1
as­tu­rias	as­tu­rias	NNP	1
así	así	NN	1
asís	asís	NNP	3
at	at	IN	100272
at	at	NNP	612
at	at	UNC	193
at	at	RP	59
at	at	NN	3
at-a-glance	at-a-glance	JJ	1
at-bat	at-bat	NN	35
at-bats	at-bat	JJ	61
at-home	at-home	JJ	8
at-homeness	at-homeness	JJ	1
at-hook	at-hook	NNP	5
at-hook-like	at-hook-like	NNP	3
at-hooks	at-hook	NNP	1
at-large	at-large	JJ	2
at-long-last	at-long-last	JJ	1
at-rich	at-rich	NNP	15
at-risk	at-risk	JJ	52
at-risks	at-risk	JJ	1
at-sea	at-sea	JJ	1
at-tariiq	at-tariiq	JJ	1
at-the-break	at-the-break	JJ	1
at-the-movies	at-the-movy	NNP	2
at-will	at-will	JJ	1
at-work	at-work	JJ	1
at-ya	at-ya	JJ	1
ata	ata	NNP	19
ata	ata	NN	1
ataaacagagcagagcagagc	ataaacagagcagagcagagc	NNP	1
ataaagcccgaggtgttgttgc	ataaagcccgaggtgttgttgc	NNP	1
ataaatggaccgcatattga	ataaatggaccgcatattga	NNP	2
ataatgtgtgtagccaagtggggt	ataatgtgtgtagccaagtggggt	NNP	1
atac	atac	NN	1
atacagcgtcacgactcccaccaatactagtgacacagacagtgaggtgctggggccagggttggactcgac	atacagcgtcacgactcccaccaatactagtgacacagacagtgaggtgctggggccagggttggactcgac	NNP	1
atactc	atactc	NNP	1
atactgcgtaactgactata	atactgcgtaactgactata	NNP	1
atag	atag	NNP	1
atagtaacgaacaggatg	atagtaacgaacaggatg	NNP	3
atai	ataus	NN	1
ataka	ataka	NNP	1
atakapa	atakapa	NNP	1
ataköy	ataköy	NNP	2
atal	atal	NNP	7
atala	atalum	NNP	2
atalaia	atalaium	NNP	1
atalaya	atalaya	NNP	3
atall	atall	NN	1
atami	atamus	NNP	2
atanarjuat	atanarjuat	NNP	8
atanatiya	atanatiya	NNP	3
atanta	atanta	NNP	1
atapi	atapus	NNP	1
atarazanas	atarazana	NNP	1
atari	atarus	NNP	3
ataru	ataru	NN	1
atas	ata	NNS	1
atascosa	atascosa	NNP	1
atassi	atassus	NNP	1
atattgtccagtgc	atattgtccagtgc	NNP	1
atatttgctagctgatagtgacc	atatttgctagctgatagtgacc	NNP	2
ataturk	ataturk	NNP	4
atatürk	atatürk	NNP	18
atavistic	atavistic	JJ	10
atavistic	atavistic	NNP	1
ataw	ataw	NN	1
ataxia	ataxia	NN	18
ataxia	ataxia	NNP	2
ataxia-oculomotor	ataxia-oculomotor	JJ	1
ataxic	ataxic	JJ	1
ataxin	ataxin	NN	5
atays	atay	NNS	1
atb	atb	NNP	1
atbc	atbc	NNP	2
atc	atc	NNP	54
atc	atc	NN	4
atcaa	atcaa	NNP	1
atcagcggccgcgatcc	atcagcggccgcgatcc	NNP	1
atcatctgtggctcagagtcg	atcatctgtggctcagagtcg	NNP	1
atcattatgctgaatccaacagtgatggcgttccatttaccacacgtaacatgagagtgatggggatcaggaag	atcattatgctgaatccaacagtgatggcgttccatttaccacacgtaacatgagagtgatggggatcaggaag	NNP	1
atcc	atcc	NNP	99
atcc	atcc	NN	2
atcc-na	atcc-na	NNP	1
atccatgccatccacgtcaag	atccatgccatccacgtcaag	NNP	1
atccgtaccagtggctaaaagg	atccgtaccagtggctaaaagg	NNP	1
atcctaa	atcctaa	NNP	1
atcctcaaagatgtctccttgtac	atcctcaaagatgtctccttgtac	NNP	1
atcctcgccgtcgggcatgc	atcctcgccgtcgggcatgc	NNP	1
atcctgaccctgaagtaccc	atcctgaccctgaagtaccc	NNP	1
atcgaactggtgtgtcgaagg	atcgaactggtgtgtcgaagg	NN	1
atcha	atcha	NN	10
atchafalaya	atchafalaya	NNP	4
atchison	atchison	NNP	1
atchugarry	atchugarry	NNP	1
atcisdb	atcisdb	NNP	11
atclo	atclo	NNP	1
atcop	atcop	NNP	37
atcost	atcost	NN	2
atcp	atcp	NNP	3
atct	atct	NNP	1
atctcctcttcttgctctgg	atctcctcttcttgctctgg	NNP	1
atctcgaaggagattgttatagg	atctcgaaggagattgttatagg	NN	1
atctgaggtcctctgaaagtg	atctgaggtcctctgaaagtg	NNP	1
atdb	atdb	NNP	1
atdm	atdm	NNP	1
ate	ate	NNP	3
ate	eat	VBD	405
ateandateandate	ateandateandate	NN	1
atee	atee	NN	2
atef	atef	NNP	64
atelectasis	atelectasis	NNS	5
atelectatic	atelectatic	JJ	1
atelier	atelier	NNP	3
atelier	atelier	NN	1
ateliers	atelier	NNS	1
ateltisate	ateltisate	NNP	1
aten	aten	NNP	2
atenas	atena	NNP	1
atención	atención	NNP	1
atenco	atenco	NNP	12
ateneo	ateneo	NNP	1
atenolol	atenolol	NN	4
atenveldt	atenveldt	NNP	1
aterror	aterror	NN	1
aterson	aterson	NN	1
ates	ate	NNS	2
atesgay	atesgay	NNP	1
atevery	atevery	NN	1
atf	atf	NNP	67
atf	atf	NN	2
atf-bpti	atf-bptus	NNP	27
atfalati	atfalatus	NNP	1
atfim	atfim	NNP	4
atfpp	atfpp	NNP	27
atfpps	atfpp	NNP	2
atg	atg	NNP	72
atg	atg	NN	1
atgaactccttctc	atgaactccttctc	NNP	1
atgaatatctagaccagggtgcc	atgaatatctagaccagggtgcc	NNP	1
atgaattttactggctattc	atgaattttactggctattc	NNP	1
atgacaaggtagcgctggggg	atgacaaggtagcgctggggg	NNP	1
atgagctgcatgatgagct	atgagctgcatgatgagct	NNP	1
atgagttaattcaaaccccacggacat	atgagttaattcaaaccccacggacat	NNP	1
atgatgaaataacataaggtggtcccg	atgatgaaataacataaggtggtcccg	NNP	1
atgatgaaggcttctc	atgatgaaggcttctc	NNP	1
atgattcaggttctcacgtccg	atgattcaggttctcacgtccg	NNP	1
atgctaactgtccaagtcta	atgctaactgtccaagtcta	NNP	1
atgctgttcagatgtttcaccatg	atgctgttcagatgtttcaccatg	NNP	1
atget	atget	NNP	3
atggaaacaccttgcttcttctccctc	atggaaacaccttgcttcttctccctc	NNP	1
atggatccttctcaacgaagagcagtg	atggatccttctcaacgaagagcagtg	NNP	1
atggcattagaaatagatatagataatg	atggcattagaaatagatatagataatg	NNP	1
atggcggcgggtgggagcggcgggcgtgcgtcgtg	atggcggcgggtgggagcggcgggcgtgcgtcgtg	NNP	2
atggctaagtttgcttccat	atggctaagtttgcttccat	NNP	1
atgggcaagaacaagcagccacg	atgggcaagaacaagcagccacg	NNP	1
atgggctggcaacatacaaca	atgggctggcaacatacaaca	NNP	1
atggtgtgggcgaaagatga	atggtgtgggcgaaagatga	NNP	1
atgs	atg	NNP	1
atgtcaacacccacagcagcagat	atgtcaacacccacagcagcagat	NNP	1
atgtggcgtcaaatcctg	atgtggcgtcaaatcctg	NNP	1
atgtgttgtgtattgtgtgggg	atgtgttgtgtattgtgtgggg	NNP	1
atgttacacaaccatgatgtagaagaag	atgttacacaaccatgatgtagaagaag	NNP	1
atgttcaacgggggaatggccacaacatc	atgttcaacgggggaatggccacaacatc	NNP	1
atgttccactgcat	atgttccactgcat	NNP	1
atgttctaatatagtcacattttc	atgttctaatatagtcacattttc	NNP	1
ath	ath	NNP	8
ath	ath	NN	7
atha	atha	NNP	1
athabasca	athabasca	NNP	3
athan	athan	NNP	1
athanaric	athanaric	NNP	1
athanasian	athanasian	NNP	2
athanasius	athanasius	NNP	2
athapaskan	athapaskan	NNP	2
athe	athe	NNP	1
athe	athe	NN	1
atheism	atheism	NN	9
atheism	atheism	NNP	2
atheist	atheist	NN	41
atheist	atheist	NNP	4
atheistic	atheistic	JJ	3
atheists	atheist	NNS	40
atheists	atheist	NNP	3
athelete	athelete	NN	1
athelstan	athelstan	NNP	1
athema	athema	NN	1
athen	athen	NNP	1
athena	athena	NNP	37
athenaeum	athenaeum	NNP	1
athenaeus	athenaeus	NNP	1
athene	athene	NNP	2
athenee	athenee	NNP	1
atheneneum	atheneneum	NNP	1
atheneum	atheneum	NNP	5
athenian	athenian	JJ	16
athenians	athenian	NNP	27
athenry	athenry	NNP	1
athens	athen	NNP	278
athens	athens	UNC	1
athens	athens	NNP	1
athenscope	athenscope	NNP	1
athenæum	athenæum	NNP	1
atherectomy	atherectomy	NN	1
atherogenesis	atherogenesis	NNS	5
atherogenic	atherogenic	JJ	4
atherogenicity	atherogenicity	NN	1
atheromatous	atheromatous	JJ	3
atherosclerosis	atherosclerosis	NNS	52
atherosclerosis	atherosclerosis	NNP	3
atherosclerotic	atherosclerotic	JJ	28
atherosclerotic	atherosclerotic	NNP	1
atherton	atherton	NNP	2
athiest	athiest	NNP	2
athiests	athiest	NNS	1
athila	athilum	NNP	2
athina	athina	NNP	2
athinas	athina	NNP	1
athinios	athinio	NNP	2
athlete	athlete	NN	139
athlete	athlete	NNP	6
athlete-comedians	athlete-comedian	NNP	1
athletes	athlete	NNS	242
athletes	athlete	NNP	9
athletes	athletes	UNC	2
athletes-turned-politicians	athletes-turned-politician	JJ	1
athletes­	athletes­	NN	1
athletic	athletic	JJ	187
athletic	athletic	NNP	34
athletic-wear	athletic-wear	JJ	1
athletically	athletically	RB	5
athleticism	athleticism	NN	15
athleticize	athleticize	NN	1
athletics	athletics	NNS	56
athletics	athletics	NNP	35
athlon	athlon	NNP	3
athnee	athnee	NNP	1
athol	athol	NNP	1
athon	athon	NN	9
athon	athon	NNP	2
athoninators	athoninator	NNS	1
athos	atho	NNP	4
athough	athough	NNP	1
athttp	athttp	NN	1
athwart	athwart	NN	3
athways	athway	NNS	3
athwri	athwrus	NN	1
athy	athy	NNP	2
athymia	athymium	NN	2
athymic	athymic	JJ	15
athymic	athymic	NNP	2
ati	atus	NNP	8
atick	atick	NNP	1
atif	atif	NNP	1
atiii	atiius	NNP	1
atikokan	atikokan	NNP	1
atilde	atilde	NN	1
atilla	atillum	NNP	2
ating	ate	VBG	3
ation	ation	NN	3
ations	ation	NNP	3
atipamezole	atipamezole	NN	2
atipemazole	atipemazole	NN	1
atircm	atircm	NNP	14
atircms	atircm	NNP	2
atissue	atissue	NN	1
atitude	atitude	NN	1
ativan	ativan	NN	1
ative	ative	JJ	1
atj	atj	NNP	6
atk	atk	NNP	4
atkatd	atkatd	NNP	2
atkcbp	atkcbp	NNP	2
atkin	atkin	NNP	2
atkins	atkin	NNP	158
atkins-like	atkins-like	NNP	4
atkinson	atkinson	NNP	29
atkrp	atkrp	NNP	5
atl	atl	NNP	6
atlanimated	atlanimated	NNP	1
atlanta	atlanta	NNP	1779
atlanta-area	atlanta-area	NNP	2
atlanta-based	atlanta-based	JJ	34
atlanta-tourism	atlanta-tourism	NNP	4
atlantan	atlantan	NNP	4
atlantans	atlantan	NNPS	14
atlanteans	atlantean	NNP	1
atlantic	atlantic	NNP	575
atlantic	atlantic	JJ	5
atlantic	atlantic	UNC	3
atlanticism	atlanticism	NNP	1
atlantico	atlantico	NNP	1
atlantics	atlantic	NNP	1
atlantik	atlantik	NNP	1
atlantique	atlantique	NN	1
atlantis	atlanti	NNP	37
atlanto-occipital	atlanto-occipital	JJ	3
atlas	atlas	NNP	82
atlas	atlas	NNS	24
atlases	atlase	NNS	3
atlasimage	atlasimage	NNP	3
atlatnic	atlatnic	NNP	1
atlg	atlg	NNP	2
atlit	atlit	NNP	1
atlprov	atlprov	NNP	2
atls	atl	NNP	1
atlus	atlus	NNP	4
atm	atm	NNP	136
atm	atm	NN	1
atm-fee	atm-fee	NNP	1
atm-independent	atm-independent	NNP	1
atm-like	atm-like	NNP	1
atmaa	atmaa	NNP	6
atmaf	atmaf	NNP	3
atman	atman	NN	1
atmca	atmca	NNP	1
atmel	atmel	NNP	1
atmgd	atmgd	NNP	1
atmgl	atmgl	NNP	1
atmidometry	atmidometry	NN	1
atmosphere	atmosphere	NN	625
atmosphere	atmosphere	NNP	5
atmosphere	atmosphere	UNC	2
atmospheres	atmosphere	NNS	5
atmospherewise	atmospherewise	NN	1
atmospheric	atmospheric	JJ	92
atmospheric	atmospheric	NNP	23
atmospherically	atmospherically	RB	1
atmosphericdeposition	atmosphericdeposition	NN	1
atmospherics	atmospherics	NNS	2
atmro	atmro	NNP	1
atms	atm	NNP	18
atmyb	atmyb	NNP	7
atn	atn	NNP	29
atneave	atneave	NNP	1
ato	ato	NNP	4
ato	ato	NN	1
atoa	atoa	NNP	1
atocha	atocha	NNP	4
atoll	atoll	NN	2
atoll	atoll	NNP	1
atolls	atoll	NNS	1
atom	atom	NN	91
atom	atom	NNP	11
atom-atom	atom-atom	JJ	1
atom-based	atom-based	JJ	2
atom-splitting	atom-splitting	JJ	3
atombombpocketknife	atombombpocketknife	NNP	1
atomfilms	atomfilm	NNS	1
atomic	atomic	JJ	124
atomic	atomic	NNP	29
atomic-bomb	atomic-bomb	JJ	1
atomic-level	atomic-level	JJ	1
atomic-mutated	atomic-mutated	JJ	1
atomic-powered	atomic-powered	JJ	1
atomic-scaled	atomic-scaled	JJ	4
atomically	atomically	RB	1
atomics	atomic	NNP	1
atomictangerine	atomictangerine	NNP	2
atomism	atomism	NN	7
atomistic	atomistic	JJ	4
atomized	atomized	JJ	3
atomosphere	atomosphere	NN	1
atoms	atom	NNS	133
atoms	atom	NNP	3
atoms	atoms	UNC	2
atonal	atonal	JJ	6
atonal	atonal	NNP	1
atonality	atonality	NN	1
atone	atone	NN	26
atone	atone	VB	1
atoned	atoned	JJ	3
atonement	atonement	NN	23
atonement	atonement	NNP	4
atones	atone	NNS	4
atoning	aton	VBG	4
atop	atop	IN	185
atopic	atopic	JJ	8
atopic	atopic	NNP	1
atopy	atopy	NN	1
ator	ator	NN	2
ators	ator	NNS	1
atorvastatin	atorvastatin	NN	30
atorvastatin	atorvastatin	NNP	10
atorvastatin-mediated	atorvastatin-mediated	JJ	1
atorvastatin-treated	atorvastatin-treated	JJ	2
atotally	atotally	NNP	1
atotonilco	atotonilco	NNP	1
atp	atp	NNP	441
atp-analog	atp-analog	NNP	1
atp-binding	atp-binding	NNP	21
atp-dependent	atp-dependent	NNP	14
atp-disodium	atp-disodium	NNP	1
atp-dnaa	atp-dnaa	NNP	1
atp-driven	atp-driven	NNP	1
atp-grasp	atp-grasp	NNP	22
atp-independent	atp-independent	NNP	1
atp-induced	atp-induced	NNP	2
atp-inhibitory	atp-inhibitory	NNP	1
atp-insensitive	atp-insensitive	NNP	1
atp-sensitive	atp-sensitive	NNP	5
atp-sulfurylase	atp-sulfurylase	NNP	1
atp?	atp?	NNP	1
atp?s	atp?s	NNP	5
atpactivity	atpactivity	NNP	2
atpakrp	atpakrp	NNP	1
atpase	atpase	NNP	179
atpase-proton	atpase-proton	NNP	1
atpase-specfic	atpase-specfic	NNP	1
atpases	atpase	NNP	25
atpip	atpip	NNP	7
atplc	atplc	NNP	7
atpsynthase	atpsynthase	NNP	3
atpsynthases	atpsynthase	NNP	1
atr	atr	NNP	17
atr	atr	NN	4
atra	atra	NN	1
atraccions	atraccion	NNP	2
atraditional	atraditional	NN	1
atrangap	atrangap	NNP	1
atransgenic	atransgenic	NNP	1
atrazine	atrazine	NN	2
atreides	atreide	NNP	1
atremble	atremble	JJ	1
atrep-base	atrep-base	NNP	1
atrepbase	atrepbase	NNP	2
atresia	atresium	NN	20
atretic	atretic	JJ	13
atretic	atretic	NNP	1
atreus	atreus	NNP	9
atreus	atreus	JJ	1
atria	atrium	NN	3
atria	atrium	NNP	1
atrial	atrial	NN	106
atrial	atrial	NNP	5
atriedes	atriede	NNP	2
atrioventricular	atrioventricular	NN	4
atrip	atrip	NNP	5
atrisk	atrisk	NN	3
atrisk	atrisk	NNP	1
atriss	atriss	NNP	17
atrium	atrium	NN	31
atrium	atrium	NNP	1
atriums	atrium	NNS	3
atroce	atroce	NNP	1
atrocious	atrocious	JJ	25
atrociously	atrociously	RB	3
atrocities	atrocities	UNC	1
atrocities	atrocity	NNS	110
atrocity	atrocity	NN	26
atrocity	atrocity	NNP	3
atrojan	atrojan	NNP	1
atrophic	atrophic	JJ	5
atrophic	atrophic	NNP	1
atrophicae	atrophica	NN	1
atrophied	atrophied	JJ	5
atrophin	atrophin	NN	1
atrophy	atrophy	NN	40
atrophying	atrophy	VBG	5
atropine	atropine	NN	12
atropine	atropine	NNP	1
atropurpurea	atropurpurea	NN	1
atrox	atrox	NN	6
atrusted	atrusted	JJ	1
atry	atry	NN	1
ats	at	NNP	136
ats	at	NNS	1
atsb	atsb	NNP	2
atsina	atsina	NNP	1
atstours	atstour	NNS	1
atsuta	atsuta	NNP	1
att	att	NNP	212
att	att	NN	2
att-comcast	att-comcast	NNP	2
att-earnings	att-earning	NNP	2
atta	atta	NNP	355
atta-the	atta-the	NNP	1
attaaa	attaaa	NNP	1
attach	attach	VB	101
attach	attach	VBP	27
attach	attach	NNP	4
attache	attache	NN	6
attached	attach	VBN	538
attached	attach	VBD	52
attached	attached	NNP	6
attached	attached	JJ	3
attaches	attach	VBZ	27
attaching	attach	VBG	28
attaching	attaching	NNP	1
attachment	attachment	NN	224
attachment	attachment	NNP	4
attachments	attachment	NNS	39
attaché	attaché	NN	5
attacin	attacin	NN	1
attack	attack	NN	1625
attack	attack	VB	288
attack	attack	NNP	107
attack	attack	VBP	42
attack	attack	UNC	6
attack	attack	JJ	1
attack-and	attack-and	JJ	1
attack-dog	attack-dog	JJ	2
attack-hekmatyar	attack-hekmatyar	NNP	1
attack-how	attack-how	JJ	1
attack-marines	attack-marine	NNP	1
attack-repeatedly	attack-repeatedly	JJ	1
attack-sailors	attack-sailor	NNP	1
attacked	attack	VBN	206
attacked	attack	VBD	167
attacked	attacked	JJ	1
attacked-on-sight	attacked-on-sight	JJ	1
attacker	attacker	NN	34
attacker	attacker	UNC	1
attackers	attacker	NNS	25
attackers	attacker	NNP	1
attacking	attack	VBG	208
attacking	attacking	NN	6
attacking	attacking	NNP	6
attacking	attacking	UNC	1
attacks	attack	NNS	1560
attacks	attack	VBZ	57
attacks	attack	NNP	10
attacks	attacks	UNC	2
attacks	attacks	NN	1
attacks-it	attacks-it	JJ	1
attacks-possibly	attacks-possibly	JJ	1
attacks-that	attacks-that	JJ	1
attact	attact	NN	1
attactive	attactive	JJ	1
attagirl	attagirl	NNP	2
attain	attain	VB	82
attain	attain	NNP	1
attainable	attainable	JJ	18
attainable	attainable	NNP	1
attainder	attainder	NN	7
attainder	attainder	NNP	1
attained	attain	VBN	93
attaining	attain	VBG	31
attaining	attaining	NNP	2
attainment	attainment	NN	57
attainment	attainment	NNP	1
attainments	attainment	NNS	1
attains	attain	NNS	2
attains	attains	UNC	1
attal	attal	NNP	13
attali	attalus	NNP	2
attalid	attalid	NNP	3
attalos	attalo	NNP	3
attalus	attalus	NNP	2
attanasio	attanasio	NNP	5
attar	attar	NNP	1
attarin	attarin	NNP	1
attas	atta	NNP	8
attash	attash	NNP	6
attatchment	attatchment	NN	3
attaway	attaway	NNP	1
attawhid	attawhid	NNP	5
attb	attb	NN	1
attcgatcggggcggggcgagc	attcgatcggggcggggcgagc	NNP	1
attcgtcatatcgccatt	attcgtcatatcgccatt	NNP	1
atte	atte	NN	1
atteck	atteck	NN	1
attemped	attemped	JJ	3
attempt	attempt	NN	1155
attempt	attempt	VB	182
attempt	attempt	VBP	60
attempt	attempt	NNP	15
attempt	attempt	UNC	1
attempt	attempt	JJ	1
attempted	attempt	VBD	288
attempted	attempt	VBN	159
attempted	attempted	JJ	34
attempted	attempted	NNP	14
attempting	attempt	VBG	319
attempting	attempting	NNP	10
attempts	attempt	NNS	608
attempts	attempt	VBZ	46
attempts	attempts	UNC	2
attenborough	attenborough	NNP	8
attence	attence	NN	1
attend	attend	VB	404
attend	attend	VBP	68
attend	attend	NNP	1
attend	attend	UNC	1
attendance	attendance	NN	200
attendance	attendance	NNP	23
attendance	attendance	UNC	2
attendances	attendance	NNS	1
attendant	attendant	NN	137
attendant	attendant	NNP	11
attendant	attendant	JJ	1
attendants	attendant	NNS	99
attendants	attendant	NNPS	3
attended	attend	VBD	342
attended	attend	VBN	117
attended	attended	UNC	2
attended	attended	NNP	1
attendee	attendee	NN	11
attendee	attendee	NNP	1
attendees	attendee	NNS	39
attendees	attendee	NNP	6
attendence	attendence	NN	4
attendent	attendent	NN	2
attendents	attendent	NNS	1
attendez	attendez	NNP	1
attending	attend	VBG	275
attending	attending	NNP	3
attendings	attending	NNS	1
attends	attend	VBZ	44
attends	attend	NNP	1
attention	attention	NN	2708
attention	attention	NNP	15
attention	attention	UNC	7
attention	attention	JJ	1
attention-deficit	attention-deficit	JJ	5
attention-deficit	attention-deficit	NNP	1
attention-getting	attention-getting	JJ	16
attention-grabbing	attention-grabbing	JJ	4
attention-happy	attention-happy	JJ	1
attention-seeking	attention-seeking	JJ	2
attention-starved	attention-starved	JJ	2
attention-switching	attention-switching	JJ	2
attentional	attentional	NN	16
attentionest	attentionest	NN	1
attentionl	attentionl	NN	1
attentions	attention	NNS	19
attentive	attentive	JJ	54
attentive	attentive	UNC	2
attentive	attentive	NNP	2
attentively	attentively	RB	9
attentiveness	attentiveness	NNS	3
attentuation	attentuation	NN	1
attenuance	attenuance	NN	1
attenuate	attenuate	NN	26
attenuated	attenuated	JJ	76
attenuates	attenuate	NNS	11
attenuating	attenuate	VBG	9
attenuation	attenuation	NN	33
attenuations	attenuation	NNS	2
attenuators	attenuator	NNS	1
atterrissage	atterrissage	NN	1
attest	attest	VB	58
attest	attest	UNC	1
attest	attest	NNP	1
attestation	attestation	NN	138
attestation	attestation	NNP	28
attestations	attestation	NNS	7
attestations	attestation	NNP	2
attested	attested	JJ	23
attesting	attest	VBG	7
attests	attest	VBZ	12
attests	attests	UNC	1
attfdb	attfdb	NNP	12
attgtctgttgtgcccagtcata	attgtctgttgtgcccagtca	NNP	1
atthat	atthat	NN	1
atthe	atthe	NN	2
atthe	atthe	NNP	1
atti	attus	NNP	1
attibutable	attibutable	JJ	1
attic	attic	NN	69
attic	attic	JJ	11
attica	attica	NNP	17
attics	attic	NNS	7
atticus	atticus	NNP	11
atticwall	atticwall	NN	1
attila	attilum	NNP	15
attilla	attillum	NNP	2
attip	attip	NNP	3
attire	attire	NN	41
attired	attired	JJ	14
attired	attired	UNC	1
attitude	attitude	NN	687
attitude	attitude	NNP	12
attitude	attitude	UNC	2
attitude	attitude	JJ	1
attitude-based	attitude-based	JJ	2
attitude-besotted	attitude-besotted	JJ	1
attitude-bound	attitude-bound	JJ	1
attitudes	attitude	NNS	368
attitudes	attitudes	UNC	2
attitudinal	attitudinal	NN	10
attitudinally	attitudinally	NNP	1
attitudinizing	attitudinize	VBG	1
attiya	attiya	NNP	1
attleboro	attleboro	NNP	16
attlee	attlee	NNP	2
attmepts	attmept	NNS	1
attn	attn	NNP	11
attnben	attnben	NN	1
attndce	attndce	NN	1
attneave	attneave	NNP	3
attolia	attolium	NNP	2
attone	attone	NN	2
attorney	attorney	NN	969
attorney	attorney	NNP	538
attorney-at	attorney-at	NNP	1
attorney-client	attorney-client	JJ	40
attorney-general	attorney-general	JJ	2
attorneyclient	attorneyclient	NN	1
attorneys	attorney	NNS	562
attorneys	attorney	NNP	5
attorneys	attorneys	UNC	1
attorneyto	attorneyto	NN	1
attp	attp	NN	3
attracrtive	attracrtive	JJ	1
attract	attract	VB	332
attract	attract	VBP	56
attract	attract	NNP	4
attract	attract	UNC	1
attractant	attractant	NN	3
attractants	attractant	NNS	1
attracted	attract	VBN	200
attracted	attract	VBD	143
attracted	attracted	JJ	1
attracting	attract	VBG	139
attracting	attracting	NNP	1
attraction	attraction	NN	351
attraction	attraction	NNP	22
attraction-filled	attraction-filled	JJ	1
attraction-relationship	attraction-relationship	NNP	1
attractions	attraction	NNS	307
attractions	attraction	NNP	9
attractions	attractions	UNC	1
attractive	attractive	JJ	703
attractive	attractive	NNP	15
attractive	attractive	UNC	2
attractively	attractively	RB	16
attractively	attractively	NNP	2
attractiveness	attractiveness	NN	24
attractivness	attractivness	NNS	1
attractor	attractor	NN	11
attractors	attractor	NNS	14
attracts	attract	VBZ	129
attracts	attract	NNP	1
attrib	attrib	NN	1
attribu	attribu	NN	1
attributable	attributable	JJ	180
attributable	attributable	NNP	5
attributable	attributable	UNC	1
attribute	attribute	VBP	96
attribute	attribute	VB	52
attribute	attribute	NN	12
attribute	attribute	NNP	3
attribute	attribute	UNC	2
attributed	attribute	VBN	274
attributed	attribute	VBD	165
attributed	attributed	NNP	2
attributes	attribute	VBZ	138
attributes	attribute	NNS	100
attributes	attribute	NNP	3
attributes	attributes	UNC	1
attributing	attribute	VBG	31
attributing	attributing	NNP	1
attribution	attribution	NN	35
attribution	attribution	NNP	5
attribution-based	attribution-based	JJ	1
attributions	attribution	NNS	6
attributions	attributions	JJ	1
attributive	attributive	JJ	1
attributively	attributively	RB	1
attrit	attrit	NN	2
attrition	attrition	NN	45
attrition	attrition	NNP	2
attrition-and	attrition-and	JJ	1
attrubutive	attrubutive	JJ	2
attss	attss	NN	1
atttaggtgacactatag	atttaggtgacactatag	NNP	1
atttgctgggttgaaaaatg	atttgctgggttgaaaaatg	NN	1
atttt	atttt	NN	1
attttgtgg	attttgtgg	NNP	1
atttttggaacctaggaaagactcggggcttgctccgactttccaagggtcgtcccggcg	atttttggaacctaggaaagactcggggcttgctccgactttccaagggtcgtcccggcg	NNP	1
atttttggaacctagggaagactcggggcttgctccgacttcccaagggtcgtcctggcg	atttttggaacctagggaagactcggggcttgctccgacttcccaagggtcgtcctggcg	NNP	1
attu	attu	NNP	1
attucks	attuck	NNP	2
attuned	attuned	JJ	24
attunement	attunement	NN	1
attwater	attwater	NNP	1
atty	atty	NNP	1
atu	atu	NNP	2
atuat	atuat	NNP	2
atul	atul	NNP	12
atv	atv	NNP	4
atvbvs	atvbv	NNS	1
atvisit	atvisit	NN	1
atw	atw	NN	3
atwan	atwan	NNP	5
atwater	atwater	NNP	13
atwitter	atwitter	NN	2
atwood	atwood	NNP	14
atwt	atwt	NNP	4
atxgxxxx	atxgxxxx	NNP	1
atypia	atypium	NN	18
atypical	atypical	JJ	73
atypical	atypical	NNP	2
atypically	atypically	RB	5
atypically	atypically	UNC	1
atyraü	atyraü	NNP	1
atzcf	atzcf	NNP	1
atâwe	atâwe	NN	1
atâweu	atâweu	NN	1
atúntunny	atúntunny	NN	2
au	au	NN	79
au	au	FW	32
au	au	NNP	24
au-kbc	au-kbc	JJ	2
au-rich	au-rich	NNP	4
aua	aua	NNP	2
auau	auau	NNP	1
auayled	auayled	JJ	1
aub	aub	NNP	2
aub-uitlijn	aub-uitlijn	NNP	2
aubade	aubade	NN	1
auberge	auberge	NN	3
auberges	auberge	NNS	1
aubergine	aubergine	NN	7
aubergines	aubergine	NNS	2
auberon	auberon	NNP	3
aubert	aubert	NNP	1
aubisque	aubisque	NNP	3
aubrey	aubrey	NNP	13
aubriot	aubriot	NNP	1
auburn	auburn	NNP	72
auburn	auburn	NN	7
auburn-haired	auburn-haired	JJ	1
auburndale	auburndale	NNP	1
aubusson	aubusson	NNP	1
auc	auc	NNP	48
auc-dbp	auc-dbp	NNP	5
auc-hr	auc-hr	NNP	4
auc-sbp	auc-sbp	NNP	5
auchincloss	auchincloss	NNP	2
auchtermuchty	auchtermuchty	NNP	1
auckerman	auckerman	NNP	2
auckland	auckland	NNP	10
aucoin	aucoin	NNP	5
aucoin	aucoin	NN	1
aucoustic	aucoustic	JJ	1
aucs	auc	NNP	1
auction	auction	NN	318
auction	auction	NNP	33
auction	auction	VB	25
auction	auction	UNC	4
auctionconducted	auctionconducted	JJ	1
auctioned	auction	VBN	55
auctioned	auction	VBD	6
auctioned	auctioned	NNP	4
auctioneer	auctioneer	NN	6
auctioning	auction	VBG	27
auctioning	auctioning	NNP	1
auctions	auction	NNS	124
auctions	auction	NNPS	6
auctions	auction	NNP	3
auctions-econscene	auctions-econscene	NNP	1
auctionshall	auctionshall	NN	1
auctionsubaccount	auctionsubaccount	NNP	1
auctionweb	auctionweb	NNP	3
aud	aud	NNP	5
aud	aud	NN	1
audacious	audacious	JJ	30
audacious	audacious	NNP	1
audaciously	audaciously	RB	4
audacities	audacity	NNS	1
audacity	audacity	NN	18
audacity	audacity	NNP	3
audelia	audelium	NNP	1
auden	auden	NNP	17
audette	audette	NNP	1
audi	audus	NNP	25
audi	audus	NN	2
audiac	audiac	NNP	2
audiard	audiard	NNP	3
audibility	audibility	NN	2
audible	audible	JJ	34
audible	audible	NNP	6
audibly	audibly	RB	6
audience	audience	NN	1282
audience	audience	NNP	83
audience	audience	UNC	11
audience	audience	JJ	1
audience-meld	audience-meld	JJ	1
audienceless	audienceless	JJ	1
audiences	audience	NNS	281
audiences	audience	NNP	20
audiences	audiences	UNC	1
audiencia	audiencium	NNP	1
audienzzimmer	audienzzimmer	NNP	1
audigy	audigy	NNP	1
audin	audin	NNP	1
audio	audio	JJ	181
audio	audio	NN	37
audio	audio	NNP	25
audio-book	audio-book	JJ	1
audio-fanatic	audio-fanatic	JJ	1
audio-review	audio-review	NNP	1
audio-reviews	audio-review	NNP	9
audio-taped	audio-taped	JJ	2
audio-taping	audio-taping	JJ	1
audio-video	audio-video	JJ	1
audio-visual	audio-visual	JJ	23
audio-visuals	audio-visual	JJ	1
audiobook	audiobook	NN	5
audiobooks	audiobook	NNP	3
audiobooks	audiobook	NNS	2
audiocasette	audiocasette	NN	1
audiogalaxy	audiogalaxy	NNP	1
audiologic	audiologic	JJ	1
audiological	audiological	JJ	1
audiological	audiological	NNP	1
audiologist	audiologist	NN	1
audiologists	audiologist	NNS	1
audiology	audiology	NN	1
audiology	audiology	NNP	1
audiometric	audiometric	JJ	1
audiometric	audiometric	NNP	1
audiophile	audiophile	NN	5
audiophiles	audiophile	NNS	1
audiophiles	audiophile	NNP	1
audiopollution	audiopollution	NN	1
audiotape	audiotape	NN	6
audiotaped	audiotaped	JJ	1
audiotapes	audiotape	NNS	13
audiotypist	audiotypist	NN	2
audiovisual	audiovisual	NN	14
audiovisual	audiovisual	NNP	1
audis	audi	NNP	3
audit	audit	NN	863
audit	audit	NNP	177
audit	audit	VB	39
audit	audit	UNC	4
audit-consulting	audit-consulting	JJ	1
audit-econscene	audit-econscene	NNP	1
audit-independence	audit-independence	JJ	1
audit-reporting	audit-reporting	JJ	1
auditable	auditable	JJ	2
audited	audit	VBN	140
audited	audit	VBD	8
auditee	auditee	NN	1
auditing	audit	VBG	125
auditing	auditing	NNP	95
auditing	auditing	NN	35
auditing-oversight	auditing-oversight	JJ	2
audition	audition	NN	22
audition	audition	VB	15
audition	audition	NNP	2
auditioned	auditioned	JJ	7
auditioners	auditioner	NNS	1
auditioning	audition	VBG	3
auditioning	auditioning	NNP	1
auditions	audition	NNS	16
auditions	audition	NNP	1
auditnet	auditnet	NNP	1
auditnet	auditnet	NN	1
audito	audito	NN	1
auditor	auditor	NN	173
auditor	auditor	NNP	11
auditori	auditorus	NNP	1
auditoria	auditorium	NN	2
auditorium	auditorium	NN	58
auditorium	auditorium	NNP	18
auditoriums	auditorium	NNS	4
auditors	auditor	NNS	858
auditors-www	auditors-www	NNP	1
auditory	auditory	NN	54
auditory	auditory	NNP	3
auditory-only	auditory-only	JJ	1
audits	audit	NN	271
audits	audit	NNP	12
audits	audit	NNS	10
audits	audits	UNC	1
audoen	audoen	NNP	6
audouin	audouin	NNP	2
audra	audra	NNP	5
audran	audran	NNP	1
audre	audre	NNP	1
audrey	audrey	NNP	40
audubon	audubon	NNP	48
auel	auel	NNP	1
auent	auent	NN	1
auer	auer	NNP	3
auerbach	auerbach	NNP	14
auerswald	auerswald	NNP	1
auf	auf	NN	9
auf	auf	NNP	4
aufait	aufait	NN	1
auferre	auferre	NN	1
aufhauser	aufhauser	NNP	3
aufraeumarbeiten	aufraeumarbeiten	NNP	1
aufs	auf	NNS	1
aufs	auf	NNP	1
aufschnaiter	aufschnaiter	NNP	2
aug	aug	NNP	873
aug	aug	NN	1
auga	auga	NN	1
augabrún	augabrún	NN	1
augaitis	augaitis	NNP	1
auge	auge	NNP	5
augean	augean	NNP	4
augenblick	augenblick	NNP	2
augenbraue	augenbraue	NNP	2
augendre	augendre	NNP	1
augenlid	augenlid	NNP	1
augenwimper	augenwimper	NNP	2
augered	augered	JJ	1
augggichkkh	augggichkkh	NNP	1
augh	augh	NNP	10
augh	augh	NN	1
aught	aught	NNP	3
aughter	aughter	NN	1
augie	augie	NNP	1
augment	augment	VB	51
augment-efforts	augment-effort	JJ	1
augmentation	augmentation	NN	18
augmentations	augmentation	NNS	2
augmentative	augmentative	JJ	6
augmentatives	augmentative	NNS	1
augmented	augmented	JJ	61
augmented	augmented	NNP	16
augmenteth	augmenteth	NN	1
augmentin	augmentin	NNP	6
augmenting	augment	VBG	7
augmenting	augmenting	NNP	2
augments	augment	NNS	7
augmon	augmon	NNP	2
augnahár	augnahár	NN	1
augs	aug	NNP	1
augsburg	augsburg	NNP	3
augur	augur	NN	3
augured	augured	JJ	2
auguring	augur	VBG	2
augurs	augur	NNS	3
august	august	NNP	1207
august	august	JJ	21
augusta	augusta	NNP	109
augustan	augustan	NNP	1
auguste	auguste	NNP	11
augustin	augustin	NNP	2
augustine	augustine	NNP	62
augustinian	augustinian	NNP	4
augustinians	augustinian	NNP	1
augustins	augustin	NNP	2
augusto	augusto	NNP	42
augustus	augustus	NNP	25
augustus	augustus	JJ	1
augustí	augustí	NNP	1
auiar	auiar	NNP	1
aujourd	aujourd	NN	2
auken	auken	NNP	3
aukofer	aukofer	NNP	1
auks	auk	NNS	1
aul	aul	NN	68
aul	aul	UNC	1
aul	aul	NNP	1
aula	aulum	NNP	3
aulaqi	aulaqus	NNP	29
auld	auld	NNP	12
auld	auld	NN	3
aulenti	aulentus	NNP	2
auler	auler	NNP	1
auletta	auletta	NNP	3
auli	aulus	NNP	1
aulin	aulin	NNP	3
ault	ault	NN	1
ault	ault	NNP	1
aum	aum	NNP	9
aumale	aumale	NNP	1
aumann	aumann	NNP	9
aumc	aumc	NNP	2
aumone	aumone	NNP	1
aun	aun	NNP	1
aunched	aunched	JJ	1
aundience	aundience	NN	1
aung	aung	NNP	30
aunified	aunified	NNP	1
aunt	aunt	NN	243
aunt	aunt	NNP	83
aunt	aunt	UNC	1
auntie	auntie	NNP	16
auntie	auntie	NN	2
aunties	auntie	NNS	4
auntly	auntly	NNP	1
aunts	aunt	NNS	69
aunts	aunt	NNP	1
aunts	aunts	NNP	1
auntum	auntum	NN	1
auotradiography	auotradiography	NN	1
aupeix	aupeix	NNP	1
aura	aura	NN	86
aura	aura	NNP	4
auraient	auraient	NN	1
aural	aural	JJ	10
aural	aural	NNP	3
aurally	aurally	RB	3
aurangabad	aurangabad	NNP	1
aurangzeb	aurangzeb	NNP	9
aurantiacus	aurantiacus	JJ	1
aurantium	aurantium	NN	13
auraptene	auraptene	NN	1
auras	aura	NNS	4
auratus	auratus	JJ	3
aurea	aurea	NNP	1
aureli	aurelus	NNP	1
aurelia	aurelium	NNP	31
aurelia	aurelium	NN	31
aurelian	aurelian	NNP	1
aurelio	aurelio	NNP	9
aurelius	aurelius	NNP	11
aurelius	aurelius	UNC	1
aurengzeb	aurengzeb	NNP	2
aureole	aureole	NN	1
aureoumbra	aureoumbra	NNP	1
aureus	aureus	NN	154
aureusand	aureusand	NN	1
aureusinduces	aureusinduce	NNS	1
aureusinfections	aureusinfection	NNS	1
aureusrequires	aureusrequire	NNS	1
aurevilly	aurevilly	NNP	2
auriculatum	auriculatum	NN	1
auriga	auriga	NNP	2
aurilia	aurilium	NNP	5
aurion	aurion	NNP	6
auriongold	auriongold	NNP	4
auritum	auritum	NN	4
aurobindo	aurobindo	NNP	1
aurora	aurora	NNP	14
aurora	aurora	NN	4
auroville	auroville	NNP	1
aurthur	aurthur	NNP	1
aurturo	aurturo	NNP	1
aurum	aurum	NN	3
aus	aus	NNP	8
aus	aus	JJ	2
ausbildung	ausbildung	NNP	1
ausbrook	ausbrook	NNP	1
auschwitz	auschwitz	NNP	40
auscultation	auscultation	NN	1
auseful	auseful	NNP	1
ausing	ause	VBG	1
ausing	ausing	NNP	1
auskeper	auskeper	NNP	1
ausmus	ausmus	NNP	25
auso	auso	NN	1
auspices	auspices	NNS	20
auspices	auspices	NNP	1
auspicious	auspicious	JJ	15
auspiciously	auspiciously	RB	2
ausser	ausser	NN	1
aussi	aussus	NN	2
aussie	aussie	NNP	42
aussie-talk	aussie-talk	NNP	1
aussieinamerica	aussieinamerica	NN	2
aussies	aussy	NNP	9
ausstellung	ausstellung	NNP	1
ausstellungsgelände	ausstellungsgelände	NNP	1
aust	aust	NNP	5
austell	austell	NNP	1
austen	austen	NNP	41
austen	austen	UNC	1
austenlike	austenlike	NNP	1
auster	auster	NNP	2
austere	austere	JJ	81
austere	austere	NNP	1
austerely	austerely	RB	2
austerities	austerity	NNS	3
austerity	austerity	NN	40
austerity	austerity	NNP	1
austerlitz	austerlitz	NNP	4
austin	austin	NNP	861
austin	austin	NN	1
austin	austin	UNC	1
austin-based	austin-based	NNP	4
austin-film-review	austin-film-review	NNP	3
austinite	austinite	NNP	3
austinpowers	austinpower	NNS	1
austintatiously	austintatiously	RB	1
austrailia	austrailium	NNP	1
austrailian	austrailian	NNP	3
austral	austral	NN	2
austral	austral	NNP	1
australasian	australasian	NNP	3
australia	australia	UNC	1
australia	australium	NNP	469
australian	australian	JJ	292
australian	australian	NNP	86
australian	australian	NN	2
australian-built	australian-built	NNP	1
australian-edition	australian-edition	NNP	1
australian-led	australian-led	NNP	3
australian-style	australian-style	NNP	1
australianism	australianism	NNP	1
australianisms	australianism	NNP	3
australians	australian	NNPS	44
australo	australo	NNP	1
australoids	australoid	NNP	2
australopithecine	australopithecine	NNP	1
australopithecus	australopithecus	NNP	2
austria	austria	NNP	1
austria	austrium	NNP	98
austria	austrium	NN	1
austrialian	austrialian	NNP	1
austrian	austrian	JJ	49
austrian	austrian	NNP	15
austrian-held	austrian-held	NNP	1
austrian-part	austrian-part	NNP	1
austrians	austrian	NNP	19
austro	austro	NNP	10
austroicetes	austroicete	NNP	1
austrolopithecus	austrolopithecus	JJ	1
ausubel	ausubel	NNP	1
aus­trians	aus­trians	NNP	1
aut	aut	NN	1
autapomorphies	autapomorphy	NNS	3
autditorium	autditorium	NN	1
autem	autem	NN	3
auterist	auterist	NN	2
auters	auter	NNS	1
auteuil	auteuil	NNP	2
auteur	auteur	NN	14
auteur	auteur	UNC	1
auteur	auteur	NNP	1
auteuristic	auteuristic	JJ	1
auteurs	auteur	NNP	6
auteurs	auteur	NNS	5
auteurs	auteurs	UNC	1
auth	auth	NNP	1
authenic	authenic	NNP	1
authenicity	authenicity	NN	1
authentic	authentic	JJ	247
authentic	authentic	NNP	10
authentic-feeling	authentic-feeling	JJ	1
authentic-sounding	authentic-sounding	JJ	1
authentically	authentically	RB	17
authentically	authentically	NNP	1
authenticate	authenticate	NN	10
authenticated	authenticated	JJ	9
authenticates	authenticate	NNS	3
authenticating	authenticating	NNP	1
authentication	authentication	NN	11
authentication	authentication	NNP	1
authenticities	authenticity	NNS	1
authenticity	authenticity	NN	97
authenticity	authenticity	NNP	2
authenticity	authenticity	UNC	1
authentick	authentick	NN	1
authenticode	authenticode	NNP	1
authenticy	authenticy	NN	1
authie	authie	NNP	1
author	author	NN	1693
author	author	NNP	7
author	author	UNC	5
author	author	JJ	1
author-side	author-side	JJ	1
authored	author	VBN	21
authoredbyralphs	authoredbyralph	NN	1
authoress	authoress	NNS	2
authorial	authorial	NN	10
authorially	authorially	RB	2
authoring	author	VBG	2
authorisation	authorisation	NN	1
authorised	authorised	JJ	1
authorit-ahy	authorit-ahy	NNP	1
authoritarian	authoritarian	JJ	66
authoritarian	authoritarian	NNP	2
authoritarian-moral	authoritarian-moral	JJ	1
authoritarianism	authoritarianism	NN	18
authoritarians	authoritarian	NNS	5
authoritarians	authoritarians	UNC	1
authoritative	authoritative	JJ	76
authoritative	authoritative	NNP	4
authoritatively	authoritatively	RB	10
authoritativeness	authoritativeness	NNS	1
authoritay	authoritay	NN	1
authorities	authorities	UNC	2
authorities	authority	NNS	868
authorities	authority	NNP	5
authorities-a	authorities-a	JJ	1
authority	authority	NN	1305
authority	authority	NNP	436
authority	authority	UNC	9
authority	authority	JJ	2
authority-resistant	authority-resistant	JJ	1
authority-the	authority-the	NNP	1
authorization	authorization	NN	178
authorization	authorization	NNP	21
authorization	authorization	UNC	1
authorizations	authorization	NNS	10
authorizations	authorization	NNP	1
authorize	authorize	VB	71
authorized	authorize	VBN	140
authorized	authorize	VBD	112
authorized	authorized	NNP	8
authorized	authorized	JJ	3
authorized	authorized	UNC	1
authorizes	authorize	VBZ	25
authorizing	authorize	VBG	64
authorizing	authorizing	NNP	4
authors	author	NNS	1130
authors	author	NNP	336
authors	authors	UNC	4
authorship	authorship	NN	25
authorship	authorship	NNP	4
authorsontheweb	authorsontheweb	NN	1
authour	authour	NN	1
autin	autin	NNP	6
autiorium	autiorium	NN	1
autism	autism	NN	42
autism	autism	NNP	9
autism	autism	UNC	3
autism-associated	autism-associated	JJ	1
autistic	autistic	JJ	48
autists	autists	UNC	1
autito	autito	NN	1
auto	auto	NN	260
auto	auto	NNP	51
auto-accident	auto-accident	JJ	1
auto-activation	auto-activation	JJ	1
auto-answer	auto-answer	JJ	1
auto-antibodies	auto-antibody	NNP	1
auto-antibodies	auto-antibody	JJ	1
auto-antigen	auto-antigen	JJ	1
auto-anything	auto-anything	JJ	1
auto-archive	auto-archive	NNP	1
auto-archiving	auto-archiving	JJ	1
auto-associative	auto-associative	JJ	3
auto-blood-letting	auto-blood-letting	JJ	1
auto-bmw-m	auto-bmw-m	NNP	1
auto-briefs	auto-brief	NNP	1
auto-by	auto-by	NNP	1
auto-catalytic	auto-catalytic	JJ	1
auto-commentary	auto-commentary	JJ	1
auto-commotion	auto-commotion	JJ	1
auto-correct	auto-correct	JJ	1
auto-da-f	auto-da-f	NNP	1
auto-deliveries	auto-delivery	JJ	1
auto-dimming	auto-dimming	JJ	2
auto-ellipsis	auto-ellipsis	JJ	1
auto-emissions	auto-emission	NNS	1
auto-emissions-review	auto-emissions-review	NNP	1
auto-erotic	auto-erotic	JJ	1
auto-eroticism	auto-eroticism	JJ	1
auto-eroticism	auto-eroticism	NNP	1
auto-flagellate	auto-flagellate	JJ	1
auto-fluorescence	auto-fluorescence	JJ	4
auto-focusing	auto-focusing	JJ	1
auto-gamma	auto-gamma	JJ	1
auto-immune	auto-immune	JJ	2
auto-inhibition	auto-inhibition	JJ	2
auto-inhibitory	auto-inhibitory	JJ	3
auto-inhibitory	auto-inhibitory	NNP	1
auto-injector	auto-injector	JJ	1
auto-insurance	auto-insurance	NN	2
auto-level	auto-level	JJ	1
auto-lexus	auto-lexus	NNP	1
auto-makers	auto-maker	JJ	2
auto-manacles	auto-manacle	JJ	1
auto-museum	auto-museum	NNP	1
auto-nissan	auto-nissan	NNP	1
auto-oldsmobile	auto-oldsmobile	NNP	1
auto-parts	auto-part	JJ	1
auto-pilot	auto-pilot	JJ	1
auto-piloting	auto-piloting	JJ	1
auto-record	auto-record	JJ	1
auto-related	auto-related	JJ	1
auto-repair	auto-repair	JJ	1
auto-rescue-systems	auto-rescue-system	NNP	1
auto-response	auto-response	JJ	1
auto-rickshaws	auto-rickshaw	JJ	1
auto-safety	auto-safety	NNP	1
auto-safety	auto-safety	JJ	1
auto-scan	auto-scan	JJ	1
auto-suggestion	auto-suggestion	JJ	1
auto-synchronizes	auto-synchronize	JJ	1
auto-theft	auto-theft	JJ	4
auto-translate	auto-translate	JJ	1
auto-tuning	auto-tuning	JJ	1
auto-watering	auto-watering	JJ	1
autoaligned	autoaligned	JJ	1
autoanalyzer	autoanalyzer	NN	1
autoantibodies	autoantibody	NNS	64
autoantibodies	autoantibody	NNP	3
autoantibody	autoantibody	NN	17
autoantibody	autoantibody	NNP	2
autoantigen	autoantigen	NN	16
autoantigen	autoantigen	NNP	1
autoantigenic	autoantigenic	JJ	2
autoantigens	autoantigen	NNS	41
autoassembler	autoassembler	NNP	3
autobahn	autobahn	NNP	7
autobahn	autobahn	NN	2
autobahn-style	autobahn-style	JJ	1
autobio	autobio	NNP	4
autobiographical	autobiographical	JJ	47
autobiographical	autobiographical	NNP	3
autobiographical	autobiographical	UNC	1
autobiographies	autobiography	NNS	12
autobiography	autobiography	NN	119
autobiography	autobiography	NNP	28
autobiography-as-get-out-of	autobiography-as-get-out-of	JJ	1
autobots	autobot	NNP	2
autobús	autobús	NNS	1
autocad	autocad	NNP	1
autocares	autocare	NNP	1
autocatalysis	autocatalysis	NNS	4
autocatalytic	autocatalytic	JJ	53
autocatalytic	autocatalytic	NNP	1
autocatalytically	autocatalytically	RB	1
autoclaved	autoclaved	JJ	4
autoclaving	autoclave	VBG	1
autocomplete	autocomplete	NN	1
autocondimentation	autocondimentation	NN	1
autocontrast	autocontrast	NNP	1
autocorrect	autocorrect	NN	2
autocorrecting	autocorrect	VBG	3
autocorrection	autocorrection	NN	1
autocorrects	autocorrect	NNS	2
autocorrelation	autocorrelation	NN	33
autocorrelation	autocorrelation	NNP	2
autocovariance	autocovariance	NN	1
autocracies	autocracy	NNS	3
autocracy	autocracy	NN	3
autocrat	autocrat	NN	6
autocratic	autocratic	JJ	23
autocrats	autocrat	NNS	5
autocrine	autocrine	NN	16
autocue	autocue	NNP	1
autodecay	autodecay	NNP	1
autodefensas	autodefensa	NNP	1
autodesk	autodesk	NNP	1
autodialed	autodialed	JJ	1
autodidact	autodidact	NN	3
autodidacts	autodidact	NNS	3
autodock	autodock	NNP	6
autodrome	autodrome	NN	2
autoerotic	autoerotic	JJ	5
autoeroticism	autoeroticism	NN	1
autoeurope	autoeurope	NN	1
autofeatures	autofeature	NNS	1
autofinish	autofinish	NNP	9
autofluorescence	autofluorescence	NN	13
autofluorescence	autofluorescence	NNP	1
autofluorescent	autofluorescent	NN	4
autogene	autogene	NN	23
autogene	autogene	NNP	1
autogestion	autogestion	NN	1
autograph	autograph	NN	28
autograph	autograph	VB	9
autograph-model	autograph-model	JJ	1
autograph-seekers	autograph-seeker	JJ	1
autographa	autographa	NNP	2
autographable	autographable	JJ	1
autographed	autograph	VBN	15
autographing	autograph	VBG	4
autographs	autograph	NNS	33
autogrid	autogrid	NNP	1
autogrills	autogrill	NNS	1
autogynephiles	autogynephile	NNS	1
autogynephilia	autogynephilia	NN	1
autohagiography	autohagiography	NN	1
autoharp	autoharp	NN	1
autoim-mune	autoim-mune	JJ	1
autoimmune	autoimmune	JJ	177
autoimmune	autoimmune	NNP	3
autoimmune-prone	autoimmune-prone	JJ	1
autoimmunity	autoimmunity	NN	46
autoimmunity	autoimmunity	NNP	1
autoimmunity-prone	autoimmunity-prone	JJ	1
autoimmunization	autoimmunization	NN	1
autoinhibited	autoinhibited	JJ	1
autoinhibition	autoinhibition	NN	4
autoinhibitory	autoinhibitory	NN	5
autolevels	autolevel	NNP	1
autolinee	autolinee	NNP	1
autologous	autologous	JJ	8
autologous	autologous	NNP	1
autolysins	autolysin	NNS	2
autolyzed	autolyzed	JJ	1
automa	automa	NN	1
automacs	automac	NNP	1
automacs	automac	NN	1
automagical	automagical	JJ	1
automagically	automagically	RB	1
automaker	automaker	NN	15
automaker	automaker	UNC	1
automakers	automaker	NNS	52
automakers	automaker	NNP	11
automaking	automake	VBG	1
automata	automaton	NNP	1
automata	automaton	NN	1
automatable	automatable	JJ	1
automate	automate	NN	19
automated	automate	VBN	345
automated	automated	NNP	50
automated	automated	JJ	6
automated-cutting	automated-cutting	JJ	1
automates	automate	VBZ	3
automatic	automatic	JJ	343
automatic	automatic	NNP	14
automatic-cutting	automatic-cutting	JJ	4
automatic-elevator	automatic-elevator	JJ	1
automatic-shift	automatic-shift	JJ	1
automatic-teller	automatic-teller	JJ	1
automatic-transmission	automatic-transmission	JJ	1
automatic-weapons	automatic-weapon	JJ	1
automatical	automatical	JJ	1
automatically	automatically	RB	395
automatically	automatically	UNC	2
automatically	automatically	NNP	1
automatics	automatic	NNS	4
automating	automate	VBG	8
automation	automation	NN	53
automation	automation	NNP	6
automatiste	automatiste	NNP	1
automatistes	automatist	NNP	1
automaton	automaton	NN	5
automaton-like	automaton-like	JJ	1
automatons	automaton	NNS	3
automats	automat	NNP	1
autometer	autometer	NN	1
automne	automne	NNP	3
automobile	automobile	NN	168
automobile	automobile	NNP	26
automobile	automobile	UNC	1
automobile-manual	automobile-manual	JJ	1
automobile-product	automobile-product	JJ	1
automobiles	automobile	NNS	124
automobilist	automobilist	NN	1
automobilists	automobilist	NNS	1
automotive	automotive	JJ	55
automotive	automotive	NNP	20
automotives	automotive	NNS	2
autonation	autonation	NNP	1
autonomic	autonomic	JJ	14
autonomist	autonomist	NN	1
autonomists	autonomist	NNS	1
autonomists	autonomist	NNP	1
autonomous	autonomous	JJ	340
autonomous	autonomous	NNP	21
autonomous-agent	autonomous-agent	JJ	3
autonomously	autonomously	RB	11
autonomy	autonomy	NN	155
autonomy	autonomy	NNP	4
autonomy	autonomy	UNC	3
autoparser	autoparser	NNP	3
autopenectomy	autopenectomy	NN	1
autophagic	autophagic	JJ	5
autophagosome	autophagosome	NN	1
autophagosome-lysosome	autophagosome-lysosome	JJ	1
autophagosomes	autophagosome	NNS	1
autophagy	autophagy	NN	8
autophosphorylated	autophosphorylated	JJ	1
autophosphorylates	autophosphorylate	NNS	1
autophosphorylation	autophosphorylation	NN	33
autophosphorylation	autophosphorylation	NNP	1
autopilot	autopilot	NN	31
autopilot	autopilot	UNC	1
autopilots	autopilot	NNS	3
autopilots	autopilot	NNP	3
autopista	autopista	NNP	2
autopista	autopista	NN	2
autoplay	autoplay	NNP	4
autopo	autopo	NN	1
autopol	autopol	NN	1
autopolis	autopoli	NNP	1
autopolyploid	autopolyploid	NN	3
autopolyploidy	autopolyploidy	NN	11
autoprocess	autoprocess	NNS	1
autopromote	autopromote	NNP	2
autopromote	autopromote	NN	1
autopromoted	autopromoted	JJ	1
autopromotion	autopromotion	NNP	1
autopromotion	autopromotion	NN	1
autopsie	autopsie	NNP	1
autopsied	autopsied	JJ	1
autopsies	autopsy	NNS	30
autopsy	autopsy	NN	74
autopsy	autopsy	NNP	10
autopsy	autopsy	UNC	2
autopurge	autopurge	NNP	1
autoquant	autoquant	NNP	1
autor	autor	NNP	1
autoradiogaphy	autoradiogaphy	NN	2
autoradiogram	autoradiogram	NN	3
autoradiograms	autoradiogram	NNS	4
autoradiograms	autoradiogram	NNP	1
autoradiograph	autoradiograph	NN	3
autoradiographed	autoradiographed	JJ	6
autoradiographic	autoradiographic	JJ	4
autoradiographs	autoradiograph	NNS	2
autoradiographs	autoradiograph	NNP	1
autoradiography	autoradiography	NN	40
autoreactive	autoreactive	JJ	12
autoreactive	autoreactive	NNP	1
autoreactivity	autoreactivity	NN	1
autoreceptors	autoreceptor	NNS	1
autoregressive	autoregressive	JJ	9
autoregu-lation	autoregu-lation	JJ	1
autoregulate	autoregulate	NN	1
autoregulation	autoregulation	NN	3
autoregulatory	autoregulatory	NN	11
autoreparaturwerkstatt	autoreparaturwerkstatt	NNP	2
autoreplies	autoreply	NNP	2
autoreply	autoreply	RB	1
autoroute	autoroute	NN	15
autoroute	autoroute	NNP	1
autoroutes	autoroute	NNS	1
autos	auto	NNS	9
autos	auto	NNP	5
autos-bmw-m	autos-bmw-m	NNP	2
autos-bmw-z	autos-bmw-z	NNP	1
autos-column	autos-column	NNP	2
autos-landrover-freelander	autos-landrover-freelander	NNP	4
autos-mercedes-sl	autos-mercedes-sl	NNP	1
autos-review	autos-review	NNP	2
autosamdri	autosamdrus	NNP	1
autosampler	autosampler	NN	1
autoscan	autoscan	NNP	1
autoschediastic	autoschediastic	JJ	1
autoscopes	autoscope	NNS	1
autosegmental	autosegmental	NNP	1
autosomal	autosomal	NN	57
autosomal-dominant	autosomal-dominant	JJ	1
autosomally	autosomally	RB	1
autosome	autosome	NN	1
autosomes	autosome	NNS	16
autostick	autostick	NNP	2
autostrada	autostrada	NN	4
autostrade	autostrade	NNP	2
autosummarize	autosummarize	NNP	16
autothrottle	autothrottle	NN	2
autotors	autotor	NNP	2
autotrader	autotrader	NN	2
autotrends	autotrend	NNP	1
autotroph	autotroph	NN	1
autotrophically	autotrophically	RB	1
autoworkers	autoworker	NNS	1
autozooids	autozooid	NNS	1
autralian	autralian	NNP	1
autre	autre	NN	2
autrum	autrum	NNP	1
autry	autry	NNP	10
autsaid	autsaid	NNP	1
autumn	autumn	NN	125
autumn	autumn	NNP	30
autumn	autumn	UNC	1
autumnal	autumnal	NN	5
autumny	autumny	NN	1
autun	autun	NNP	4
auu	auu	NNP	2
auuua	auuua	NNP	5
auuuuuugh	auuuuuugh	NNP	1
auuuuuuuugh	auuuuuuuugh	NNP	1
auvergnat	auvergnat	NNP	1
auvergne	auvergne	NNP	1
auvers	auver	NNP	8
auvers-sur	auvers-sur	NNP	4
auvil	auvil	NNP	3
auw	auw	NNP	1
auw	auw	NN	1
aux	aux	NN	24
aux	aux	NNP	8
auxerre	auxerre	NNP	2
auxerrois	auxerroi	NNP	1
auxiliary	auxiliary	JJ	41
auxiliary	auxiliary	NNP	4
auxin	auxin	NN	17
auxin-induced	auxin-induced	JJ	3
auxin-regulated	auxin-regulated	JJ	1
auxin-response	auxin-response	JJ	1
auxin-responsive	auxin-responsive	JJ	1
auxin-upregulated	auxin-upregulated	JJ	1
auxotroph	auxotroph	NN	2
auxotrophic	auxotrophic	JJ	6
auxotrophs	auxotroph	NNS	5
auxotrophy	auxotrophy	NN	4
auyuittuq	auyuittuq	NNP	3
av	av	NNP	47
av	av	NN	5
ava	ava	NNP	15
ava	ava	UNC	1
avac	avac	NNP	3
avaii	avaius	NNP	3
avail	avail	NN	36
availabilities	availability	NNS	1
availability	availability	NN	464
availability	availability	NNP	24
availability-based	availability-based	JJ	3
availabl	availabl	NN	1
available	available	JJ	4612
available	available	NNP	88
available	available	UNC	11
available-anywhere	available-anywhere	JJ	1
availableto	availableto	NN	1
availed	availed	JJ	2
availiable	availiable	NNP	1
availing	avail	VBG	1
availresponses	availresponse	NN	1
avalance	avalance	NN	1
avalanche	avalanche	NN	56
avalanche	avalanche	NNP	5
avalanche-prone	avalanche-prone	JJ	1
avalanches	avalanch	NNS	67
avalanching	avalanch	VBG	1
avaler	avaler	NN	2
avaliabel	avaliabel	NN	1
avaliable	avaliable	JJ	3
avallon	avallon	NNP	1
avalokitesvara	avalokitesvara	NNP	1
avalon	avalon	NNP	16
avaluacio	avaluacio	NNP	1
avanesyan	avanesyan	NNP	1
avant	avant	NN	8
avant	avant	NNP	3
avant-funk	avant-funk	JJ	1
avant-garde	avant-garde	NN	81
avant-garde	avant-garde	NNP	3
avant-garde	avant-garde	JJ	1
avant-gardish	avant-gardish	JJ	1
avant-gardist	avant-gardist	JJ	2
avant-gardists	avant-gardist	JJ	2
avantazhiya	avantazhiya	NN	1
avantgarde	avantgarde	NN	1
avantgo	avantgo	NNP	2
avanti	avantus	NNP	3
avanzino	avanzino	NNP	1
avarice	avarice	NN	14
avarice	avarice	NNP	2
avarice	avarice	UNC	1
avaricious	avaricious	JJ	14
avars	avar	NNP	1
avast	avast	NNP	2
avatar	avatar	NN	21
avatar	avatar	NNP	1
avatars	avatar	NNS	18
avaya	avaya	NNP	1
avco	avco	NNP	1
avda	avda	NNP	13
avdat	avdat	NNP	1
ave	ave	NNP	67
ave	ave	NN	8
avebury	avebury	NNP	1
avec	avec	FW	11
avec	avec	NNP	1
avected	avected	JJ	1
aveda	aveda	NNP	10
avedon	avedon	NNP	32
aveeno	aveeno	NNP	4
aveenoed	aveenoed	NNP	1
aveiro	aveiro	NNP	4
aveline	aveline	NNP	2
avelino	avelino	NNP	4
avelok	avelok	NNP	1
aven	aven	NNP	6
avena	avena	NNP	2
avenage	avenage	NN	1
avenge	avenge	VB	23
avenged	avenged	JJ	6
avenger	avenger	NNP	168
avenger	avenger	NN	5
avenger	avenger	UNC	3
avengers	avenger	NNP	65
avengers	avenger	NNS	1
avenges	avenge	NNS	1
avenging	avenge	VBG	12
avenging	avenging	NNP	2
avengings	avenging	NNS	1
avenida	avenida	NNP	43
avenin	avenin	NN	1
aventine	aventine	NNP	2
aventis	aventi	NNP	19
aventura	aventura	NNP	4
aventuras	aventura	NNP	6
aventures	aventure	NNS	1
avenue	avenue	NNP	413
avenue	avenue	NN	111
avenues	avenue	NNS	100
avenues	avenue	NNP	7
aver	aver	NN	1
avera	avera	NN	1
average	average	JJ	2654
average	average	NN	848
average	average	NNP	72
average	average	VB	52
average	average	UNC	10
average	average	VBP	3
average-distance	average-distance	JJ	1
average-income	average-income	JJ	1
average-linkage	average-linkage	JJ	1
average-looking	average-looking	JJ	1
average-or-better	average-or-better	JJ	1
average-priced	average-priced	JJ	1
average-risk	average-risk	JJ	4
average-size	average-size	JJ	2
average-sized	average-sized	JJ	1
average-type	average-type	JJ	1
average??ct	average??ct	NNP	1
averageclassification	averageclassification	NN	1
averaged	average	VBD	169
averaged	average	VBN	88
averaged	averaged	NNP	5
averageness	averageness	NNS	2
averages	average	NNS	113
averages	average	VBZ	16
averages	average	NNP	4
averagesa	averagesa	NNP	1
averaging	average	VBG	101
averaging	averaging	NN	10
averaging	averaging	NNP	5
averbukh	averbukh	NNP	2
averell	averell	NNP	1
averett	averett	NNP	2
averetts	averett	NNP	1
averil	averil	NNP	1
averitt	averitt	NNP	1
avermectin	avermectin	NN	1
averred	aver	VBD	2
avers	aver	NNS	10
averse	averse	NN	25
aversion	aversion	NN	68
aversions	aversion	NNS	1
aversive	aversive	JJ	2
avert	avert	VB	59
avert	avert	NNP	5
avert	avert	UNC	1
averted	avert	VBN	81
averted	averted	NNP	2
averter	averter	NNP	1
avertin	avertin	NN	1
avertin	avertin	NNP	1
averting	avert	VBG	17
averting	averting	NNP	2
averts	avert	VBZ	5
avertv	avertv	NNP	1
avery	avery	NNP	34
aves	ave	NNP	2
avetz	avetz	NNP	1
avez	avez	NN	1
avezzano	avezzano	NNP	9
avg	avg	NN	1
avgoustou	avgoustou	NNP	1
avi	avus	NNP	13
avi	avus	NN	10
avia	avium	NNP	1
avian	avian	NN	26
avian	avian	NNP	1
aviand	aviand	NN	1
aviano	aviano	NNP	6
aviaries	aviary	NNS	2
aviary	aviary	JJ	11
aviary	aviary	NNP	7
aviary	aviary	UNC	1
aviation	aviation	NN	222
aviation	aviation	NNP	174
aviation	aviation	UNC	2
aviation-security-review	aviation-security-review	NNP	1
aviation-to	aviation-to	JJ	1
aviator	aviator	NNP	5
aviator	aviator	NN	4
aviatorka	aviatorka	NN	1
aviators	aviator	NNS	9
aviators	aviator	NNP	1
aviatrix	aviatrix	NN	2
aviatrixes	aviatrix	NNP	1
avici	avicus	NNP	2
avid	avid	JJ	91
avid	avid	NNP	13
avid-vista	avid-vista	NNP	1
avidin	avidin	NN	22
avidin	avidin	NNP	1
avidin-biotin	avidin-biotin	JJ	9
avidin-biotin-horseradish	avidin-biotin-horseradish	JJ	1
avidin-biotin-peroxidase	avidin-biotin-peroxidase	JJ	6
avidin-coated	avidin-coated	NNP	1
avidin-fluorophore	avidin-fluorophore	JJ	1
avidin-peroxidase	avidin-peroxidase	JJ	1
avidin-peroxidase-complex	avidin-peroxidase-complex	JJ	1
avidity	avidity	NN	10
avidly	avidly	RB	21
avifauna	avifauna	NN	1
avigdor	avigdor	NNP	1
avignon	avignon	NNP	16
avila	avilum	NNP	36
avildsen	avildsen	NNP	1
aviles	avile	NNP	1
avin	avin	NNP	1
avinash	avinash	NNP	1
avineri	avinerus	NNP	2
avinguda	avinguda	NNP	10
avinguda	avinguda	NN	1
avinoam	avinoam	NNP	1
aviod	aviod	NN	1
aviodome	aviodome	NNP	2
avionics	avionic	NNS	8
avionics	avionic	NNP	2
avirulence	avirulence	NN	2
avirulent	avirulent	NN	20
avis	avi	NNP	70
avis	avi	NNS	1
avis	avis	UNC	1
avise	avise	NNP	3
avishai	avishaus	NNP	1
avital	avital	NNP	15
avium	avium	NN	76
avium	avium	NNP	1
aviuminfection	aviuminfection	NN	1
aviv	aviv	NNP	156
aviva	aviva	NNP	1
avivah	avivah	NN	1
aviz	aviz	NNP	1
avl	avl	NNP	1
avm	avm	NNP	5
avms	avm	NNP	4
avnet	avnet	NNP	4
avo	avo	NNP	1
avoca	avoca	NNP	4
avocado	avocado	NN	27
avocado	avocado	NNP	4
avocadoes	avocado	NNS	1
avocados	avocado	NNS	9
avocat	avocat	NN	1
avocation	avocation	NN	3
avocational	avocational	NN	2
avocations	avocation	NNS	1
avocet	avocet	NN	1
avogadro	avogadro	NNP	2
avoid	avoid	VB	1465
avoid	avoid	VBP	104
avoid	avoid	NNP	45
avoid	avoid	UNC	5
avoid-the-elephant	avoid-the-elephant	JJ	1
avoid-y	avoid-y	JJ	3
avoidable	avoidable	JJ	15
avoidable	avoidable	NNP	1
avoidance	avoidance	NN	87
avoidance	avoidance	NNP	12
avoidances	avoidance	NNS	1
avoidant	avoidant	NN	4
avoidant	avoidant	NNP	2
avoide	avoide	NN	1
avoided	avoid	VBN	258
avoided	avoid	VBD	107
avoided	avoided	NNP	7
avoided	avoided	UNC	3
avoider	avoider	NN	1
avoidest	avoidest	NNP	1
avoiding	avoid	VBG	293
avoiding	avoiding	NNP	3
avoiding	avoiding	UNC	1
avoids	avoid	VBZ	95
avoids	avoid	NNP	1
avoids	avoids	UNC	1
avoir	avoir	NN	4
avon	avon	NNP	40
avondale	avondale	NNP	1
avonex	avonex	NNP	8
avons	avon	NNS	1
avoparcin	avoparcin	NN	10
avord	avord	NN	2
avorded	avorded	JJ	1
avoriaz	avoriaz	NNP	1
avow	avow	NN	2
avowal	avowal	NN	4
avowed	avowed	JJ	19
avowedly	avowedly	RB	3
avowing	avow	VBG	1
avowing	avowing	NNP	1
avows	avow	NNS	1
avowtier	avowtier	NN	2
avp	avp	NNP	31
avp-induced	avp-induced	NNP	8
avp-stimulated	avp-stimulated	NNP	1
avpv	avpv	NNP	1
avr	avr	NN	8
avr	avr	NNP	1
avraham	avraham	NNP	2
avram	avram	NNP	1
avranches	avranch	NNP	6
avrb	avrb	NN	22
avrband	avrband	NN	2
avril	avril	NNP	11
avrpphb	avrpphb	NN	1
avrrpm	avrrpm	NN	3
avrrps	avrrp	NNS	1
avrrpt	avrrpt	NN	38
avs	av	NNP	4
avs	av	NNS	1
avsp	avsp	NNP	1
avulsed	avulsed	JJ	1
avulsion	avulsion	NN	19
avulsion	avulsion	NNP	3
avuncular	avuncular	JJ	12
avus	avus	NNP	1
avvenire	avvenire	NNP	1
avvocato	avvocato	NN	1
avß	avß	NN	6
aw	aw	UH	150
aw	aw	NNP	33
aw	aw	NN	1
aw-cgi	aw-cgi	JJ	1
aw-shucks	aw-shuck	JJ	11
awacs	awac	NNP	2
awadallah	awadallah	NNP	7
awadly	awadly	NNP	3
awady	awady	NNP	3
awaii	awaius	NN	4
await	await	VBP	51
await	await	VB	37
await	await	NNP	1
awaited	await	VBD	32
awaiting	await	VBG	136
awaiting	awaiting	NNP	6
awaits	await	VBZ	60
awaits	await	NNP	3
awaji	awajus	NNP	4
awake	awake	JJ	180
awake	awake	NNP	5
awake	awake	RB	1
awaked	awaked	JJ	1
awaken	awaken	NN	23
awakened	awaken	VBN	37
awakened	awakened	NNP	1
awakening	awaken	VBG	42
awakening	awakening	NNP	21
awakening	awakening	UNC	1
awakenings	awakening	NNP	11
awakens	awaken	NNS	8
awakes	awake	NNS	3
awaking	awake	VBG	1
awalt	awalt	NNP	2
awana	awana	NNP	1
awara	awara	NNP	2
award	award	NN	341
award	award	NNP	200
award	award	VB	45
award-giving	award-giving	JJ	1
award-ignorer	award-ignorer	JJ	1
award-nominated	award-nominated	NNP	2
award-show	award-show	JJ	1
award-wining	award-wining	NNP	2
award-winner	award-winner	NNP	5
award-winning	award-winning	JJ	37
award-winning	award-winning	NNP	8
award-worthy	award-worthy	JJ	2
awarded	award	VBN	132
awarded	award	VBD	91
awarded	awarded	NNP	4
awardee	awardee	NNP	1
awardees	awardee	NNS	2
awarding	award	VBG	38
awarding	awarding	NN	8
awarding	awarding	NNP	3
awarding	awarding	UNC	1
awards	award	NNS	281
awards	award	NNP	156
awards	award	VBZ	10
awards	awards	UNC	6
awards	awards	NNP	1
awards-watching	awards-watching	NNP	1
aware	aware	JJ	1127
aware	aware	NNP	19
aware	aware	UNC	1
awareness	awareness	NN	399
awareness	awareness	NNP	20
awareness	awareness	UNC	2
awarenesses	awareness	NNS	1
awas	awa	NNS	2
awas	awa	NNP	2
awash	awash	RB	36
awash	awash	NNP	1
away	away	RB	6960
away	away	NNP	20
away	away	UNC	15
away	away	RP	13
away	away	NN	3
away	away	JJ	1
away-from-home	away-from-home	NNP	1
away-where	away-where	JJ	1
awayafter	awayafter	NN	1
awayas	awaya	NNS	1
awaypuff	awaypuff	NN	1
aways	away	NNS	2
awayyyy	awayyyy	NN	1
awb	awb	NNP	1
awda	awda	NNP	1
awe	awe	NN	118
awe	awe	NNP	8
awe-full	awe-full	JJ	1
awe-inspiring	awe-inspiring	JJ	22
awe-inspiring	awe-inspiring	NNP	1
awe-struck	awe-struck	JJ	1
awed	awed	JJ	25
awed	awed	NNP	2
aweek	aweek	NNP	1
aweful	aweful	JJ	1
aweight	aweight	NN	1
awere	awere	NN	1
awere	awere	NNP	1
awes	awe	NNP	1
awesome	awesome	JJ	302
awesome	awesome	NNP	40
awesome	awesome	UNC	1
awesome-ness	awesome-ness	JJ	1
awesomely	awesomely	RB	4
awesomer	awesomer	NN	1
awestruck	awestruck	NN	14
awestruck	awestruck	NNP	1
awful	awful	JJ	722
awful	awful	NNP	15
awful	awful	UNC	1
awfulize	awfulize	NN	1
awfully	awfully	RB	135
awfulness	awfulness	NNS	8
awg	awg	NN	1
awhile	awhile	RB	234
awhile	awhile	NNP	2
awhile	awhile	NN	1
awhile	awhile	JJ	1
awile	awile	NN	1
awith	awith	NN	2
awith	awith	NNP	1
awk	awk	NNP	3
awk	awk	NN	1
awkward	awkward	JJ	244
awkward	awkward	NNP	6
awkward-and	awkward-and	JJ	1
awkward-embarassment	awkward-embarassment	JJ	1
awkward-sized	awkward-sized	JJ	2
awkward-sounding	awkward-sounding	JJ	2
awkwardly	awkwardly	RB	24
awkwardly	awkwardly	NNP	1
awkwardness	awkwardness	NNS	29
awkwardness	awkwardness	NNP	2
awkwardness	awkwardness	UNC	1
awkwardness	awkwardness	JJ	1
awkwardnessand	awkwardnessand	NN	1
awkwardnesses	awkwardness	NNS	1
awl	awl	NN	2
awma	awma	NNP	2
awni	awnus	NNP	1
awning	awn	VBG	11
awning-like	awning-like	JJ	1
awnings	awning	NNS	4
awo	awo	NNP	13
awoke	awake	VBD	26
awoke	awoke	NNP	1
awoken	awoken	NN	3
awol	awol	NNP	16
awolow	awolow	NNP	1
awolowo	awolowo	NNP	1
awols	awol	NNP	1
awomanscorned	awomanscorned	JJ	1
awook	awook	NN	1
awoooo	awoooo	NNP	1
awright	awright	NNP	1
awritten	awritten	NN	1
awry	awry	RB	39
awry	awry	UNC	1
awry	awry	NNP	1
aws	aw	NNP	2
awsat	awsat	NNP	14
awsome	awsome	NN	1
awverlooked	awverlooked	JJ	1
aww	aww	NNP	84
aww	aww	NN	3
awww	awww	NNP	52
awww	awww	NN	7
awwww	awwww	NNP	17
awwww	awwww	NN	4
awwwww	awwwww	NNP	9
awwwwww	awwwwww	NNP	3
awwwwwww	awwwwwww	NNP	1
awwwwwwww	awwwwwwww	NNP	1
awwwwwwwww	awwwwwwwww	NN	1
awwwwwwwwwwwwwwwww	awwwwwwwwwwwwwwwww	NN	1
awwwwwwwwwwwwwwwwww	awwwwwwwwwwwwwwwwww	NNP	1
awzalagh	awzalagh	NNP	1
ax	ax	NNP	82
ax	ax	NN	38
ax-grinders	ax-grinder	JJ	1
axa	axa	NNP	13
axarquía	axarquía	NNP	1
axb	axb	NNP	32
axb-bxa	axb-bxa	NNP	3
axcalibur	axcalibur	NNP	1
axe	axe	NN	89
axe	axe	NNP	17
axe-kick	axe-kick	JJ	1
axe-man	axe-man	JJ	1
axe-murderer	axe-murderer	JJ	2
axe-murderess	axe-murderess	JJ	1
axe-murdering	axe-murdering	JJ	1
axe-thing	axe-thing	JJ	1
axecaliber	axecaliber	NNP	1
axecalibre	axecalibre	NNP	1
axecalibur	axecalibur	NNP	1
axed	axed	JJ	10
axel	axel	NNP	13
axel	axel	NN	2
axelrod	axelrod	NNP	5
axels	axel	NNS	1
axels	axel	NNP	1
axemen	axeman	NNP	1
axenfeld	axenfeld	NNP	4
axenic	axenic	JJ	10
axenic	axenic	NNP	4
axenically	axenically	RB	5
axercalibur	axercalibur	NNP	1
axes	ax	NNS	63
axes	ax	NNP	1
axheads	axhead	NNS	1
axi	axi	NN	2
axial	axial	NN	43
axial	axial	NNP	2
axially	axially	RB	1
axidental	axidental	NN	1
axilla	axillum	NN	11
axilla	axillum	NNP	1
axillae	axilla	NN	2
axillary	axillary	JJ	64
axillary	axillary	NNP	5
axin	axin	NNP	12
axing	axe	VBG	1
axinomancy	axinomancy	NN	1
axiocam	axiocam	NNP	1
axiom	axiom	NN	60
axiomated	axiomated	JJ	1
axiomatic	axiomatic	JJ	12
axioms	axiom	NNS	51
axioms	axiom	NNP	1
axiophot	axiophot	NNP	7
axiophot	axiophot	NN	2
axioplan	axioplan	NNP	3
axioskop	axioskop	NNP	5
axiovert	axiovert	NNP	5
axiovert	axiovert	NN	1
axiovision	axiovision	NNP	1
axis	axis	NNS	243
axis	axis	NNP	17
axis	axis	UNC	1
axl	axl	NNP	3
axle	axle	NN	16
axle-deep	axle-deep	JJ	1
axles	axle	NNS	4
axletrees	axletree	NNS	1
axmaker	axmaker	NNP	2
axminster	axminster	NNP	1
axo-axonic	axo-axonic	JJ	1
axo-dendritic	axo-dendritic	JJ	2
axoclamp	axoclamp	NNP	1
axogenesis	axogenesis	NNS	2
axol	axol	NN	1
axon	axon	NN	37
axon	axon	NNP	30
axon-growth	axon-growth	JJ	1
axonal	axonal	NN	76
axonal	axonal	NNP	4
axonemal	axonemal	NN	1
axonin	axonin	NN	1
axonogenesis	axonogenesis	NNS	3
axonopodis	axonopodi	NNS	1
axons	axon	NNS	76
axopatch	axopatch	NNP	8
axoplasm	axoplasm	NN	1
axotomy	axotomy	NN	21
axotomy-induced	axotomy-induced	JJ	1
axpression	axpression	NN	1
axuve	axuve	NNP	1
axxon	axxon	NNP	3
axxora	axxora	NNP	1
axxw	axxw	NNP	1
axyb	axyb	NNP	1
axénique	axénique	NN	1
ay	ay	NNP	297
ay	ay	NN	41
ay-sis	ay-sis	NNP	1
aya	aya	NN	1
aya	aya	NNP	1
ayaat	ayaat	NNP	1
ayah	ayah	NN	1
ayala	ayalum	NNP	2
ayalon	ayalon	NNP	2
ayamonte	ayamonte	NNP	4
ayant	ayant	NN	1
ayasofya	ayasofya	NNP	2
ayasuluk	ayasuluk	NNP	1
ayatollah	ayatollah	NNP	21
ayatollah	ayatollah	NN	7
ayatollahed	ayatollahed	NNP	1
ayatollahs	ayatollah	NNS	8
ayatollahs	ayatollah	NNP	2
ayazma	ayazma	NN	1
aybak	aybak	NNP	2
aybar	aybar	NNP	1
ayckbourn	ayckbourn	NNP	1
aycock	aycock	NNP	1
aye	aye	NNP	32
aye	aye	NN	19
aye-aye	aye-aye	NNP	1
aye-yup	aye-yup	NNP	1
ayemenem	ayemenem	NNP	2
ayer	ayer	NNP	6
ayers	ayer	NNP	7
ayerst	ayerst	NNP	8
ayes	aye	NNP	2
ayes	aye	NNS	1
aygepong	aygepong	NNP	2
ayi	ayus	NN	1
ayin	ayin	NN	1
aying	ay	VBG	1
aying	aying	NNP	1
ayinger	ayinger	NNP	2
ayios	ayio	NNP	6
aykohyeb	aykohyeb	NNP	2
aykroyd	aykroyd	NNP	5
aylee	aylee	NN	1
aylene	aylene	NNP	1
aylesbury	aylesbury	NNP	6
aylward	aylward	NNP	8
aym	aym	NNP	2
ayman	ayman	NNP	11
aymara	aymara	NNP	6
aymetrix	aymetrix	NNP	1
ayn	ayn	NNP	34
aynak	aynak	NNP	6
ayne	ayne	NN	2
aynity	aynity	NN	3
aynohteb	aynohteb	NNP	1
aynohyeb	aynohyeb	NNP	13
aynohyeb-to-reunion	aynohyeb-to-reunion	NNP	1
ayodhya	ayodhya	NNP	2
ayran	ayran	NN	1
ayres	ayre	NNP	28
ayrshire	ayrshire	NNP	1
ayrton	ayrton	NNP	1
ays	ay	NNS	2
aysel	aysel	NNP	6
aytch	aytch	NN	1
ayto	ayto	NNP	10
ayton	ayton	NNP	1
ayub	ayub	NNP	1
ayuhwa	ayuhwa	NNP	1
ayumi	ayumus	NNP	2
ayun	ayun	NNP	1
ayung	ayung	NNP	3
ayuntamiento	ayuntamiento	NNP	11
ayuntamiento	ayuntamiento	NN	1
ayup	ayup	NNP	22
ayup	ayup	NN	1
ayurveda	ayurveda	NNP	1
ayurveda-film-review	ayurveda-film-review	NNP	1
ayvazian	ayvazian	NNP	2
ayvilik	ayvilik	NNP	1
ayw	ayw	NNP	33
ayway	ayway	NN	1
ayya	ayya	NNP	1
ayyad	ayyad	NNP	3
ayyagari	ayyagarus	NNP	1
ayyam	ayyam	NNP	2
ayyar	ayyar	NNP	1
ayyash	ayyash	NNP	4
ayyubid	ayyubid	NNP	2
ayyy	ayyy	NNP	1
ayyyyyy	ayyyyyy	NNP	1
ayía	ayía	NNP	1
az	az	NNP	111
az-bound	az-bound	NNP	1
az-dependent	az-dependent	NNP	1
az-involved	az-involved	NNP	1
az?	az?	NN	1
aza	aza	NNP	28
aza	aza	NN	3
azac	azac	NNP	1
azacytidine	azacytidine	NN	5
azacytidine	azacytidine	NNP	2
azad	azad	NNP	1
azafrán	azafrán	NN	1
azahara	azahara	NNP	2
azalea	azalea	NN	4
azalea	azalea	NNP	1
azaleas	azalea	NNS	19
azam	azam	NNP	1
azamehr	azamehr	NNP	4
azania	azanium	NNP	2
azar	azar	NNP	1
azar	azar	NN	1
azarchs	azarch	NNP	1
azaria	azarium	NNP	6
azathioprine	azathioprine	NNP	1
azay	azay	NNP	1
azay-le	azay-le	NNP	2
azazel	azazel	NNP	5
azcan	azcan	NNP	2
azcentral	azcentral	NN	1
azcárraga	azcárraga	NNP	1
azdi	azdus	NNP	3
azeglio	azeglio	NNP	1
azelaic	azelaic	JJ	1
azelaoyl	azelaoyl	NN	3
azerbaijan	azerbaijan	NNP	30
azerbaijan	azerbaijan	UNC	1
azerbaijani	azerbaijanus	NNP	1
azerbaijanis	azerbaijani	NNP	4
azeri	azerus	NNP	2
azevedo	azevedo	NNP	5
azhar	azhar	NNP	6
azide	azide	NN	17
azido	azido	NN	2
azienda	azienda	NNP	1
azimuth	azimuth	NN	1
azincourt	azincourt	NNP	3
azing	aze	VBG	1
azinger	azinger	NNP	1
azino-di	azino-di	JJ	1
azir	azir	NNP	1
aziz	aziz	NNP	251
aziz-that	aziz-that	NNP	1
aziza	aziza	NNP	3
azizah	azizah	NNP	10
azizia	azizium	NNP	4
azkaban	azkaban	NNP	12
azköy	azköy	NN	1
azlan	azlan	NNP	1
azle	azle	NN	1
azmi	azmus	NNP	2
aznar	aznar	NNP	11
azo	azo	NN	1
azoarcus	azoarcus	NNP	1
azole	azole	NN	3
azoles	azole	NNS	2
azoospermia	azoospermium	NN	1
azoospermia	azoospermium	NNP	1
azoreans	azorean	NNP	1
azores	azore	NNP	6
azorín	azorín	NNP	1
azospirillum	azospirillum	NNP	2
azotemia	azotemium	NN	8
azotofixans	azotofixan	NNS	1
azouga	azouga	NNP	1
azoulay	azoulay	NNP	4
azoxymethane	azoxymethane	NN	1
azoxymethane-induced	azoxymethane-induced	JJ	1
azr	azr	NNP	11
azraq	azraq	NNP	1
azrou	azrou	NNP	57
azt	azt	NNP	37
aztec	aztec	JJ	74
aztec	aztec	NNP	2
azteca	azteca	NNP	1
aztecas	azteca	NNP	1
aztecs	aztec	NNP	28
aztlan	aztlan	NNP	3
aztlán	aztlán	NNP	25
azul	azul	NNP	6
azulejo	azulejo	NN	13
azulejo	azulejo	NNP	5
azulejo-covered	azulejo-covered	JJ	1
azulejos	azulejo	NNS	29
azulejos	azulejo	NNP	1
azumano	azumano	NNP	1
azur	azur	NNP	11
azura	azura	NNP	6
azure	azure	JJ	15
azure	azure	NNP	3
azure-blue	azure-blue	JJ	1
azurest	azurest	NNP	9
azurite	azurite	NN	1
azusa	azusa	NNP	3
azz	azz	NNP	1
azz-wee	azz-wee	JJ	1
azzalat	azzalat	NN	1
azzam	azzam	NNP	17
azzazzay	azzazzay	NNP	2
azzedine	azzedine	NNP	2
azziz	azziz	NNP	1
azzo	azzo	NN	1
azzurra	azzurra	NNP	2
azzy-gazzies	azzy-gazzy	JJ	1
a­	a­	NNP	1
aß	aß	NNP	7
aäronkerk	aäronkerk	NNP	1
açoeitas	açoeitas	NNS	2
aétmis	aétmis	NNP	2
aéã	aéã	NN	3
aìé	aìé	NN	1
aìê	aìê	NN	2
aïnhoa	aïnhoa	NNP	1
aïtone	aïtone	NNP	2
añejo	añejo	NN	1
añera	añera	NN	1
añtakis	añtakis	NNS	1
aý	aý	NN	3
a–	a–	NNP	4
a–a	a–a	NNP	1
a–c	a–c	NN	3
b	b	NNP	6649
b	b	SYM	3208
b	b	NN	177
b	b	UNC	2
b	b	JJ	2
b-b	b-b	NNP	2
b-b-bye	b-b-bye	JJ	1
b-b-c	b-b-c	NNP	1
b-b-s	b-b	NNP	1
b-ball	b-ball	JJ	4
b-based	b-based	JJ	1
b-binding	b-binding	JJ	1
b-boys	b-boy	JJ	2
b-c	b-c	NNP	8
b-c	b-c	JJ	1
b-cll	b-cll	NNP	3
b-d	b-d	NNP	6
b-d	b-d	JJ	2
b-day	b-day	JJ	11
b-dna	b-dna	NNP	8
b-duplicate	b-duplicate	JJ	1
b-expressing	b-expressing	JJ	2
b-f	b-f	NNP	2
b-fast	b-fast	JJ	1
b-i-g	b-i-g	JJ	1
b-l-a-a-a-n-d	b-l-a-a-a-n-d	JJ	1
b-m	b-m	NNP	2
b-m	b-m	JJ	1
b-m-i	b-m-us	NNP	1
b-mediated	b-mediated	JJ	1
b-mercaptoethanol	b-mercaptoethanol	JJ	1
b-o	b-o	NNP	9
b-p	b-p	NNP	1
b-r	b-r	NNP	5
b-r-e-a-s-t-s	b-r-e-a-s-t	JJ	1
b-r-o-i-l-e-r	b-r-o-i-l-e-r	JJ	2
b-roll	b-roll	JJ	1
b-s	b	NNP	9
b-s-e	b-s-e	NNP	11
b-school	b-school	JJ	1
b-side	b-side	JJ	5
b-side	b-side	NNP	1
b-sides	b-side	JJ	3
b-skp	b-skp	NNP	1
b-spline	b-spline	JJ	1
b-sulfur	b-sulfur	NNP	1
b-t	b-t	NNP	2
b-u-f-f-y	b-u-f-f-y	NNP	1
b-w	b-w	NNP	1
b-x	b-x	NNP	1
b-y	b-y	NNP	4
b-y-b-x	b-y-b-x	NNP	1
b-z	b-z	NNP	1
b?dn?s	b?dn?s	NNS	1
b?gédá	b?gédá	NN	1
b?ij?ng	b?ij?ng	NN	1
b?k	b?k	NN	2
b?l?	b?l?	NN	1
b?lí	b?lí	NN	2
b?ngd?o	b?ngd?o	NN	1
b?s	b?s	NNS	1
b?twulf	b?twulf	NNP	1
ba	ba	NNP	55
ba	ba	NN	34
ba-a-a-a-a-a-a-d	ba-a-a-a-a-a-a-d	JJ	1
ba-aa	ba-aa	NNP	1
ba-con-an-eh-guh-zuh	ba-con-an-eh-guh-zuh	JJ	1
baa	baa	NNP	8
baaaaaaaaaaaack	baaaaaaaaaaaack	NN	1
baaaaaaaaaad	baaaaaaaaaad	NN	1
baaaaaaaaack	baaaaaaaaack	NN	1
baaaaaaad	baaaaaaad	NN	1
baaaaaay	baaaaaay	NNP	1
baaaaad	baaaaad	NNP	1
baaaaad	baaaaad	NN	1
baaaacckkkkk	baaaacckkkkk	NN	1
baaaad	baaaad	NN	1
baaaasil	baaaasil	NNP	1
baaack	baaack	NN	1
baaad	baaad	NN	2
baaah	baaah	NNP	1
baaas	baaa	NNS	1
baad	baad	NN	1
baade	baade	NNP	1
baader	baader	NNP	3
baal	baal	NN	3
baal	baal	NNP	3
baalbek	baalbek	NNP	1
baar	baar	NN	2
baath	baath	NNP	3
baathists	baathist	NNP	1
bab	bab	NNP	14
baba	baba	NNP	19
baba	baba	NN	6
babababababa	babababababa	NN	1
babaganoush	babaganoush	NNP	1
babalicious	babalicious	NNP	1
babaloo	babaloo	NNP	1
babar	babar	NNP	4
babas	baba	NNS	19
babas	baba	NNP	4
babas-limoncello	babas-limoncello	NNP	1
babb	babb	NNP	3
babbage	babbage	NNP	1
babbidge	babbidge	NNP	1
babbitt	babbitt	NNP	33
babble	babble	JJ	28
babble	babble	NN	1
babble-on-ion	babble-on-ion	JJ	1
babble-y	babble-y	JJ	1
babblebabble	babblebabble	JJ	1
babbled	babbled	JJ	2
babblefish	babblefish	NNP	1
babbler	babbler	NN	1
babblers	babbler	NNS	2
babbles	babble	NNS	8
babbling	babble	VBG	29
babbling	babbling	NNP	3
babbly	babbly	RB	2
babbo	babbo	NNP	1
babby	babby	NNP	4
babco	babco	NNP	3
babcock	babcock	NNP	20
babcocks	babcock	NNP	1
babe	babe	NNP	89
babe	babe	NN	56
babel	babel	NNP	11
babeland	babeland	NNP	2
babelard	babelard	NN	1
babelfish	babelfish	NN	4
babelfish	babelfish	NNP	3
babelian	babelian	NNP	2
babelicious	babelicious	JJ	2
babeling	babele	VBG	1
babelon	babelon	NN	1
babelsberg	babelsberg	NNP	4
babely	babely	RB	1
babeness	babeness	NNS	1
babers	baber	NNP	1
babes	babe	NNS	18
babes	babe	NNP	8
babes-dancing-on-bars	babes-dancing-on-bar	JJ	1
babied	babied	JJ	2
babies	babies	UNC	3
babies	baby	NNS	516
babies	baby	NNP	2
babies-to-be	babies-to-be	JJ	1
babij	babij	NNP	6
babillard	babillard	NN	1
babington	babington	NNP	1
babitch	babitch	NNP	3
bablok	bablok	NNP	1
baboia	baboium	NN	1
baboon	baboon	NN	23
baboon	baboon	NNP	4
baboons	baboon	NNS	26
baboons	baboon	NNP	3
babor	babor	NNP	7
babs	bab	NNP	5
babsitting	babsit	VBG	1
babson	babson	NNP	5
babu	babu	NNP	2
babu	babu	NN	1
babuino	babuino	NNP	2
babur	babur	NNP	6
babus	babus	JJ	2
babushkaphobia	babushkaphobia	NN	1
babushkas	babushka	NNS	3
baby	baby	NN	1822
baby	baby	NNP	308
baby	baby	UNC	7
baby-back	baby-back	JJ	1
baby-blue	baby-blue	JJ	2
baby-boom	baby-boom	JJ	1
baby-boomer	baby-boomer	JJ	7
baby-boomers	baby-boomer	JJ	2
baby-child	baby-child	JJ	1
baby-death	baby-death	NNP	1
baby-dyke	baby-dyke	JJ	1
baby-eater	baby-eater	JJ	1
baby-eating	baby-eating	JJ	1
baby-faced	baby-faced	JJ	4
baby-fat	baby-fat	JJ	2
baby-fucker	baby-fucker	JJ	2
baby-having	baby-having	JJ	1
baby-killer	baby-killer	JJ	2
baby-killing	baby-killing	JJ	1
baby-making	baby-making	JJ	2
baby-murder	baby-murder	JJ	1
baby-name	baby-name	JJ	1
baby-naming	baby-naming	JJ	1
baby-related	baby-related	JJ	1
baby-sat	baby-sat	JJ	1
baby-seal	baby-seal	JJ	1
baby-seat	baby-seat	JJ	1
baby-seatwith	baby-seatwith	JJ	1
baby-shit	baby-shit	JJ	1
baby-sit	baby-sit	JJ	8
baby-sits	baby-sit	JJ	2
baby-sitter	baby-sitter	JJ	1
baby-sitting	baby-sitting	JJ	21
baby-sittingism	baby-sittingism	JJ	1
baby-sized	baby-sized	NNP	1
baby-slayers	baby-slayer	JJ	1
baby-smooth	baby-smooth	JJ	1
baby-snatching	baby-snatching	JJ	1
baby-talk	baby-talk	JJ	2
baby-talking	baby-talking	JJ	2
baby-thieves	baby-thieve	JJ	1
baby-to-be	baby-to-be	JJ	1
babybel	babybel	NNP	2
babybel	babybel	NN	1
babybitches	babybitch	NNS	1
babybjorn	babybjorn	NNP	1
babyboom	babyboom	NN	1
babycake	babycake	NN	1
babycakes	babycake	NNP	4
babycakes	babycake	NNS	3
babycenter	babycenter	NN	1
babycheeks	babycheek	NNS	1
babyface	babyface	NNP	5
babyface	babyface	NN	2
babyface-style	babyface-style	NNP	1
babyfaced	babyfaced	JJ	1
babyfaces	babyface	NNS	1
babyfeeding	babyfeeding	NNP	1
babyfood	babyfood	NN	1
babyhood	babyhood	NN	4
babyish	babyish	NN	5
babyista	babyista	NN	1
babykristen	babykristen	NNP	1
babyland	babyland	NNP	3
babylon	babylon	NNP	39
babylone	babylone	NNP	1
babylonia	babylonium	NNP	1
babylonian	babylonian	NNP	20
babylonians	babylonian	NNP	4
babylons	babylon	NNP	1
babymaybe	babymaybe	NN	1
babyname	babyname	NNP	1
babynap	babynap	NN	1
babyraper	babyraper	NN	1
babyrs	babyr	NNP	2
babysat	babysat	NN	12
babyshit	babyshit	NN	4
babysit	babysit	NN	42
babysitter	babysitter	NN	54
babysitter	babysitter	NNP	3
babysitter	babysitter	UNC	1
babysitters	babysitter	NNS	21
babysitters	babysitter	NNP	1
babysitting	babysit	VBG	47
babysitting	babysitting	NNP	1
babysittingwise	babysittingwise	NN	1
babyslings	babysling	NNS	1
babysnatching	babysnatch	VBG	1
babysteps	babystep	NNS	1
babystuff	babystuff	NN	2
babytalk	babytalk	NN	5
babywise	babywise	NNP	1
babywise	babywise	NN	1
bac	bac	NNP	276
bac	bac	NN	6
bac-ac	bac-ac	NNP	1
bac-based	bac-based	NNP	8
bac-by-bac	bac-by-bac	NNP	1
bac-derived	bac-derived	NNP	2
bac-end	bac-end	NNP	5
bac-sized	bac-sized	NNP	1
bac-to	bac-to	NNP	1
baca	baca	NNP	27
bacah	bacah	NN	1
bacalaocodfishmelocotónpeach	bacalaocodfishmelocotónpeach	NN	1
bacalaocodfishnaranjaorange	bacalaocodfishnaranjaorange	NN	1
bacalhao	bacalhao	NN	1
bacalhau	bacalhau	NN	2
bacall	bacall	NNP	13
bacall-like	bacall-like	NNP	1
bacanovic	bacanovic	NNP	18
bacardi	bacardus	NNP	5
bacardi	bacardus	NN	1
bacardí	bacardí	NNP	4
baccalaureat	baccalaureat	NN	2
baccanal	baccanal	NNP	1
baccarat	baccarat	NN	9
baccarat	baccarat	NNP	5
baccaro	baccaro	NNP	1
bacchae	baccha	NNP	1
bacchanal	bacchanal	NN	2
bacchanale	bacchanale	NNP	1
bacchanalia	bacchanalium	NN	1
bacchanalia	bacchanalium	NNP	1
bacchanalian	bacchanalian	NNP	1
bacchanals	bacchanal	NNS	1
bacchants	bacchant	NNS	1
bacchetta	bacchetta	NNP	3
bacchus	bacchus	NNP	9
bace	bace	NNP	1
bacgtgkm	bacgtgkm	NNP	1
bach	bach	NNP	53
bach	bach	NN	5
bacha	bacha	NNP	1
bacharach	bacharach	NNP	9
bachaxichuch	bachaxichuch	NN	1
bachelard	bachelard	NNP	2
bachellier	bachellier	NNP	1
bachelor	bachelor	NN	80
bachelor	bachelor	NNP	54
bachelorette	bachelorette	NNP	8
bachelorette	bachelorette	NN	1
bachelorettes	bachelorette	NNP	1
bachelorhood	bachelorhood	NN	5
bachelors	bachelor	NNS	13
bachelors	bachelor	NNP	3
bachem	bachem	NNP	2
bachir	bachir	NNP	1
bachl	bachl	NNP	1
bachman	bachman	NNP	5
bachofen	bachofen	NNP	1
bachs	bach	NNP	1
bachula	bachulum	NNP	2
bacilli	bacillus	NN	22
bacillus	bacillus	NN	82
bacillus	bacillus	JJ	5
bacillus	bacillus	NNP	1
bacilluscultures	bacillusculture	NNP	1
bacino	bacino	NNP	1
bacio	bacio	NN	1
bacitracin	bacitracin	NN	3
back	back	RB	15684
back	back	NN	1035
back	back	RP	422
back	back	VB	195
back	back	JJ	157
back	back	NNP	56
back	back	UNC	23
back-against-the-wall	back-against-the-wall	JJ	1
back-alley	back-alley	JJ	1
back-among-the-white-hats	back-among-the-white-hat	JJ	1
back-and-forth	back-and-forth	JJ	16
back-and-forths	back-and-forth	JJ	2
back-ansa	back-ansa	JJ	1
back-axle	back-axle	JJ	2
back-axle	back-axle	NNP	2
back-bench	back-bench	JJ	1
back-bencher	back-bencher	JJ	2
back-bone	back-bone	JJ	1
back-bounce	back-bounce	JJ	1
back-breaking	back-breaking	JJ	2
back-burnered	back-burnered	JJ	1
back-clapping	back-clapping	JJ	1
back-country	back-country	JJ	3
back-cover	back-cover	JJ	1
back-cross	back-cross	JJ	1
back-door	back-door	JJ	2
back-end	back-end	JJ	3
back-firing	back-firing	JJ	1
back-formation	back-formation	JJ	5
back-formed	back-formed	JJ	6
back-from-the-dead	back-from-the-dead	JJ	1
back-hall	back-hall	JJ	1
back-handed	back-handed	JJ	2
back-heeled	back-heeled	JJ	1
back-holler	back-holler	JJ	1
back-home	back-home	JJ	1
back-kick	back-kick	JJ	1
back-leak	back-leak	JJ	2
back-lighted	back-lighted	JJ	1
back-lit	back-lit	JJ	1
back-locked	back-locked	JJ	2
back-lot	back-lot	JJ	1
back-lots	back-lot	JJ	1
back-ma	back-ma	JJ	1
back-nine	back-nine	JJ	1
back-of-envelope	back-of-envelope	JJ	1
back-of-the-envelope	back-of-the-envelope	JJ	2
back-of-the-front-section	back-of-the-front-section	JJ	1
back-ordered	back-ordered	JJ	1
back-page	back-page	JJ	3
back-page	back-page	NNP	2
back-pat	back-pat	JJ	2
back-patting	back-patting	JJ	2
back-phosphorylated	back-phosphorylated	JJ	1
back-reading	back-reading	JJ	1
back-related	back-related	JJ	1
back-riding	back-riding	JJ	1
back-road	back-road	JJ	1
back-room	back-room	JJ	8
back-ruffle	back-ruffle	JJ	1
back-runs	back-run	JJ	1
back-scratcher	back-scratcher	JJ	1
back-scratchers	back-scratcher	JJ	1
back-scratching	back-scratching	JJ	1
back-seat	back-seat	JJ	3
back-seat	back-seat	NNP	1
back-selection	back-selection	JJ	1
back-shooters	back-shooter	JJ	1
back-size	back-size	JJ	1
back-slapping	back-slapping	JJ	2
back-stabbers	back-stabber	JJ	1
back-stabbing	back-stabbing	JJ	6
back-stage	back-stage	JJ	1
back-stop	back-stop	JJ	3
back-story	back-story	JJ	2
back-street	back-street	JJ	1
back-talking	back-talking	JJ	1
back-to	back-to	JJ	2
back-to-back	back-to-back	JJ	50
back-to-back	back-to-back	NNP	1
back-to-basics	back-to-basic	JJ	2
back-to-nature	back-to-nature	JJ	1
back-to-school	back-to-school	JJ	7
back-to-school-shopping	back-to-school-shopping	NNP	1
back-to-the-future	back-to-the-future	JJ	1
back-to-the-wall	back-to-the-wall	JJ	1
back-to-work	back-to-work	JJ	2
back-tracking	back-tracking	JJ	1
back-transformed	back-transformed	JJ	1
back-translated	back-translated	JJ	1
back-up	back-up	NN	18
back-ups	back-up	NNS	3
back-ups	back-up	NNP	1
back-wards	back-ward	JJ	1
back-while-dead	back-while-dead	JJ	1
back-window	back-window	JJ	1
back-yard	back-yard	JJ	1
backache	backache	NN	2
backaches	backach	NNS	3
backaches	backaches	UNC	1
backbay	backbay	NNP	1
backbeat	backbeat	NN	8
backbeats	backbeat	NNS	1
backbencher	backbencher	NN	3
backbenchers	backbencher	NNS	1
backbiting	backbiting	NNP	1
backboard	backboard	NN	3
backbone	backbone	NN	154
backbone	backbone	NNP	1
backbone-specific	backbone-specific	JJ	2
backbones	backbone	NNS	9
backbreaking	backbreak	VBG	3
backbreaking	backbreaking	NNP	1
backcast	backcast	NN	1
backchannel	backchannel	NN	1
backcloth	backcloth	NN	1
backcountry	backcountry	NN	1
backcourt	backcourt	NN	6
backcourts	backcourt	NNS	1
backcross	backcross	NNS	16
backcrossed	backcrossed	JJ	11
backcrosses	backcross	NNS	5
backcrossing	backcross	VBG	2
backcrosssing	backcrosss	VBG	1
backdated	backdate	VBD	1
backdating	backdate	VBG	1
backdoor	backdoor	NN	14
backdoor	backdoor	NNP	3
backdown	backdown	NN	1
backdraft	backdraft	NNP	4
backdraft	backdraft	NN	1
backdrop	backdrop	NN	134
backdrop	backdrop	JJ	1
backdropped	backdropped	JJ	2
backdrops	backdrop	NNS	10
backe	backe	NNP	2
backed	back	VBN	239
backed	back	VBD	118
backed	backed	NNP	9
backed	backed	UNC	2
backed-into-a-corner	backed-into-a-corner	JJ	1
backed-up	backed-up	JJ	2
backend	backend	NN	1
backer	backer	NN	15
backer	backer	NNP	1
backers	backer	NNS	39
backers	backer	NNP	8
backfield	backfield	NN	3
backfill	backfill	NN	2
backfill	backfill	NNP	1
backfilling	backfill	VBG	1
backfin	backfin	NN	1
backfin	backfin	NNP	1
backfire	backfire	VB	25
backfire	backfire	VBP	2
backfire	backfire	NNP	2
backfired	backfire	VBN	19
backfired	backfire	VBD	5
backfires	backfire	VBZ	5
backfiring	backfire	VBG	8
backfist	backfist	NN	1
backflip	backflip	NN	1
backflips	backflip	VBZ	3
backflung	backflung	NNP	1
backgammon	backgammon	NN	9
backgound	backgound	NN	1
backgro	backgro	NN	1
background	background	NN	1479
background	background	NNP	772
background	background	UNC	2
background-color	background-color	JJ	1
background-corrected	background-corrected	JJ	10
background-corrected	background-corrected	NNP	1
background-dependent	background-dependent	JJ	1
background-foreground	background-foreground	JJ	1
background-free	background-free	NNP	1
background-free	background-free	JJ	1
background-leveled	background-leveled	JJ	1
background-leveling	background-leveling	JJ	1
background-staining	background-staining	JJ	1
background-subtracted	background-subtracted	JJ	13
background-subtracted	background-subtracted	NNP	1
backgrounder	backgrounder	NN	8
backgrounder	backgrounder	NNP	1
backgrounders	backgrounder	NNS	2
backgrounds	background	NNS	138
backgrounds	backgrounds	JJ	1
backgrounds-such	backgrounds-such	JJ	1
backguard	backguard	NN	1
backhand	backhand	NN	18
backhanded	backhanded	JJ	19
backhanded	backhanded	NNP	1
backhandedly	backhandedly	RB	1
backhands	backhand	NNS	2
backheel	backheel	NN	1
backhendl	backhendl	NNP	1
backhoe	backhoe	NN	2
backhoes	backho	NNS	2
backing	back	VBG	186
backing	backing	NN	51
backing	backing	NNP	6
backing-and-forthing	backing-and-forthing	JJ	1
backing-up	backing-up	JJ	1
backing-vocals-less	backing-vocals-less	JJ	1
backlands	backland	NNS	1
backlash	backlash	NN	139
backlash	backlash	NNP	17
backlashed	backlashed	JJ	1
backlashes	backlash	NNS	1
backless	backless	JJ	4
backless	backless	NNP	1
backlighting	backlight	VBG	2
backlist	backlist	NN	4
backlit	backlit	JJ	4
backlit	backlit	NNP	1
backlog	backlog	NN	54
backlogged	backlogged	JJ	4
backlogs	backlog	NNS	7
backlot	backlot	NN	1
backlund	backlund	NNP	1
backma	backma	NN	3
backness	backness	NNS	1
backoff	backoff	NN	1
backolog	backolog	NN	1
backordered	backordered	JJ	1
backpack	backpack	NN	36
backpack	backpack	NNP	1
backpacked	backpacked	JJ	2
backpacker	backpacker	NN	3
backpacker	backpacker	NNP	2
backpackers	backpacker	NNS	10
backpackers	backpacker	NNP	1
backpacking	backpack	VBG	27
backpacks	backpack	NNS	25
backpacks	backpacks	UNC	1
backpedal	backpedal	NN	1
backpedaled	backpedaled	JJ	1
backpedaling	backpedal	VBG	7
backpedalling	backpedall	VBG	1
backpeddalling	backpeddall	VBG	1
backpropagation	backpropagation	NN	2
backrest	backrest	NN	1
backroad	backroad	NN	1
backroads	backroad	NNS	2
backroom	backroom	NN	11
backrooms	backroom	NNS	2
backrub	backrub	NN	2
backrubbing	backrub	VBG	1
backs	back	NNS	114
backs	back	VBZ	108
backs	back	NNP	6
backscattered	backscattered	JJ	3
backscattered	backscattered	NNP	1
backseat	backseat	NN	30
backseat	backseat	NNP	1
backseats	backseat	NNS	3
backsent	backsent	NN	1
backshadowing	backshadow	VBG	1
backshops	backshop	NNS	1
backside	backside	NN	13
backside	backside	NNP	1
backside-to	backside-to	JJ	1
backsides	backside	NNS	5
backslapping	backslap	VBG	5
backslappy	backslappy	NN	1
backslash-column	backslash-column	NNP	1
backslid	backslid	NN	3
backslid-smoking	backslid-smoking	JJ	1
backslide	backslide	NN	1
backsliding	backslide	VBG	8
backsolver	backsolver	NN	1
backspace	backspace	NN	1
backspin	backspin	NN	7
backspins	backspin	NNS	1
backstabbage	backstabbage	NN	1
backstabbing	backstab	VBG	3
backstabbing	backstabbing	NNP	2
backstage	backstage	RB	45
backstage	backstage	NNP	8
backstitch	backstitch	NN	1
backstitches	backstitch	NNS	1
backstop	backstop	NN	7
backstories	backstory	NNS	1
backstory	backstory	NN	40
backstory	backstory	NNP	5
backstreet	backstreet	NNP	18
backstreet	backstreet	NN	1
backstreets	backstreet	NNS	5
backstretch	backstretch	NN	8
backswamp	backswamp	NN	7
backswamps	backswamp	NNS	1
backswing	backsw	VBG	4
backto	backto	NN	1
backtrack	backtrack	NN	10
backtracked	backtracked	JJ	4
backtracking	backtrack	VBG	10
backtracking	backtracking	NNP	3
backtracks	backtrack	NNS	1
backup	backup	NN	151
backup	backup	JJ	11
backups	backup	NNS	15
backups	backup	NNP	2
backus	backus	NNP	14
backward	backward	RB	192
backward	backward	NNP	6
backward	backward	UNC	1
backward-beating	backward-beating	JJ	1
backward-facing	backward-facing	JJ	1
backward-looking	backward-looking	JJ	2
backward-pivot	backward-pivot	JJ	1
backward-slanted	backward-slanted	JJ	1
backwardness	backwardness	NNS	4
backwards	backward	JJ	143
backwards	backward	NNP	1
backwash	backwash	NN	3
backwater	backwater	NN	36
backwaters	backwater	NNS	7
backwith	backwith	NN	1
backwoods	backwoods	NNS	9
backword	backword	NN	6
backwords	backword	NNS	13
backwords	backword	NNP	3
backyard	backyard	NN	179
backyard	backyard	NNP	1
backyard-vehicles	backyard-vehicle	NNP	1
backyards	backyard	NNS	10
backyards	backyard	NNP	1
baclofen	baclofen	NN	7
baclofen	baclofen	NNP	2
bacome	bacome	NN	1
bacon	bacon	NN	130
bacon	bacon	NNP	56
bacon-and-cheese	bacon-and-cheese	JJ	1
baconao	baconao	NNP	2
baconburgare	baconburgare	NNP	1
baconwhores	baconwhore	NNP	2
bacopa	bacopa	NN	1
bacpac	bacpac	NNP	3
bacr	bacr	NNP	6
bacronyms	bacronym	NNS	1
bacs	bac	NNP	84
bacsik	bacsik	NNP	9
bacstitcher	bacstitcher	NNP	2
bacsu	bacsu	NNP	1
bact	bact	NNP	20
bact	bact	NN	1
bactalert	bactalert	NNP	1
bactec	bactec	NNP	1
bacteremia	bacteremium	NN	30
bacteremia	bacteremium	NNP	5
bacteremias	bacteremia	NNS	5
bacteremic	bacteremic	JJ	1
bacteria	bacteria	NNS	1104
bacteria	bacteria	NNP	108
bacteria	bacteria	UNC	1
bacteria-containing	bacteria-containing	JJ	1
bacteria-eating	bacteria-eating	JJ	1
bacteria-laden	bacteria-laden	JJ	1
bacteria-like	bacteria-like	JJ	2
bacteria-specific	bacteria-specific	JJ	2
bacterial	bacterial	JJ	718
bacterial	bacterial	NNP	59
bacterial-specific	bacterial-specific	JJ	3
bacterial-type	bacterial-type	JJ	1
bacterially	bacterially	RB	11
bacterially	bacterially	NNP	3
bacterially-derived	bacterially-derived	JJ	2
bacterially-expressed	bacterially-expressed	JJ	1
bacterial–insect	bacterial–insect	NN	1
bactericidal	bactericidal	NN	12
bactericidal	bactericidal	NNP	3
bacteriochlorophyll	bacteriochlorophyll	NN	1
bacteriocide	bacteriocide	NN	1
bacteriocytes	bacteriocyte	NNS	2
bacteriologic	bacteriologic	NNP	1
bacteriological	bacteriological	JJ	6
bacteriologically	bacteriologically	RB	1
bacteriologist	bacteriologist	NN	2
bacteriologists	bacteriologist	NNP	2
bacteriology	bacteriology	NN	3
bacteriolytic	bacteriolytic	JJ	2
bacteriome	bacteriome	NN	19
bacteriomes	bacteriome	NNS	4
bacteriophage	bacteriophage	NN	52
bacteriophage	bacteriophage	NNP	4
bacteriophages	bacteriophage	NNS	17
bacteriophages	bacteriophage	NNP	1
bacteriorhodopsin	bacteriorhodopsin	NN	2
bacteriostatic	bacteriostatic	JJ	2
bacterium	bacterium	NN	118
bacteroides	bacteroide	NNP	1
bacteroidetes	bacteroidete	NNP	1
bactine	bactine	NN	1
bacto	bacto	NNP	3
bacto-agar	bacto-agar	JJ	1
bacto-peptone	bacto-peptone	JJ	2
bacto-tryptone	bacto-tryptone	NNP	1
bactopeptone	bactopeptone	NN	1
bactria	bactrium	NN	1
bactrian	bactrian	NNP	1
baculogold	baculogold	NNP	1
baculometry	baculometry	NNP	2
baculoviral	baculoviral	NN	1
baculoviridae	baculovirida	NN	1
baculovirus	baculovirus	JJ	61
baculovirus	baculovirus	NNP	2
baculovirus-derived	baculovirus-derived	JJ	1
baculovirus-infected	baculovirus-infected	JJ	2
baculoviruses	baculovirus	NNS	14
baculoviruses	baculovirus	NNP	3
bad	bad	JJ	6747
bad	bad	NNP	302
bad	bad	RB	38
bad	bad	UNC	21
bad	bad	NN	1
bad-address	bad-address	JJ	2
bad-arrest	bad-arrest	JJ	1
bad-ass	bad-ass	JJ	16
bad-ass	bad-ass	NNP	2
bad-behaviour	bad-behaviour	JJ	1
bad-boy	bad-boy	JJ	7
bad-boy-meets-good-girl	bad-boy-meets-good-girl	JJ	1
bad-breathed	bad-breathed	JJ	1
bad-brother	bad-brother	JJ	1
bad-clothes	bad-clothe	JJ	1
bad-cockney-accent	bad-cockney-accent	JJ	2
bad-day	bad-day	JJ	1
bad-day-having	bad-day-having	NNP	1
bad-dream	bad-dream	JJ	1
bad-egg	bad-egg	JJ	1
bad-fan-fic-a-licious	bad-fan-fic-a-licious	JJ	1
bad-food	bad-food	JJ	1
bad-for-me	bad-for-me	JJ	1
bad-for-you	bad-for-you	JJ	1
bad-girl	bad-girl	JJ	1
bad-guy	bad-guy	JJ	3
bad-guys	bad-guy	JJ	2
bad-habit	bad-habit	JJ	1
bad-hop	bad-hop	JJ	1
bad-influence	bad-influence	JJ	1
bad-info	bad-info	JJ	1
bad-job	bad-job	JJ	1
bad-mannered	bad-mannered	JJ	2
bad-mouthed	bad-mouthed	JJ	1
bad-mouthing	bad-mouthing	JJ	4
bad-mouths	bad-mouth	JJ	1
bad-news	bad-new	JJ	2
bad-novel	bad-novel	JJ	1
bad-smelling	bad-smelling	JJ	1
bad-teeth	bad-teeth	JJ	1
bad-tempered	bad-tempered	JJ	2
bad-tempered	bad-tempered	NNP	1
bad-tv	bad-tv	JJ	1
bad-tv-that	bad-tv-that	JJ	1
bad-writing	bad-writing	JJ	1
bad-writing-contest	bad-writing-contest	NNP	1
bada	bada	NNP	5
bada	bada	NN	1
badaccent	badaccent	NN	1
badacsony	badacsony	NNP	4
badae	bada	NNP	1
badaguan	badaguan	NNP	1
badain	badain	NN	1
badalamenti	badalamentus	NNP	1
badaling	badaling	NNP	13
badalucco	badalucco	NNP	2
badang	badang	NNP	2
badar	badar	NN	1
badaracco	badaracco	NNP	2
badareeen	badareeen	NNP	1
badass	badass	NNS	26
badass	badass	NNP	5
badassed	badassed	JJ	2
badasses	badass	NNS	1
badassitude	badassitude	NN	1
badassness	badassness	NNS	1
badasswes	badassw	NNP	1
badawi	badawus	NNP	10
badbert	badbert	NN	1
badboy	badboy	NNP	1
baddeck	baddeck	NNP	3
baddeley	baddeley	NNP	2
badder	badder	NNP	1
badder	badder	NN	1
baddest	baddest	NN	6
baddie	baddie	NN	9
baddie	baddie	NNP	3
baddie	baddie	UNC	1
baddies	baddy	NNS	21
baddies	baddy	NNP	1
baddy	baddy	NN	2
bade	bade	NN	7
bade	bade	NNP	1
badel	badel	NNP	1
badella	badellum	NNP	2
badelt	badelt	NNP	1
baden	baden	NNP	8
badenheim	badenheim	NNP	1
badeparadies	badeparady	NNP	1
bader	bader	NNP	12
badesch	badesch	NNP	3
badfic	badfic	JJ	16
badfic	badfic	NNP	8
badfics	badfic	NNS	2
badge	badge	NN	50
badge	badge	NNP	6
badge	badge	UNC	1
badge-carrying	badge-carrying	JJ	1
badge-wearing	badge-wearing	JJ	1
badger	badger	NN	16
badger	badger	NNP	10
badgered	badgered	JJ	5
badgering	badger	VBG	9
badgers	badger	NNP	8
badgers	badger	NNS	2
badgers	badgers	UNC	1
badges	badge	NNS	25
badges	badge	NNP	4
badgett	badgett	NNP	2
badging	badge	VBG	2
badgir	badgir	NN	1
badgley	badgley	NNP	1
badgoodbad	badgoodbad	NN	1
badia	badium	NNP	3
badiale	badiale	NNP	1
badie	badie	NNP	2
badillo	badillo	NNP	1
badinage	badinage	NN	6
badlaa	badlaa	NNP	1
badlands	badland	NNP	6
badlands	badland	NNS	3
badler	badler	NNP	1
badly	badly	RB	546
badly	badly	UNC	4
badly	badly	NNP	2
badly	badly	NN	1
badly-coifed	badly-coifed	JJ	1
badly-fitting	badly-fitting	JJ	1
badly-spelled	badly-spelled	JJ	1
badlys	badly	NNS	1
badminton	badminton	NN	7
badminton	badminton	NNP	1
badminton-set-size	badminton-set-size	JJ	1
badmouth	badmouth	NN	2
badmouthing	badmouthe	VBG	5
badmouthing	badmouthing	NNP	1
badness	badness	NNS	16
badness	badness	NNP	2
badrakkhan	badrakkhan	NNP	1
badran	badran	NNP	2
badre	badre	NNP	1
bads	bad	NNS	7
bads	bad	NNP	4
badtrip	badtrip	NNP	1
badtv	badtv	NN	2
badtz-maru	badtz-maru	NNP	1
badtzmaru	badtzmaru	NNP	2
badtzmobile	badtzmobile	NNP	2
badu	badu	NNP	4
baduizm	baduizm	NNP	1
badump-bump	badump-bump	NNP	1
badung	badung	NNP	5
badwagon	badwagon	NN	1
badwater	badwater	NNP	1
bae	ba	NNP	3
baebe	baebe	NNP	1
baebe	baebe	NN	1
baebes	baebe	NNP	5
baec	baec	NNP	1
baecs	baec	NNP	52
baed	baed	JJ	1
baedeker	baedeker	NNP	2
baen	baen	NNP	1
baenen	baenen	NNP	4
baeomyces	baeomyce	NNS	3
baer	baer	NNP	8
baerga	baerga	NNP	7
baerlestraat	baerlestraat	NNP	2
baerlstraat	baerlstraat	NNP	1
baesler	baesler	NNP	1
baetica	baetica	NNP	3
baez	baez	NNP	9
baez	baez	UNC	1
baf	baf	NNP	2
baff	baff	NNP	1
baffert	baffert	NNP	24
baffin	baffin	NNP	4
baffle	baffle	NN	13
baffled	baffled	JJ	84
baffled	baffled	NNP	4
bafflement	bafflement	NN	8
bafflement	bafflement	UNC	1
bafflements	bafflement	NNS	1
baffler	baffler	NNP	6
baffles	baffle	NNS	20
baffling	baffling	JJ	26
baffling	baffling	NNP	2
baffoonish	baffoonish	NN	1
bag	bag	NN	690
bag	bag	NNP	42
bag	bag	UNC	1
bag-blind	bag-blind	JJ	1
bag-lady	bag-lady	JJ	2
bag-of-blood-girl	bag-of-blood-girl	NNP	3
bag-snatchers	bag-snatcher	JJ	1
bagain	bagain	NN	1
baganoff	baganoff	NNP	1
bagatelle	bagatelle	NNP	2
bagatellelike	bagatellelike	NN	1
bagbalm	bagbalm	NN	1
bagbound	bagbound	NN	2
bagby	bagby	NNP	1
bagdad	bagdad	NNP	3
bagdikian	bagdikian	NNP	3
bagdogra	bagdogra	NNP	1
bage	bage	NN	2
bagehot	bagehot	NNP	3
bagel	bagel	NN	48
bagel	bagel	NNP	36
bagel-munching	bagel-munching	JJ	1
bagel-shaped	bagel-shaped	JJ	1
bagels	bagel	NNS	65
bagels	bagel	NNP	3
bagemihl	bagemihl	NNP	13
bagful	bagful	JJ	1
baggage	baggage	NN	122
baggage	baggage	NNP	5
baggage-check	baggage-check	JJ	1
baggage-handling	baggage-handling	JJ	1
baggage-screening	baggage-screening	JJ	2
baggages	baggage	NNS	1
bagge	bagge	NNP	4
bagged	bagged	JJ	18
bagged	bagged	UNC	2
bagger	bagger	NN	2
baggerly	baggerly	NNP	1
baggers	bagger	NNS	1
baggie	baggie	NN	4
baggie-full	baggie-full	JJ	1
baggies	baggy	NNS	2
bagging	bag	VBG	12
baggins	baggin	NNP	8
baggio	baggio	NNP	1
baggot	baggot	NNP	6
baggot	baggot	NN	1
baggotrath	baggotrath	NNP	1
baggy	baggy	NN	30
bagh	bagh	NNP	8
baghdad	baghdad	NNP	145
baghdad-based	baghdad-based	NNP	1
baghdad-by-the	baghdad-by-the	NNP	1
baghdadi	baghdadus	NNP	1
bagheera	bagheera	NNP	1
bagilishema	bagilishema	NNP	2
baginski	baginskus	NNP	1
bagless	bagless	JJ	1
bagli	baglus	NNP	1
bagmati	bagmatus	NNP	4
bagnoles	bagnole	NNP	1
bago	bago	NNP	1
bagos	bago	NNP	1
bagpipe	bagpipe	NN	3
bagpipe-playing	bagpipe-playing	JJ	1
bagpipean	bagpipean	NN	1
bagpipelike	bagpipelike	NN	1
bagpipes	bagpipes	NNS	12
bagpipes	bagpipes	NNP	2
bagram	bagram	NNP	5
bagru	bagru	NN	1
bags	bag	NNS	573
bags	bag	NNP	10
bags	bags	UNC	1
bags	bags	JJ	1
bagso	bagso	NN	1
baguette	baguette	NN	5
baguette	baguette	NNP	3
baguettes	baguette	NNS	5
bagunça	bagunça	NN	1
bagutta	bagutta	NNP	1
bagwell	bagwell	NNP	30
bah	bah	NNP	39
bah	bah	NN	11
bah-bah	bah-bah	JJ	1
bah-cah-rah	bah-cah-rah	JJ	1
bah-humbug	bah-humbug	JJ	1
bah-humbugging	bah-humbugging	JJ	1
baha	baha	NNP	6
bahadur	bahadur	NNP	5
bahadur	bahadur	NN	1
bahah	bahah	NNP	1
bahahah	bahahah	NNP	1
bahaji	bahajus	NNP	29
bahal	bahal	NNP	3
bahal	bahal	NN	1
baham	baham	NNP	1
bahama	bahama	NNP	30
bahamas	bahama	NNPS	145
bahamas	bahamas	UNC	1
bahamian	bahamian	NNP	51
bahamians	bahamian	NNP	12
bahamian–	bahamian–	NNP	1
bahang	bahang	NNP	4
bahara	bahara	NNP	1
baharian	baharian	NNP	1
baharians	baharian	NNP	1
bahasa	bahasa	NNP	7
bahbuh	bahbuh	NN	1
bahceli	bahcelus	NNP	4
bahera	bahera	NN	1
bahia	bahium	NN	18
bahia	bahium	NNP	6
bahler	bahler	NNP	1
bahn	bahn	NN	3
bahnhof	bahnhof	NNP	8
bahnhofstraße	bahnhofstraße	NNP	1
bahor	bahor	UNC	1
bahor	bahor	NNP	1
bahr	bahr	NNP	2
bahrain	bahrain	NNP	36
bahraini	bahrainus	NNP	1
bahre	bahre	NNP	26
bahres	bahr	NNP	4
bahri	bahrus	NNP	2
bahru	bahru	NNP	14
baht	baht	NN	8
baht	baht	NNP	1
bahtulism	bahtulism	NNP	1
bahutiers	bahutier	NNP	1
bahuvrihi	bahuvrihus	NN	2
bahía	bahía	NNP	10
bahú	bahú	NN	1
bai	baus	NNP	13
bai	baus	NN	3
bai-nara	bai-nara	JJ	1
baia	baium	NNP	1
baiada	baiada	NNP	4
baiae	baia	NNP	3
baibu	baibu	NN	1
baidi	baidus	NNP	1
baie	baie	NNP	4
baier	baier	NNP	3
baigent	baigent	NNP	1
baijuyi	baijuyus	NNP	1
baikingu	baikingu	NN	1
bail	bail	VB	83
bail	bail	NN	43
bail	bail	NNP	10
bail-bond	bail-bond	JJ	1
bail-bondsman	bail-bondsman	JJ	2
bail-bondsmen	bail-bondsman	NNP	1
bail-bondsmen	bail-bondsmen	JJ	3
bail-jumper	bail-jumper	JJ	1
bail-jumpers	bail-jumper	JJ	2
bail-out	bail-out	JJ	1
bail-outs	bail-out	JJ	1
baila	bailum	NN	1
baila	bailum	NNP	1
bailando	bailando	NNP	2
bailando	bailando	NN	1
bailar	bailar	NN	1
baile	baile	NN	10
baile	baile	NNP	2
bailed	bail	VBD	23
bailee	bailee	NN	1
bailes	baile	NNS	1
bailey	bailey	NNP	134
bailey-like	bailey-like	NNP	1
baileys	bailey	NNP	2
bailie	bailie	NNP	2
bailiff	bailiff	NN	3
bailiffs	bailiff	NNS	1
bailing	bail	VBG	20
bailiwick	bailiwick	NN	4
bailiwick	bailiwick	UNC	1
bailiwicky	bailiwicky	NN	1
baillie	baillie	NNP	1
baillif	baillif	NNP	1
bailly	bailly	NNP	2
bailor	bailor	NN	1
bailout	bailout	NN	53
bailout	bailout	NNP	3
bailouts	bailout	NNS	5
bailouts	bailout	NNP	1
bails	bail	NNS	2
bails	bail	NNP	1
bailén	bailén	NNP	1
baimasi	baimasus	NNP	1
bain	bain	NNP	20
bain	bain	NN	1
bain-aux	bain-aux	NNP	1
bainbridge	bainbridge	NNP	3
bainchoooch	bainchoooch	NN	1
baine	baine	NNP	4
baines	baine	NNP	2
bains	bain	NNP	4
baio	baio	NNP	2
bair	bair	NNP	1
bairam	bairam	NNP	2
baird	baird	NNP	6
bairn	bairn	NN	4
bairn	bairn	NNP	1
bairro	bairro	NNP	8
bairro	bairro	NN	2
bairstow	bairstow	NNP	2
baisch	baisch	NNP	2
baiser	baiser	NN	1
baishi	baishus	NNP	1
baisho	baisho	NNP	1
bait	bait	NN	118
bait	bait	NNP	10
bait-and-switch	bait-and-switch	JJ	3
bait-and-tackle	bait-and-tackle	JJ	1
baita	baita	NNP	1
baitashan	baitashan	NNP	1
baitasi	baitasus	NNP	1
baite	baite	NN	1
baited	baited	JJ	23
baiter	baiter	NN	1
baitfish	baitfish	NN	1
baitgate	baitgate	NNP	2
baith	baith	NNP	2
baiting	bait	VBG	11
baits	bait	NNS	5
baits	bait	NNP	3
baituo	baituo	NN	2
baitz	baitz	NNP	1
baiul	baiul	NNP	2
baix	baix	NNP	1
baixa	baixa	NNP	12
baixada	baixada	NNP	2
baixo	baixo	NNP	3
baiyuanguan	baiyuanguan	NNP	1
baiyunguan	baiyunguan	NNP	2
baiza	baiza	NNP	1
baize	baize	NNP	1
baj	baj	NNP	3
baj-csy	baj-csy	NNP	1
baja	baja	NNP	14
baja	baja	NN	3
bajada	bajada	NNP	1
bajaing	bajae	VBG	1
bajang	bajang	NNP	1
bajara	bajara	NN	1
bajau	bajau	NNP	2
bajcsy	bajcsy	NNP	1
bajillion	bajillion	NN	4
bajillionth	bajillionth	NN	1
bajillo	bajillo	NNP	1
bajo	bajo	NN	2
bajob	bajob	NNP	1
bajondillo	bajondillo	NNP	1
bajra	bajra	NN	1
bajra	bajra	NNP	1
bajrami	bajramus	NNP	1
bak	bak	NNP	26
bak	bak	NN	1
bak?rc?lar	bak?rc?lar	NNP	1
bak?rköy	bak?rköy	NNP	1
baka	baka	NNP	3
bakaly	bakaly	NNP	11
bakar	bakar	NNP	5
bakarbashat	bakarbashat	NNP	6
bakaxichuch	bakaxichuch	NN	1
bake	bake	NN	103
bake	bake	NNP	15
bake-off	bake-off	JJ	4
bake-off	bake-off	NNP	2
baked	baked	JJ	137
baked	baked	NNP	13
baked-on	baked-on	NNP	1
baked-on	baked-on	JJ	1
bakelite	bakelite	NNP	1
bakeoff	bakeoff	NN	3
baker	baker	NNP	252
baker	baker	NN	40
bakeries	bakery	NNS	12
bakeries	bakery	NNP	2
bakers	baker	NNS	15
bakers	baker	NNP	2
bakersfield	bakersfield	NNP	9
bakery	bakery	NN	50
bakery	bakery	NNP	5
bakes	bake	NNS	12
bakes	bake	NNP	2
bakes	bakes	UNC	1
bakesale	bakesale	NN	1
baketball	baketball	NN	1
bakewell	bakewell	NNP	1
bakhru	bakhru	NNP	1
bakhtar	bakhtar	NNP	1
bakhtin	bakhtin	NNP	2
bakija	bakija	NNP	1
bakila	bakilum	NNP	1
bakili	bakilus	NNP	2
baking	bake	VBG	157
baking	baking	NNP	16
baking-powder	baking-powder	JJ	1
bakis	baki	NNP	2
bakke	bakke	NNP	7
bakker	bakker	NNP	8
bakkumira	bakkumira	NN	1
bakkungan	bakkungan	NNP	1
baklava	baklava	NN	1
bako	bako	NNP	11
bakouris	bakouri	NNP	1
bakr	bakr	NNP	3
bakri	bakrus	NNP	2
baksait	baksait	NN	1
baksheesh	baksheesh	NN	2
bakshi	bakshus	NNP	3
baku	baku	NNP	7
bakufu	bakufu	NNP	1
bakula	bakulum	NNP	4
bak­lava	bak­lava	NN	1
bakócz-kápolna	bakócz-kápolna	NNP	1
bal	bal	NNP	101
bal	bal	NN	2
bal?ienas	bal?ienas	NNS	1
bal?k	bal?k	NNP	1
bala	balum	NN	1
bala	balum	NNP	1
balaban	balaban	NNP	3
balabanov	balabanov	NNP	1
balaclava	balaclava	NN	1
balaclava	balaclava	NNP	1
baladeur	baladeur	NN	1
balady	balady	NNP	1
balaff	balaff	NNP	1
balafi	balafus	NNP	1
balafkan	balafkan	NNP	1
balagan	balagan	NN	13
balagan	balagan	NNP	12
balagan-like	balagan-like	JJ	1
balaghat	balaghat	NN	1
balahana	balahana	NN	2
balahana	balahana	NNP	1
balahi	balahus	NN	1
balai	balaus	NNP	4
balai	balaus	NN	2
balaia	balaium	NNP	2
balalaikas	balalaika	NNS	1
balallythrough	balallythrough	NNP	1
balamúr	balamúr	NN	1
balamúrnik	balamúrnik	NN	1
balancanché	balancanché	NNP	2
balance	balance	NN	891
balance	balance	VB	171
balance	balance	NNP	57
balance	balance	UNC	3
balance-of-payments	balance-of-payment	NNS	3
balance-sheet	balance-sheet	NN	1
balance-wise	balance-wise	JJ	1
balanced	balance	VBN	34
balanced	balanced	JJ	312
balanced	balanced	NNP	22
balanced-budget	balanced-budget	JJ	26
balancedscorecard	balancedscorecard	NN	1
balancer	balancer	NN	4
balancers	balancer	NNS	1
balances	balance	NNS	111
balances	balance	VBZ	14
balances	balance	NNP	2
balances	balances	UNC	1
balancey-invested-demony	balancey-invested-demony	JJ	3
balanchine	balanchine	NNP	10
balancing	balance	VBG	95
balancing	balancing	NNP	18
balancing	balancing	NN	14
balancingly	balancingly	RB	1
balanini	balaninus	NNP	1
balanzat	balanzat	NNP	1
balart	balart	NNP	1
balasubramanian	balasubramanian	NNP	1
balat	balat	NNP	1
balata	bala	NNP	2
balaton	balaton	NNP	15
balatonalmádi	balatonalmádi	NNP	1
balatonföldvár	balatonföldvár	NNP	1
balatonfüred	balatonfüred	NNP	3
balb	balb	NNP	72
balboa	balboa	NNP	14
balboa	bal